A high-electricity-producing Geobacterium sulfurreducens strain based on GSU0024 gene knockout and its application
By knocking out the GSU0024 gene to construct a sulfur-reducing bacterium with high electricity production capacity, the problem of low electron transfer efficiency in the existing technology was solved, and more efficient electricity generation and pollutant degradation effects were achieved.
Patent Information
- Application Number
- CN202211579424.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-08
- Publication Date
- 2025-09-12
- Estimated Expiration
- 2042-12-08
AI Technical Summary
The electron transfer efficiency and bioreduction efficiency of existing Geobacter sulfurreducens are not ideal in production applications, which has become a bottleneck restricting its further development in bioelectrochemical systems.
By knocking out the GSU0024 gene, a high-electricity-producing Geobacter sulfur-reducing strain was constructed, enhancing its electron transfer efficiency and the bioreduction efficiency of environmental pollutants.
It significantly improves the power generation capacity and biological reduction capacity, forms a thicker and denser biofilm, and improves the efficiency of electron transfer and pollutant degradation.
Smart Images

Figure CN116240154B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biological genetic engineering, and in particular to a strain of Geobacterium sulfurreducens with high electricity production capacity based on GSU0024 gene knockout and application thereof. Background Art
[0002] Electroactive bacteria (EAB) are a type of microorganism that can transfer electrons generated by intracellular metabolism across the cell membrane to extracellular electron acceptors, thereby achieving extracellular respiration. Their unique extracellular electron transfer (EET) capability gives them great potential in energy recovery, wastewater treatment, and waste resource utilization. As research on the application of EAB in various bioelectrochemical systems deepens, it has been found that low EET efficiency has become a key bottleneck restricting their further development and application. To address this issue, a series of enhancement methods and strategies have been developed from different perspectives, including physics, chemistry, materials, and biotechnology.
[0003] Geobacter is the most prevalent and currently the most sought-after electroactive microorganism in nature, widely used in bioelectrochemical systems. Geobacter sulfurreducens PCA possesses high electrogenic and Fe(III) reduction capacities, a complete genome sequence, and comprehensive genetic manipulation tools. Therefore, it has become a natural model species for studying Geobacter metabolism, gene regulation, and extracellular electron transfer mechanisms. However, the reported electron transfer and bioreduction efficiencies of PCA remain suboptimal for production applications. Summary of the Invention
[0004] The primary purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide a strain of Geobacter sulfurreducens with high electricity production capacity; the strain is obtained by knocking out the GSU0024 gene, and the knockout of the GSU0024 gene can effectively enhance the electron transfer efficiency of PCA and the bioreduction efficiency of environmental pollutants.
[0005] Another object of the present invention is to provide the application of the above-mentioned Geobacter sulfurreducens with high electricity production capacity.
[0006] The object of the present invention is achieved by the following technical solution: a strain of Geobacter sulfurreducens with high electricity production capacity is obtained by knocking out the gene GSU0024;
[0007] The nucleotide sequence of the gene GSU0024 is shown in SEQ ID NO: 1.
[0008] The method for constructing the Geobacter sulfurreducens with high electricity production capacity comprises the following steps:
[0009] (1) Using the genome of Geobacter sulfurreducens PCA as a template, the upstream homology arm (GSU0024-UP) and downstream homology arm (GSU0024-DN) of the GSU0024 gene were amplified;
[0010] (2) Using pET-28a plasmid as template, amplify Kan + Gene;
[0011] (3) The upstream homology arm (GSU0024-UP) and downstream homology arm (GSU0024-DN) of the GSU0024 gene amplified in step (1) were combined with the kan + Gene upstream homology arm -kan + The gene-downstream homology arm sequence was ligated into pUC19 to construct the pUC19-Kan0024 plasmid;
[0012] (4) expanding the culture of the pUC19-Kan0024 plasmid constructed in step (3) and extracting it;
[0013] (5) Enzymatically digesting the plasmid extracted in step (4) and concentrating the linearized plasmid;
[0014] (6) The linearized plasmid concentrated in step (5) is transformed into competent cells to culture the Geobacter sulfurreducens with high electricity production capacity.
[0015] Preferably, the primers used to amplify the upstream homology arm (GSU0024-UP) of the GSU0024 gene in step (1) are as follows:
[0016] 0024-UP-F: 5'-cggtacccggggatcGCTTTTCCGTTTCCTTCG-3';
[0017] 0024-UP-R: 5'-gttccactgagcgtcCGGCCTCCCTTTCTCTATG-3'.
[0018] Preferably, the primers used to amplify the downstream homology arm (GSU0024-DN) of the GSU0024 gene in step (1) are as follows:
[0019] 0024-DN-F: 5'-aaataggggttccgcTGGTTCCTCTCCTTTTTG-3';
[0020] 0024-DN-R: 5'-cgactctagaggatcAGCGGATCGCTTTTGTCT-3'.
[0021] Preferably, the PCR reaction system for amplifying the upstream homology arm (GSU0024-UP) and the downstream homology arm (GSU0024-DN) of the GSU0024 gene in step (1) is as follows: 1 μL of template; 0.5 μL of each of the front and back primers; 12.5 μL of high-fidelity PCR enzyme; and filled up to 25 μL with sterile water.
[0022] Preferably, the PCR reaction conditions for amplifying the upstream homology arm (GSU0024-UP) and the downstream homology arm (GSU0024-DN) of the GSU0024 gene in step (1) are as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 52°C for 5 s, extension at 72°C for 1 min, 35 cycles; and full extension at 72°C for 10 min.
[0023] Preferably, in step (2), Kan is amplified + The primers used for the genes are as follows:
[0024] Kan r: 5'-GACGCTCAGTGGAACGAA-3';
[0025] Kan f: 5'-GCGGAACCCCTATTTGTT-3'.
[0026] The sequence of the pUC19-Kan0024 plasmid described in step (3) is shown in SEQ ID NO: 2.
[0027] The expansion culture described in step (4) is preferably to transform the pUC19-Kan0024 plasmid into Escherichia coli DH5α and expand the culture at 37°C in a shaking incubator.
[0028] The extraction described in step (4) is preferably performed in large quantities using a plasmid extraction kit.
[0029] The specific steps of the enzyme linearization described in step (5) are as follows: locate a unique enzyme cutting site ScaI on the plasmid and perform single enzyme cutting with the corresponding restriction endonuclease.
[0030] Preferably, the concentration of the linearized plasmid in step (5) is such that the concentration of the linearized plasmid is ≥1 μg / μL.
[0031] The specific steps for transforming competent cells in step (6) are as follows: Place the competent cells on ice, add the concentrated linearized plasmid, mix gently, and then transfer to a pre-chilled electroporation cuvette. Perform electroporation in the electroporation cuvette, add a small amount of reduced NBAF medium to the electroporation cuvette, resuspend the competent cells, and then inoculate them into NBAF medium for culture.
[0032] The competent cells are preferably PCA competent cells.
[0033] The electroporation operation conditions are preferably: electric field strength of 1.47 kV / cm; time constant of 5 ms.
[0034] The reduced NBAF medium is prepared by the following steps: adding 2% yeast extract based on the volume of the NBAF medium to the NBAF medium, and then adding 2% 100 mM cysteine based on the volume of the NBAF medium to fully reduce the medium.
[0035] The NBAF medium comprises the following components: 4.64 g / L fumaric acid, 0.04 g / L CaCl2·2H2O, 0.1 g / L MgSO4·7H2O, 1.8 g / L NaHCO3, 0.5 g / L Na2CO3·H2O, 2.04 g / L sodium acetate trihydrate, 10 mL / L non-metallic salt mixture (100×NB Salts), 10 mL / L metal salt mixture (NB Mineral Elixir), 15 mL / L vitamin mixture (DL Vitamins), and 0.5 mL / L 0.1% (m / v) resazurin;
[0036] The NBAF culture medium also includes water.
[0037] The non-metallic salt mixture includes the following components: 42g / L KH2PO4, 22g / L K2HPO4, 20g / L NH4Cl, 38g / L KCl and 36g / L NaCl.
[0038] The non-metallic salt mixture also includes water.
[0039] The metal salt mixture is prepared as follows: first, ultrapure water is added to a beaker, NTA (nitrilotriacetic acid) is added, and the pH of the solution is adjusted to 6.5-7.0 with high-concentration NaOH, and then the pH of the solution is adjusted to 8.0-8.5 with low-concentration NaOH; MoCl2·4H2O, FeSO4·7H2O, CoCl2·6H2O, ZnSO4·7H2O, CuCl2·2H2O, AlK(SO4)2·12H2O, H3BO3, Na2MoO4·2H2O, NiSO4·6H2O and Na2WO4·2H2O are added to the pH-adjusted solution in sequence, and the mixture is stirred to dissolve. After all the reagents are dissolved, ultrapure water is used to make up the volume;
[0040] The amounts of the components of the metal salt mixture are preferably as follows: 2.14 g / L NTA (nitrilotriacetic acid), 0.1 g / L MoCl2·4H2O, 0.3 g / L FeSO4·7H2O, 0.17 g / L CoCl2·6H2O, 0.2 g / L ZnSO4·7H2O, 0.03 g / L CuCl2·2H2O, 0.005 g / L AlK(SO4)2·12H2O, 0.005 g / L H3BO3, 0.09 g / L Na2MoO4·2H2O, 0.11 g / L NiSO4·6H2O and 0.02 g / L Na2WO4·2H2O;
[0041] The high concentration of NaOH is preferably 10 mol / L NaOH;
[0042] The low concentration NaOH is preferably 2 mol / L NaOH.
[0043] The vitamin mixture comprises the following components: 0.002 g / L biotin, 0.005 g / L pantothenic acid, 0.0001 g / L vitamin B-12, 0.005 g / L p-aminobenzoic acid, 0.005 g / L lipoic acid, 0.005 g / L niacin, 0.005 g / L vitamin B1, 0.005 g / L riboflavin, 0.01 g / L vitamin B6 and 0.002 g / L folic acid.
[0044] The vitamin mixture also includes water.
[0045] The yeast extract was deoxygenated and sterilized with N2.
[0046] The culture conditions are preferably: temperature 30° C., and culture for more than 18 hours.
[0047] The application of the above-mentioned high-electricity-producing Geobacter sulfur-reducing bacteria in electricity generation.
[0048] The application of the above-mentioned high-electricity-producing Geobacter sulfur-reducing bacteria in bioreduction.
[0049] The present invention has the following advantages and effects compared to the prior art:
[0050] The present invention obtains a strain of Geobacter sulfurreducens with high electricity production capacity by knocking out the GSU0024 gene of Geobacter sulfurreducens PCA. Knocking out the GSU0024 gene can effectively enhance the electron transfer efficiency of PCA and the bioreduction efficiency of environmental pollutants. The strain can form a thicker and denser biofilm, and both electricity production and reduction capabilities are significantly improved. BRIEF DESCRIPTION OF THE DRAWINGS
[0051] Figure 1 This is the PCR verification graph of the mutant strain; lane A is the control strain PCA, and lane B is PCAΔOmpA.
[0052] Figure 2 : It is a comparison of the electricity generation capacity of the mutant strain PCAΔOmpA and the control strain PCA, where (a) is the it diagram of the mutant strain PCAΔOmpA and the control strain PCA in the bioelectrochemical system, and (b) is the comparison of the maximum current of the mutant strain PCAΔOmpA and the control strain PCA.
[0053] Figure 3 CLSM images of the mutant strain PCAΔOmpA and the control strain PCA.
[0054] Figure 4 It is the iron reduction result graph of mutant strain PCAΔOmpA and control strain PCA.
[0055] Figure 5 This is a graph showing the degradation of methyl orange dye by the mutant strain PCAΔOmpA and the control strain PCA. DETAILED DESCRIPTION
[0056] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.
[0057] Example 1 Amplification and cloning of gene GSU0024
[0058] The genomic DNA of Geobacter sulfurreducens PCA (purchased from the German Microbial Culture Collection) was extracted using a bacterial genomic DNA extraction kit (YDP302, purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.). PCA genomic DNA was used as a template and primers 0024-UP-F (5'-cggtacccggggatcGCTTTTCCGTTTCCTTCG-3') and 0024-UP-R (5'-gttccactgagcgtcCGGCTCCCTTTCTCTATG-3') were used to amplify the PCR reaction using a PCR amplifier (T100 The upstream homology arm of the GSU0024 gene (GSU0024-UP) was amplified by a PCR amplifier (T100 PCR instrument, Bio-Rad), and the downstream homology arm of the GSU0024 gene (GSU0024-DN) was amplified by a PCR amplifier (T100 PCR instrument, Bio-Rad) using primers 0024-DN-F (5'-aaataggggttccgcTGGTTCCTCTCCTTTTTG-3') and 0024-DN-R (5'-cgactctagaggatcAGCGGATCGCTTTTGTCT-3').
[0059] The PCR reaction system was as follows: 1 μL template; 0.5 μL each of the front and back primers; 12.5 μL of high-fidelity PCR enzyme (Takara); and the volume was made up to 25 μL with sterile water.
[0060] The PCR reaction conditions were as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 52°C for 5 s, extension at 72°C for 1 min, 35 cycles; and full extension at 72°C for 10 min.
[0061] When the PCR cycle is completed, a 1% agarose gel is used to confirm whether a single DNA fragment is obtained and to determine the recovery and purification method. A common agarose gel DNA recovery kit (TIANgel Midi Purification Kit DP209, purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) is used for purification. The purification steps are carried out according to the product instructions, and then the concentration of the PCR purified product is measured using a spectrophotometer (Thermo Fisher Scientific NanoDrop 2000). Using the pET-28a plasmid as a template, primers Kan r (5'-GACGCTCAGTGGAACGAA-3') and Kan f (5'-GACGCTCAGTGGAACGAA-3') are used to amplify Kan. + Using the In-Fusion cloning kit (In-Fusion HD Cloning Plus Kits, purchased from Takara bio), GSU0024-UP, kan+ The gene fragment and GSU0024-DN were connected to pUC19 to construct the pUC19-Kan0024 plasmid. The plasmid was then transformed into Escherichia coli DH5α and coated with Kan + The blue-white colony was screened on the plate. Single white colonies were selected and verified by PCR using primers M13F (5'-TGTAAAACGACGGCCAGT-3') and M13R (5'-CAGGAAACAGCTATGACC-3'). After sequencing was correct, the colonies were expanded and cultured in a shaking incubator at 37°C.
[0062] The sequence of the pUC19-Kan0024 plasmid is as follows:
[0063] TACGACGGCAGTGATTCGAGCTCGGTACCCGGGGATCGCTTTTCCGTTTCC
[0064] TTCGGCGAGGGTGCCTGCTCGGCCACCTTTTTCTGCAGCGCCTCGATCCCT
[0065] GTCTCGGCCTTGGCCAGTCGCTGGTCAAAGGCCGTGAGCCTGCGCTCCAG
[0066] ATCCTCTCGCAGGAGGATCAGATCGTCGCCCGGCTTCTTGGCGGCGAGCCC
[0067] AACGTCGTCCACCTTGCCCGCGAGCACCTGCATGTCCACCTTTATCCCGTC
[0068] CATGGCCGCCTGCAGGTCGGCCAGCCCCTTGCGTACTCCGGCCCGTCCCGT
[0069] ATCCAGATCCTTGAAAGAGCTTTCAATGCGTGCGGTCGCCTCGGTCCGGAC
[0070] GCCGCCGACCTCTTTCCTACCTGGAACTGGCGGTTTTTGAGTTCGTCTAG
[0071] ATCGCGCCGGACAACGTCCAGGTCACTGTTGGTGACACACCCTCCGAGGG
[0072] TGAAAAGGGCGAGGGCCGTCAAGGGCATGGTCAACTGTTTCATGGGATAA
[0073] TCGGTCTCCTTTTGCTGGAGCAACGGTGTCTTCATAGAGAAAGGGAGCCG
[0074] GACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAACAA
[0075] TAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATAT
[0076] TCAACGGGAAACGTCTTGCTCTAGGCCGCGATTAAATTCCAACATGGATGC
[0077] TGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCG
[0078] ACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAA
[0079] CATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTA
[0080] AACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTA
[0081] CTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCAT
[0082] TCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCT
[0083] GGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTT
[0084] AACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAAC
[0085] GGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTT
[0086] GAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCA
[0087] GTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTTGACGAGGGGA
[0088] AATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACC
[0089] AGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACA
[0090] GAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTG
[0091] CAGTTTCATTTGATGCTCGATGAGTTTTTCTAAGAATTAATTCATGAGCGGA
[0092] TACATATTTGAATGTATTTAAAAATAAACAAATAGGGTTCCGCTGGTTC
[0093] CTCTCCTTTTTGTTAATGCAGTGGTCGGGCGGGTACGACCCGCGCCGCGTC
[0094] AACGCGAACAATTATATAATGGAGATGCTTTTTCAATGGGTTAGGTA
[0095] ACTGCAAGTAAAAACGATGTCTTACCACCGTGGCGACCAAGTTGGGTGGG
[0096] ACGCTTTTCCCTTGCTTCGGTAGACCCGCGTCTGGCCGCTGCCGTCGGAAC
[0097] GCATGACGTAGATGGCTTCGCCTCCATCGCGGGTGGAACTGAACGTCAGA
[0098] AATCGCCCGTCCGGGGACCAACGGGGATGCTCGTTGCTCCCTTCGCTGGTA
[0099] AGGCGGGTGTCACCGGTTCCGTCCGTCGCAATGGAGTAGATCTGGAAGCC
[0100] CCCTTCCTGACGACAGTAGACGAGTCTGTCCCCCTTGGGCGACCAGCGGG
[0101] GCGAGACATTATAGGCGCCGCTGGTTGTGAGTCGCCGTACGTCGGAGCCG
[0102] TCGGCGTTCATGATGAATACCTGGGGCTTGCCGAGCCGGTCCGAGACAAA
[0103] AGCGATCCGCTATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTGGCGTAATCATGT; 38 to 557 bp are the upstream homology arm of the GSU0024 gene (GSU0024-UP), 558 to 1529 bp are the kan + gene, and 1530 to 2051 bp is the downstream homology arm of the GSU0024 gene (GSU0024-DN).
[0104] Example 2 Construction of expression plasmid and concentration
[0105] Plasmids were extracted and linearized. A plasmid extraction kit (AG21001, purchased from Acry Biotech) was used to extract large quantities of plasmids from DH5α. A unique restriction site, ScaI, was located on the plasmid, and single enzyme digestion was performed with the corresponding restriction endonuclease (purchased from New England Biotech). The digestion system and digestion conditions were the same as above. When the plasmid concentration was high, the amount of restriction endonuclease and the digestion time could be increased accordingly. Gel electrophoresis was used to determine whether the plasmid was completely linearized. If linearization was complete, the next step, plasmid concentration, could be performed directly. If not, the target band was excised from the gel and purified using the MiniBEST Agarose Gel DNA Extraction Kit (purchased from Takara Bio).
[0106] Concentrate the linearized plasmid to a concentration of ≥1 μg / μL. Add 10 μL of sodium acetate (3 M, pH 5.2) and mix thoroughly. Add 250 μL of pre-chilled anhydrous ethanol and mix thoroughly. Incubate at -20°C for >20 min, then centrifuge at 4°C (>12,000 g) for 30 min and discard the supernatant. Add 1 mL of pre-chilled 70% ethanol and mix thoroughly. Centrifuge at 4°C (>12,000 g) for 30 min and discard the supernatant. Add 500 μL of pre-chilled anhydrous ethanol and centrifuge at 4°C (>12,000 g) for 30 min and discard the supernatant. Remove all ethanol by air drying or vacuum drying. Resuspend the plasmid in 10 μL of sterile water and measure the plasmid concentration using a spectrophotometer (Thermo Fisher Scientific NanoDrop 2000).
[0107] Example 3 Mutant PCA-ΔOmpA and its verification
[0108] Preparation of reduced NBAF medium: Add yeast extract to 10 mL of NBAF medium to make the final yeast concentration 0.1%, then add 0.2 mL of cysteine (100 mM) to fully reduce the medium; obtain reduced NBAF medium.
[0109] Geobacter sulfurreducens PCA was cultured in NBAF medium until mid-logarithmic phase, and then competent cells were prepared (Liu Xing. Study on the Effects of Pili and Nanomaterials on Extracellular Electron Transport in Geobacter [D]. Nanjing: Southeast University, 2015: 75). In an anaerobic workstation, 25 μL of PCA electrocompetent cells were placed on ice. 1 μL of the linearized recombinant plasmid obtained in Example 2 was added (the concentration of the linearized recombinant plasmid in PCA electrocompetent cells was >1 μg / μL). The mixture was gently mixed and then transferred to a 4°C pre-cooled electroporation cuvette, avoiding the formation of bubbles. The electroporation cuvette was placed in an electroporator (1652100, Bio-Rad) for electroporation (1.47 kV / cm, 5 ms). A small amount of reduced NBAF medium was added to the cuvette to resuspend the competent cells. The cells were then inoculated into NBAF medium and cultured at 30°C for at least 18 h. After 18 hours, different volumes of bacterial liquid were aspirated and spread on NBAF agar plates containing 50 μg / mL kanamycin. At the same time, the bacterial liquid was inoculated into NBAF medium containing 50 μg / mL kanamycin as a backup, and the plates were continued to be spread after growth to the logarithmic phase. The above plates were cultured in a sealed box at 30°C. Colonies were formed in about 10 days. Several colonies were selected and inoculated into NBAF medium containing kanamycin for culture. The mutant strain was verified by PCR using primers verGSU0024f (5'-CTTCTCCTCGCCGTAGCT-3') and verGSU0024r (5'-TCGCACACTCGGTGTTGT-3'). After PCR verification, sequencing verification was performed. The results are as follows: Figure 1 The GSU0024 gene mutant was named PCA△OmpA.
[0110] The NBAF medium is composed of the following components: fumaric acid 4.64 g / L, CaCl2·2H2O 0.04 g / L, MgSO4·7H2O 0.1 g / L, NaHCO3 1.8 g / L, Na2CO3·H2O 0.5 g / L, sodium acetate trihydrate 2.04 g / L, 100×NBSalts 10 mL / L, NB Mineral Elixir 10 mL / L, DL Vitamins 15 mL / L, and 0.1% (m / v) resazurin 0.5 mL / L; the balance is ultrapure water.
[0111] The 100×NB Salts is a non-metallic salt mixture, and its preparation steps are as follows: weigh 42g KH2PO4, 22g K2HPO4, 20g NH4Cl, 38g KCl and 36g NaCl into a 1L beaker, add 800mL ultrapure water, stir to dissolve, and then dilute to 1L. The prepared solution is stored in a refrigerator at 4°C.
[0112] The NB Mineral Elixir is a mixture of metal salts, and its preparation steps are as follows: first, add about 800mL of ultrapure water to a 1L beaker, add 2.14g of NTA (nitrilotriacetic acid), adjust the solution pH to 6.5-7.0 with 10mol / L NaOH, and then use 2mol / L Adjust the pH of the solution to 8.0-8.5 with NaOH; add 0.1gMoCl2·4H2O, 0.3gFeSO4·7H2O, 0.17gCoCl2·6H2O, 0.2gZnSO4·7H2O, 0.03gCuCl2·2H2O, 0.005gAlK(SO4)2·12H2O, 0.005gH3BO3, 0.09gNa2MoO4·2H2O, 0.11gNiSO4·6H2O and 0.02gNa2WO4·2H2O to the solution with adjusted pH, stir to dissolve, and after all the reagents are dissolved, dilute to 1L with ultrapure water and store in a refrigerator at 4°C.
[0113] DL Vitamins is a vitamin mixture, and its preparation steps are as follows: weigh 0.002g biotin, 0.005g pantothenic acid, 0.0001g vitamin B-12, 0.005g p-aminobenzoic acid, 0.005g lipoic acid, 0.005g niacin, 0.005g vitamin B1, 0.005g riboflavin, 0.01g vitamin B6, and 0.002g folic acid, add 800mL of ultrapure water, stir to dissolve, and then dilute to 1L with ultrapure water. Store at 4°C in the dark.
[0114] Example 4 Comparison of electricity production capacity between mutant strains and control strains
[0115] The mutant strain PCA-ΔOmpA and the control strain PCA in Example 2 were cultured to mid-logarithmic phase using the NBAF medium in Example 3, and then inoculated into a single-chamber bioelectrochemical system with a three-electrode system at a ratio of 10% by volume, wherein the working electrode and the counter electrode were 30 mm * 15 mm * 15 mm rectangular graphite plates, and the reference electrode was a saturated calomel electrode.
[0116] The electrolyte solution was prepared as follows: 10 mL of DL Vitamin and 10 mL of DL Mineral were measured and 2.5 g of NaHCO₃, 0.06 g of NaH₂PO₄·H₂O, 0.25 g of NH₄Cl, 0.1 g of KCl, and 2.04 g of NaAC·3H₂O were weighed and dissolved in 800 mL of Milli-Q water. After all the reagents were dissolved, the volume was adjusted to 1 L with Milli-Q water.
[0117] DL Vitamins is a vitamin mixture, and its preparation steps are as follows: weigh 0.002g biotin, 0.005g pantothenic acid, 0.0001g vitamin B-12, 0.005g p-aminobenzoic acid, 0.005g lipoic acid, 0.005g niacin, 0.005g vitamin B1, 0.005g riboflavin, 0.01g vitamin B6, and 0.002g folic acid, add 800mL of ultrapure water, stir to dissolve, and then dilute to 1L with ultrapure water. Store at 4°C in the dark.
[0118] The preparation steps of DL Mineral are as follows: first, add about 800 mL of ultrapure water to a 1 L beaker, add 1.5 g / L NTA (nitrilotriacetic acid), adjust the pH of the solution to 6.5-7.0 with 10 mol / L NaOH, and then use 2 mol / L NaOH to adjust the pH of the solution to 8.0-8.5; then, add 0.5 g / L MnSO4·H2O, 1 g / L NaCl, 0.1 g / L FeSO4·7H2O, 0.1 g / L CaCl2·2H2O, 0.1 g / L CoCl2·6H2O, 0.13 g / L ZnCl2, 0.01 g / L CuSO4·5H2O, 0.01 g / L AlK(SO4)2·12H2 O, 0.01 g / L H3BO3, 0.025 g / L Na2MoO4·2H2O, 0.024 g / L Stir and dissolve NiCl2·6H2O and 0.025g / L Na2WO4·2H2O. After all the reagents are dissolved, use ultrapure water to make up to 1L.
[0119] The results are as follows Figure 2 The maximum current output of the mutant PCA-ΔOmpA was significantly increased.
[0120] Example 5 Comparison of electroactive biofilms of control strains and mutant strains
[0121] When the three-electrode system in Example 4 reached a stable current value, the working electrode was removed and the biofilm thickness and metabolic activity on the working electrode were compared using a laser confocal microscope (Zeiss LSM 800). The biofilm on the working electrode was stained with a bacterial cell viability assay kit (LIVE / DEAD BacLight Bacterial Viability kit, purchased from Thermo Fisher Scientific) and then imaged using a laser confocal microscope. The results are shown in Figure 4. Figure 3 As shown, the mutant strain formed thicker and denser biofilms than the control strain.
[0122] Example 6 Comparison of iron reducing ability between mutant strains and control strains
[0123] The mutant strain and the control strain of Example 3 were inoculated into a ferrihydrite culture medium, and the Fe(II) concentration was measured at regular intervals to analyze the reduction of Fe(III) by the strain. The steps of the Fe(II) determination method are as follows:
[0124] 1) Take 0.2 mL of ferrihydrite culture medium and add it to 0.5 mol / L hydrochloric acid for 15 min to obtain a digestion solution.
[0125] 2) Pipette 0.1 mL of the digestion solution obtained in step 1) and mix with 4.9 mL of phenanthroline to develop color.
[0126] 3) Measure the sample absorbance at 562 nm. Substitute the sample absorbance into the Fe(II) standard curve to determine the Fe(II) concentration. The Fe(II) standard solution is prepared with ammonium ferrous sulfate. The color development method for the standard solution with different concentration gradients is the same as above.
[0127] The ferrihydrite culture medium is composed of the following components: NaHCO3 2.5g / L, NH4Cl 0.25g / L, NaH2PO4·H2O 0.6g / L, KCl 0.1g / L, sodium acetate 1.23g / L, DL Vitamin 10ml / L, 1mM Na2SeO4 1mL / L, non-chelated DL Mineral Mix 10mL / L and iron gel 50mM
[0128] The non-chelated metal salt mixture (Non-Chelated DL Mineral Mix) consists of the following components: 3g / LMgSO4, 0.5g / L MnSO4·H2O, 1g / L NaCl, 0.1g / L FeSO4·7H2O, 0.1g / L CaCl2·2H2O, 0.1g / LCoCl2·6H2O, 0.13g / L ZnCl2, 0.01g / L CuSO4·5H2O, 0.01g / L AlK(SO4)2·12H2O, 0.01g / LH3BO3, 0.025g / L Na2MoO4·2H2O, 0.024g / L NiCl2·6H2O and 0.025g / L Na2WO4·2H2O; the balance is water.
[0129] The preparation steps of iron gel are as follows: add 108g FeCl3 to 600mL Milli-Q water and stir vigorously. After the FeCl3 is completely dissolved, use 10M NaOH to adjust the pH of the solution to neutral (add slowly and stir vigorously. When the pH is close to 7.0, use 1M NaOH to adjust the pH). Use Milli-Q water to centrifuge and wash the iron gel (4500×g, 20min) until the washing solution turns yellow or red, and store at 4°C in the dark.
[0130] The results are as follows Figure 4 As shown, the iron reducing ability of the mutant strain was higher than that of the control strain.
[0131] Example 7 Comparison of the Iron Methyl Orange Reducing Ability of the Mutant and Control Strains
[0132] Add 50 mL of mineral salt culture medium to a 100 mL anaerobic bottle, seal it with a butyl rubber stopper and an aluminum cap, and pass nitrogen to remove oxygen from the solution. Sterilize at high temperature and high pressure at 121°C for 20 minutes. After the anaerobic bottle cools to room temperature, use a disposable sterile syringe to inject sterile methyl orange solution and bacterial solution respectively. Samples are taken from the anaerobic bottle every 0.5 hours to analyze the mass concentration of methyl orange. Set up 3 parallel groups for each type of experiment. The absorbance OD of the bacterial solution of the reaction system 600 =0.05, and the initial concentration of methyl orange was 80 mg / L.
[0133] Determination of methyl orange mass concentration: Take 1 mL of solution from the anaerobic bottle and place it in a centrifuge tube. Centrifuge at 10,000 r / min for 1 minute. After centrifugation, filter the supernatant and dilute to an appropriate concentration. Use a spectrophotometer (UV-2600, Shimadzu, Japan) to measure the absorbance of the solution at a wavelength of 465 nm and calculate the methyl orange mass concentration by comparing it with the standard curve. The results are as follows: Figure 5 As shown, the mutant strain had a higher ability to degrade methyl orange than the control strain.
[0134] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. A strain of Geobacter sulfurreducens with high electricity production capacity, characterized in that: By knocking out Geobacter sulfurreducens ( Geobacter sulfurreducens ) PCA of gene GSU0024 was obtained; The nucleotide sequence of the gene GSU0024 is shown in SEQ ID NO:
1.
2. The method for constructing Geobacter sulfurreducens with high electricity production capacity according to claim 1, characterized in that: The steps include: (1) Using the genome of Geobacter sulfurreducens PCA as a template, amplify the upstream homology arm and downstream homology arm of the GSU0024 gene; (2) Using pET-28a plasmid as template, amplify Kan + Gene; (3) The upstream homology arm and downstream homology arm of the GSU0024 gene amplified in step (1) were combined with the kan + Gene upstream homology arm -kan + The gene-downstream homology arm sequence was ligated into pUC19 to construct the pUC19-Kan0024 plasmid; (4) Expanding the culture of the pUC19-Kan0024 plasmid constructed in step (3) and extracting it; (5) Enzyme digestion of the plasmid extracted in step (4) and concentrating the linearized plasmid; (6) The linearized plasmid concentrated in step (5) is transformed into competent cells to culture the sulfur-reducing bacteria with high electricity production capacity.
3. The method according to claim 2, wherein: The primers used to amplify the upstream homology arm of the GSU0024 gene in step (1) are as follows: 0024-UP-F: 5'-cggtacccggggatcGCTTTTCCGTTTCCTTCG -3'; 0024-UP-R: 5'-gttccactgagcgtcCGGCCTCCCTTTCTCTATG -3'; The primers used to amplify the downstream homology arms of the GSU0024 gene in step (1) are as follows: 0024-DN-F: 5'-aaataggggttccgcTGGTTCCTCTCCTTTTTG -3'; 0024-DN-R: 5'-cgactctagaggatcAGCGGATCGCTTTTGTCT -3'; Amplify Kan in step (2) + The primers used for the genes are as follows: Kan r: 5'-GACGCTCAGTGGAACGAA -3'; Kan f: 5'-GCGGAACCCCTATTTGTT-3'.
4. The method according to claim 2, wherein: The sequence of the pUC19-Kan0024 plasmid described in step (3) is shown in SEQ ID NO:
2.
5. The method according to claim 2, wherein: The PCR reaction system for amplifying the upstream homology arm and downstream homology arm of the GSU0024 gene in step (1) is as follows: 1 μL template; 0.5 μL each of the front and back primers; 12.5 μL high-fidelity PCR enzyme; and fill up to 25 μL with sterile water. The PCR reaction conditions for amplifying the upstream homology arms and downstream homology arms of the GSU0024 gene in step (1) were as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 52°C for 5 s, extension at 72°C for 1 min, and 35 cycles; full extension at 72°C for 10 min; The specific steps of enzyme linearization described in step (5) are as follows: locate a unique enzyme cutting site on the plasmid ScaI and perform single digestion with corresponding restriction enzymes; Concentrate the linearized plasmid as described in step (5) so that the concentration of the linearized plasmid is ≥1µg / µL.
6. The method according to claim 2, wherein: The specific steps of transforming competent cells in step (6) are as follows: placing competent cells on ice, adding concentrated linearized plasmid and gently mixing, and then transferring to a pre-cooled electroporation cuvette; performing electroporation on the electroporation cuvette, taking a small amount of reduced NBAF medium into the electroporation cuvette to resuspend the competent cells, and then inoculating them into NBAF medium for culture; The reduced NBAF medium is prepared by the following steps: adding 2% yeast extract based on the volume of the NBAF medium to the NBAF medium, and then adding 2% 100 mM cysteine based on the volume of the NBAF medium to fully reduce the medium.
7. The method according to claim 6, characterized in that: The competent cells are PCA electrocompetent cells; The electroporation operation conditions are as follows: electric field strength of 1.47 kV / cm; time constant of 5 ms; The culture conditions are: temperature 30°C, and culture for more than 18 hours.
8. The method according to claim 6, wherein: The yeast extract is deoxygenated and sterilized with N2; The NBAF culture medium comprises the following components: 4.64 g / L fumaric acid, 0.04 g / L CaCl2·2H2O, 0.1 g / L MgSO4·7H2O, 1.8 g / L NaHCO3, 0.5 g / L Na2CO3·H2O, 2.04 g / L sodium acetate trihydrate, 10 mL / L non-metallic salt mixture, 10 mL / L metal salt mixture, 15 mL / L vitamin mixture, and 0.5 mL / L 0.1% m / v resazurin; The non-metallic salt mixture comprises the following components: 42 g / L KH2PO4, 22 g / L K2HPO4, 20 g / L NH4Cl, 38 g / L KCl and 36 g / L NaCl; The metal salt mixture is prepared as follows: first, ultrapure water is added to a beaker, nitrilotriacetic acid is added, and the pH value of the solution is adjusted to 6.5-7.0 with high-concentration NaOH, and then the pH value of the solution is adjusted to 8.0-8.5 with low-concentration NaOH; MoCl2·4H2O, FeSO4·7H2O, CoCl2·6H2O, ZnSO4·7H2O, CuCl2·2H2O, AlK(SO4)2·12H2O, H3BO3, Na2MoO4·2H2O, NiSO4·6H2O and Na2WO4·2H2O are added to the solution with adjusted pH in sequence, and the mixture is stirred to dissolve. After all the reagents are dissolved, ultrapure water is used to make up the volume; The amounts of the components of the metal salt mixture are as follows: 2.14 g / L nitrilotriacetic acid, 0.1 g / L MoCl2•4H2O, 0.3 g / L FeSO4•7H2O, 0.17 g / L CoCl2•6H2O, 0.2 g / L ZnSO4•7H2O, 0.03 g / L CuCl2•2H2O, 0.005 g / L AlK(SO4)2•12H2O, 0.005 g / L H3BO3, 0.09 g / L Na2MoO4•2H2O, 0.11 g / L NiSO4•6H2O and 0.02 g / L Na2WO4•2H2O; The vitamin mixture comprises the following components: 0.002g / L biotin, 0.005g / L pantothenic acid, 0.0001g / L vitamin B-12, 0.005g / L p-aminobenzoic acid, 0.005g / L lipoic acid, 0.005g / L niacin, 0.005g / L vitamin B1, 0.005g / L riboflavin, 0.01g / L vitamin B6 and 0.002g / L folic acid.
9. Use of the Geobacter sulfurreducens with high electricity production capacity according to claim 1 in electricity generation.
10. Use of the Geobacter sulfurreducens with high electricity production capacity according to claim 1 in iron reduction or methyl orange degradation.