Sucrose phosphorylase mutant, encoding gene and application

Abstract

The present invention discloses a sucrose phosphorylase mutant, encoding gene and application. The mutant is obtained by a single point mutation of the arginine at position 137 of the wild-type sucrose phosphorylase whose amino acid sequence is shown in SEQ ID NO.2. The present invention significantly improves the catalytic activity and regional selectivity of the glycosylation site in the production of 2-α-glucosylglycerol using sucrose and glycerol as raw materials by introducing a point mutation at the 137th amino acid residue site of the wild-type sucrose phosphorylase derived from Lactobacillus reuteri, and reduces the synthesis of the byproduct 1-α-glucosylglycerol. The enzyme mutant LreSP-R137M has good application value in the production of 2-α-glucosylglycerol.

Description

(I) Technical field

[0001] The invention belongs to the field of genetic engineering, and specifically relates to a sucrose phosphorylase mutant, a coding gene and an application. (II) Background technology

[0002] Sucrose phosphorylase (SPase) is a class of GH13 family of glycoside hydrolases, with EC number 2.4.1.7, belonging to the transferase class, which can catalyze sucrose phosphorylation and its reversible reaction, and the reaction formula is: SPase has a wide range of receptor specificity and can transfer glucose groups to different receptors, including water, inorganic phosphate, small molecules containing alcoholic hydroxyl, phenolic hydroxyl or carboxyl groups. SPase performs well in the glycosylation of small molecules and can efficiently synthesize a variety of important glycoside compounds.

[0003] Glycerol glucoside is a glycoside compound formed by connecting glucose and glycerol through a glycosidic bond, including 2-α-glucosylglycerol (2-O-α-D-glucosylglycerol, 2-α-GG, also referred to as 2-glyceroglycoside, as shown in Formula 1) and 1-α-glucosylglycerol (1-O-α-D-glucosylglycero, 1-α-GG, also referred to as 1-glyceroglycoside, as shown in Formula 2). Among them, 2-α-GG is a natural osmotic protective substance spontaneously synthesized by plants and microorganisms under stress conditions. It can protect cells from damage in harsh environments such as high osmotic pressure, high temperature, drought and ultraviolet rays, and also has the effects of moisturizing and preventing ultraviolet damage to human skin. It has good application value in skin care cosmetics, cell freeze-drying, protein protection, etc.

[0004]

[0005] 2-α-GG can be obtained by catalyzing the transglycosylation reaction of glycerol and sucrose with sucrose phosphorylase, but due to the regional selectivity of the glycosylation site of the enzyme, a certain amount of byproduct 1-α-GG is produced while generating 2-α-GG. In the early stage, we screened a sucrose phosphorylase from Lactobacillus roseauii, which has very efficient glycerol glycosylation activity. It has good advantages in catalyzing the synthesis of 2-α-GG from glycerol and sucrose, including fast reaction rate and good thermal stability (International Journal of Biological Macromolecules 2022, 209: 376-384). However, its disadvantage is that the regional selectivity of the enzyme is not high, and it is necessary to modify the enzyme molecule to improve the regional selectivity during glycerol glycosylation, thereby improving its application performance. With the continuous advancement of enzyme molecule modification technology, computational simulation based on bioinformatics and semi-rational design of enzymes, combined with directed evolution and screening methods, can effectively modify the catalytic performance of enzymes, thereby innovating enzyme application technology. (III) Summary of the invention

[0006] The present invention aims to provide a sucrose phosphorylase mutant with good regional selectivity and its encoding gene, as well as its application in the enzyme-catalyzed preparation of 2-glycerol glycosides.

[0007] The technical solution adopted by the present invention is:

[0008] A sucrose phosphorylase mutant is obtained by single-point mutation of the 137th arginine of the wild-type sucrose phosphorylase with the amino acid sequence as shown in SEQ ID NO.2.

[0009] The active site residues of sucrose phosphorylase are a triplet consisting of two aspartic acid residues Asp and one glutamic acid residue Glu, which are highly conserved in sequence and structure. During the transglycosidic reaction of sucrose phosphorylase, the glucosidic bond of sucrose is first protonated by Glu, and Asp nucleophilically attacks the anomeric carbon atom on the glucose group to form a sucrose-enzyme covalent intermediate, and then releases D-fructose; then the glycosyl acceptor substrate nucleophilically attacks the glucosyl-enzyme covalent intermediate, and a glucose transfer reaction occurs to obtain a glycoside compound. Common glycosyl acceptor substrates include water, phosphate, oligosaccharides, and some substances containing phenolic hydroxyl groups, alcoholic hydroxyl groups, and carboxyl groups. By changing the residues around the active pocket, the side chain effect of the residues is affected, and the size and kinetic properties of the enzyme pocket are changed, thereby improving the catalytic activity of the enzyme to the substrate and the regional selectivity of the glycosylation site.

[0010] The wild-type sucrose phosphorylase (LreSP) shown in SEQ ID NO.2 is derived from Lactobacillus reuteri (GenBank: KRK51962.1) (International Journal of Biological Macromolecules 2022, 209: 376-384), which can efficiently glycosylate glycerol for the preparation of 2-glycerol glycosides, with a fast glycosylation rate and low hydrolysis activity on the product. However, 1-glycerol glycoside is generated as a byproduct during the enzyme catalysis process. The present invention molecularly modifies the catalytic activity and glycosylation site selection of the wild-type enzyme on the glycerol substrate, thereby obtaining a mutant with improved catalytic activity and significantly improved regional selectivity.

[0011] First, the sucrose phosphorylase LreSP gene was obtained by PCR amplification and cloned into the expression vector pET28a of Escherichia coli BL21 (DE3) for overexpression of the enzyme. Combined with enzyme three-dimensional structure computational simulation, site-directed mutagenesis was performed on the amino acid sites in the substrate structure pocket of sucrose phosphorylase LreSP that play a key role in substrate regioselectivity, and then enzyme mutants were screened after enzymatic comparative analysis.

[0012] Preferably, the amino acid sequence of the mutant is shown as SEQ ID NO.4.

[0013] The present invention also relates to genes encoding the sucrose phosphorylase mutants.

[0014] The coding gene of the sucrose phosphorylase mutant LreSP-R137M can be a gene sequence synthesized after codon optimization according to its amino acid sequence, or a gene sequence modified by site-directed mutagenesis after PCR amplification from the genome of Lactobacillus reuteri. Preferably, the nucleotide sequence of the gene coding for the enzyme mutant LreSP-R137M is shown in SEQ ID NO.3.

[0015] The invention also relates to a recombinant vector and a genetic engineering bacterium containing the coding gene.

[0016] The invention also relates to the application of the sucrose phosphorylase mutant in the preparation of 2-α-glucosylglycerol by microbial catalysis.

[0017] Specifically, the application is: constructing a genetically engineered bacterium containing the gene encoding the sucrose phosphorylase mutant, using wet bacteria obtained by fermentation culture of the genetically engineered bacteria or enzyme-containing cell fragmentation liquid obtained by crushing the bacteria as a catalyst, using glycerol as a substrate and sucrose as a glycosyl donor, to carry out a catalytic reaction to obtain the 2-α-glucosylglycerol.

[0018] The gene of the sucrose phosphorylase mutant can be cloned into an expression plasmid and transformed into a host cell, and after being induced to ferment and made into an enzyme preparation, it is used to catalyze the glycosylation of glycerol to prepare 2-glyceroglycoside. The expression plasmid and host cell are preferably pET28a plasmid and Escherichia coli BL21 (DE3) host cell, that is, to construct the recombinant bacterium E. coli BL21 (DE3) (pET28a-LreSP-R137M).

[0019] Preferably, in the whole-cell catalytic reaction system, the amount of bacteria added is 10-100 g / L (preferably 100 g / L), the concentration of glycerol is controlled at 1-3 mol / L (preferably 1.5 mol / L), the concentration of sucrose is controlled at 0.5-2 mol / L (preferably 1 mol / L), and the catalytic process is controlled at pH 6.0-7.5 (preferably pH 6.5) and temperature 30°C-60°C (preferably 50°C).

[0020] The sucrose phosphorylase mutant of the present invention catalyzes the glycosylation preparation of glycerol, and its 2-glycerol glycoside production rate is increased by 70.79% compared with the wild type, and the ratio of the product 2-glycerol glycoside to the total glycoside products (also known as the purity of the glycoside product) is greater than 95.44%. The calculation method of the glycoside product purity is the concentration of 2-glycerol glycoside / (the concentration of 2-glycerol glycoside+the concentration of 1-glycerol glycoside).

[0021] The beneficial effects of the present invention are mainly reflected in: the present invention provides a highly active sucrose phosphorylase mutant, which not only provides glycerol glycosylation activity, but also significantly improves the regional selectivity of glycosylation sites, that is, the glycoside purity of 2-α-GG is >95.44%, showing good industrial application performance. (IV) Description of the drawings

[0022] Figure 1 This is the reaction formula for the preparation of 2-α-glucosylglycerol catalyzed by sucrose phosphorylase.

[0023] Figure 2 This is the docking diagram of the receptor glycerol and wild-type sucrose phosphorylase.

[0024] Figure 3 This is the liquid chromatogram of the 2-α-glucosylglycerol standard sample.

[0025] Figure 4 This is a liquid chromatogram of the catalytic reaction liquid of glycerol glycosylation catalyzed by the wild-type sucrose phosphorylase LreSP.

[0026] Figure 5 This is a liquid chromatogram of the catalytic reaction liquid of glycerol glycosylation catalyzed by the sucrose phosphorylase mutant LreSP-R137M. (V) Specific implementation methods

[0027] In order to deepen the understanding of the present invention, the present invention will be further described in detail below in conjunction with specific embodiments. The embodiments are only used to explain the present invention and do not limit the protection scope of the present invention.

[0028] LB medium: yeast powder 5.0 g / L, peptone 10.0 g / L, NaCl 10.0 g / L, and the solvent is distilled water.

[0029] Fermentation medium: yeast powder 12.0 g / L, peptone 15.0 g / L, Na2HPO4·12H2O 8.9 g / L, KH2PO4 3.4 g / L, NH4Cl 2.67 g / L, Na2SO4 0.71 g / L, MgSO4·7H2O 0.49 g / L, kanamycin 50 μg / L, pH 7.0, solvent is distilled water.

[0030] Example 1: Cloning and expression of sucrose phosphorylase gene

[0031] The sucrose phosphorylase LreSP gene is amplified from the genome of a common probiotic Lactobacillus reuteri strain, such as the genome of Lactobacillus reuteri CICC 6118 strain, using PCR technology, and the amplification primers are LreSP-F and LreSP-R.

[0032] LreSP-F:

[0033] GCCTGGTGCCGCGCGGCAGCCATATGCCAATCAAAAATGAAGCAATGT LreSP-R:

[0034] GTCGACGGAGCTCGAATTCGGATCCCTATTTTTGTTCCATCACTTTTTCAC

[0035] The LreSP gene obtained by PCR amplification was separated and purified by agarose gel electrophoresis and used for ligation reaction. The plasmid pET-28a was extracted, and the plasmid was double-digested with restriction endonucleases Ncol / BamHI. After separation and purification by agarose gel electrophoresis, it was used for ligation reaction. The purified LreSP gene fragment and the purified linearized pET-28a plasmid were ligated using the ClonExpress II One Step Cloning Kit from Novezan. Take 10 μL of the ligation product and mix it with 100 μL of E. coli BL21 (DE3) competent cells. After placing it in an ice bath for 30 minutes, heat shock it in a 42°C water bath for 90 seconds. The competent cells after heat shock were spread on LB (containing 50 μg / mL Kana) plates. After growing in a 37°C incubator for 12 hours. The transformant was used for colony PCR verification, streaked and purified, and then inoculated into LB liquid medium for culture. The plasmid was extracted and sequenced for verification, and finally the recombinant strain E. coli BL21 (DE3) (pET-28a-LreSP) expressing wild-type sucrose phosphorylase LreSP was obtained, referred to as E. coli LreSP.

[0036] Inducible expression of sucrose phosphorylase LreSP. After streaking and culturing the strain E. coli LreSP from the preserved glycerol tube overnight, a single colony was inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C and 200 rpm. Inoculate into the fermentation medium at a 0.5% (v / v) inoculum, culture at 37°C for 2.5 hours; add IPTG with a final concentration of 1.0 mmol / L, adjust the culture temperature to 25°C, and continue fermentation for 5 hours to obtain a bacterial agent that overexpresses wild-type sucrose phosphorylase E. coli LreSP.

[0037] Example 2: Activity analysis of wild-type sucrose phosphorylase LreSP catalyzing glycosylation of glycerol to obtain 2-glyceroglycosides

[0038] Take 2 mL of the wild-type sucrose phosphorylase agent LreSP prepared by the above method, centrifuge at 10000×g for 10 min to collect the cells, and resuspend the cells in 1 mL of 0.1 mmol / L MES buffer at pH 6.5; add 1 mL of the reaction mother solution containing 1.0 mol / L sucrose and 1.5 mol / L glycerol, catalyze in a metal bath at 50°C and 1200 rpm for 2 h, and the catalytic solution is used for liquid chromatography analysis.

[0039] Liquid chromatography of the catalytic solution Figure 4As shown, after 2 hours of reaction, 39.28 g / L of 2-glyceroglycoside can be obtained, accounting for 84.75% of the total glyceroglycoside production. After 10 hours of reaction, the concentration of 2-glyceroglycoside is 128 g / L, accounting for 84.35% of the total glyceroglycoside production.

[0040] Liquid phase analysis method for catalytic liquid sampling:

[0041] 1) Sample pretreatment: The catalytic reaction solution was centrifuged at 12000×g for 1 min, and 200 μL of the supernatant was added to 800 μL of ultrapure water for dilution for liquid chromatography analysis.

[0042] 2) Liquid chromatography detection conditions: Chromatographic column: YMC-Pack Polyamine II; Mobile phase: acetonitrile: water = 75:25; Column temperature: 30°C; Injection volume: 10 μL; Isocratic elution flow rate: 1 mL / min; Detector: Shimadzu RID-20A; The elution time of 2-glycerol glycoside is about 10.8 min, and the elution time of 1-glycerol glycoside is about 11.8 min. The liquid chromatogram of the standard is as follows: Figure 3 As shown, from left to right are fructose, 2-glycerol glycoside (2-αGG), 1-glycerol glycoside (1-αGG), and glucose.

[0043] Example 3: Design of mutation sites of sucrose phosphorylase and construction and screening of mutants

[0044] In order to improve the regioselectivity of wild-type sucrose phosphorylase for the 2-hydroxyl group of glycerol, computer-aided design was used to select the site-directed mutation site of LreSP. The crystal structure of BadSP (PDB number: 1R7A) was used as a template (the template and the target protein sequence had a consistency greater than 30%), and the protein sequence of the target enzyme was modeled using SWISS-MODEL for protein three-dimensional structure. Simulation analysis was performed using protein three-dimensional structure analysis software and molecular docking software. Taking into account the docking results of sucrose phosphorylase and substrate, the characteristics of the enzyme's substrate binding pocket, the structural characteristics of the enzyme's substrate recognition region selection, and the enzyme's catalytic mechanism, the function of the arginine residue at position 137 of the amino acid sequence SEQ ID NO.2 was finally predicted: the site is on the Loop ring at the entrance of the enzyme's catalytic pocket, and the Loop ring is a key factor affecting the regioselectivity. The docking results show that the arginine at position 137 will interact with the 1-hydroxyl group of glycerol (such as Figure 2 Therefore, the amino acid at position 137 of SEQ ID NO.2 was preferentially used as a mutation analysis site.

[0045] According to the amino acid sequence shown in SEQ ID NO.2, saturation mutation primers for amino acid position 137 were designed, as shown in Table 1. Using the vector pET-28a-LreSP as a template, PCR amplification of the entire plasmid was performed, and the amplified band of the correct size was obtained after detection by 0.8% agarose gel electrophoresis. The PCR product was digested with restriction endonuclease DpnI for 1 hour, that is, the methylated plasmid template was digested. The digested PCR product was subjected to a one-step cloning method for ligation reaction, and then transformed into Escherichia coli BL21 (DE3) cells. After colony PCR verification and sequencing verification, a sucrose phosphorylase mutant with a mutation at the target site was obtained.

[0046] Table 1: Mutation primer design table based on multiple sequence alignment results

[0047]

[0048]

[0049] Example 4: Screening of a saturated mutant library of amino acid position 137

[0050] 19 mutants were obtained by site-directed mutagenesis at the 137th amino acid site described in SEQ ID NO.2, and the catalytic activity and substrate regioselectivity of the mutant enzymes were evaluated under the same catalytic conditions. The transformants on the plate were transferred to LB liquid medium containing 50 μg / mL kanamycin and cultured to the mid-logarithmic growth period. Then, the inoculation volume was transferred to the fermentation medium at 1% (v / v), cultured at 37°C for 3h; IPTG was added at a final concentration of 0.5mmol / L, the fermentation temperature was controlled at 25°C, and the fermentation was continued for 12h to obtain the bacterial agent after induced expression.

[0051] Take 2 mL of the cultured bacterial agent containing the esterase mutant, collect the cells by centrifugation at 10,000 × g for 10 min, and resuspend the cells in 1 mL of 0.05 M MES buffer at pH 6.5; add 1 ml of the reaction mother solution of 1 mol / L sucrose and 1.5 mmol / L glycerol, and catalyze in a metal bath at 50°C and 1200 rpm for 2 h. The catalytic solution is used for liquid chromatography analysis.

[0052] The concentration of synthesized 2-glycerol glycoside at 2 h of reaction was analyzed for enzyme activity comparison, where the ratio of 2-glycerol glycoside concentration to total glycoside products was used as a comparison of enzyme regioselectivity. The results of enzyme activity and glycosylation site regioselectivity analysis of wild-type LreSP and 19 LreSP mutants are shown in Table 2. Considering the substrate selectivity and enzyme catalytic rate, the LreSP-R137M mutant was the optimal mutant.

[0053] Table 2: Comparison of product concentration and glycoside product purity of the wild-type LreSP and 19 LreSP mutants after 2 h of catalytic reaction

[0054]

[0055] Example 5: Activity analysis of mutant sucrose phosphorylase LreSP-R137M in catalyzing glycerol glycosylation to obtain 2-glycerol glycosides

[0056] After streaking and culturing the strain E.coli LreSP-R137M from the preserved glycerol tube overnight, a single colony was inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C and 200 rpm. Inoculate into the fermentation medium at a 0.5% (v / v) inoculum, culture at 37°C for 2.5 hours; add IPTG with a final concentration of 1.0 mmol / L, adjust the culture temperature to 25°C, and continue fermentation for 5 hours to obtain a bacterial agent of the recombinant strain E.coli LreSP-R137M that overexpresses the sucrose phosphorylase mutant.

[0057] Take 2 mL of the bacterial agent of the sucrose phosphorylase mutant LreSP-R137M prepared by the above method, collect the cells by centrifugation at 10000×g for 10 min, and resuspend the cells in 1 mL of 0.1 mol / L MES buffer at pH 6.5; add 1 mL of the reaction mother solution containing 1.0 mol / L sucrose and 1.5 mol / L glycerol, and catalyze in a metal bath at 50°C and 1200 rpm for 2 h. The catalytic solution is used for liquid chromatography analysis.

[0058] Liquid chromatography of the catalytic solution Figure 5 As shown, after two hours of reaction, 70.77 g / L of 2-glyceroglycoside can be obtained, accounting for 95.58% of the total glyceroglycoside production. After 10 hours of reaction, the transglycosylation reaction is close to equilibrium, and the concentration of 2-glyceroglycoside is 221 g / L, accounting for 95.65% of the total glyceroglycoside production.

Claims

1. A sucrose phosphorylase mutant, the amino acid sequence of which is shown in SEQ ID NO.

4.

2. A gene encoding the sucrose phosphorylase mutant according to claim 1.

3. The gene according to claim 2, characterized in that The nucleotide sequence of the gene is shown in SEQ ID NO.

3.

4. A recombinant vector containing the gene according to claim 2.

5. A genetically engineered bacterium containing the gene according to claim 2.

6. Use of the sucrose phosphorylase mutant according to claim 1 in catalyzing glycerol glycosylation to prepare 2-α-glucosylglycerol.

7. The use according to claim 6, characterized in that The application is: constructing a genetically engineered bacterium containing a gene encoding a sucrose phosphorylase mutant having an amino acid sequence as shown in SEQ ID NO.4, using wet bacteria obtained by fermentation culture of the genetically engineered bacterium as a catalyst, using glycerol as a substrate and sucrose as a glycosyl donor, to carry out a catalytic reaction to obtain the 2-α-glucosylglycerol.

Images