A method for synthesizing nucleotide sugars catalyzed by enzymes

Abstract

The present invention discloses a method for enzymatically synthesizing nucleotide sugars, which belongs to the field of biotechnology. The present invention uses sucrose as a substrate, and generates uridine diphosphate glucose and fructose by sucrose synthase catalysis, fructose is catalyzed by mannose isomerase or lyxose isomerase to generate mannose, mannose is catalyzed by N-acetyhexose aminophosphokinase to generate mannose-1-phosphate, and mannose-1-phosphate is catalyzed by GDP-Man pyrophosphorylase to obtain guanosine diphosphate mannose. The present invention cascades modules for synthesizing UDP-Glc and synthesizing GDP-Man, uses cheap sucrose as a raw material, and simultaneously obtains UDP-Glc and GDP-Man in the shortest reaction route, thereby reducing the cost of synthesizing high-value-added oligosaccharides and glycosides.

Description

Technical Field

[0001] The invention relates to a method for synthesizing nucleotide sugars catalyzed by enzymes, and belongs to the field of biotechnology. Background Art

[0002] Nucleotide sugars are derivatives of nucleoside diphosphates or monophosphates with the hydroxyl groups of different monosaccharide anomeric forms. They are activated forms of monosaccharides (such as glucose, mannose, galactose, and fucose) and serve as sugar donors, providing the basic glycosyl units for the assembly of polysaccharide or oligosaccharide chains. The sequence and linkage of the glycosyl units contribute to the structural complexity and functional diversity of polysaccharides or oligosaccharides.

[0003] Polysaccharides or oligosaccharides, synthesized from nucleotide sugars, are a class of highly active biomacromolecules that participate extensively in biological processes. Polysaccharides are high-molecular-weight carbohydrates composed of at least ten monosaccharides, formed by glycosidic bonds. Polysaccharides have molecular weights ranging from tens of thousands to tens of millions, with structural units linked by glycosidic bonds. Common glycosidic bonds include α-1,4-, β-1,4-, and α-1,6-glycosidic bonds. Polysaccharides composed of identical monosaccharides are called homopolysaccharides, such as starch, cellulose, and glycogen; those composed of different monosaccharides are called heteropolysaccharides, such as gum arabic, which is composed of pentose and galactose. Oligosaccharides, also known as oligosaccharides, generally refer to polymers containing 2-10 glycosidic bonds, formed by the dehydration condensation of a monosaccharide hydroxyl group with another monosaccharide hydroxyl group. Oligosaccharides are indestructible by gastric acid and cannot be broken down by digestive enzymes. However, it can be fermented and utilized by bacteria in the intestines and converted into short-chain fatty acids and lactic acid, with little increase in blood sugar and blood lipids.

[0004] Uridine diphosphate glucose (UDP-Glc) and guanosine diphosphate mannose (GDP-Man) are core sugars used as sugar donors in the synthesis of polysaccharides and oligosaccharides. UDP-Glc is present in plants, animals, and microorganisms, serving as a glucose donor in the synthesis of sucrose, starch, glycogen, and other oligosaccharides and polysaccharides. It can also be converted into uridine diphosphate galactose and uridine diphosphate glucuronic acid. UDP-Glc can be converted into uridine diphosphate galactose (UDP-Gal) by the action of galactose epimerase, or into uridine diphosphate glucuronic acid (UDP-GlcA) by the catalysis of UDP-Glc dehydrogenase. Further conversion to uridine diphosphate xylose (UDP-Xyl) and uridine diphosphate arabinose (UDP-Ara) by the action of UDP-xylose synthase and UDP-xylose epimerase, respectively, is possible. These nucleotide sugars are common sugar donors in organisms and play an important role in cell growth. UDPG has also been used in the development of new drugs and new sweeteners. For example, UDPG is used as a glycosyl donor to synthesize the antibiotic BE-7585A via ORF-36-28 enzyme catalysis; 14C-UDPG labeled with the hexacarbon as the only glycosyl donor is used to synthesize the main glycoside of stevia via UDP glycosyltransferase catalysis.

[0005] GDP-Man is a glycosyl donor and metabolic intermediate found widely in various organisms. It is also an important precursor for the synthesis of guanosine diphosphate-fucose (GDP-Fuc). In prokaryotes, GDP-Man primarily participates in the biosynthesis of oligosaccharides such as O-antigens. In eukaryotes, it serves as an important glycosyl donor for protein glycosylation and a precursor for the biosynthesis of other sugar nucleotides. In some plants, it participates in the biosynthesis of vitamin C. Therefore, obtaining large quantities of pure GDP-Mannose would provide the essential material basis for glycoprotein production and laboratory research. However, the content of GDP-Mannose in organisms is generally very low, making it virtually impossible to obtain GDP-Mannose by isolating and purifying it from wild-type biological materials. In most organisms, the biosynthetic pathway of GDP-mannose is as follows: starting from mannose, mannose-6-phosphate is catalyzed by hexokinase, mannose-6-phosphate is converted into mannose-1-phosphate under the catalysis of phosphohexose isomerase, and GDP-mannose is finally synthesized under the action of GDP-mannose pyrophosphorylase using mannose-1-phosphate and GDP (GTP) as substrates.

[0006] Furthermore, nucleotide sugars are not only essential substrates for the synthesis of polysaccharides and oligosaccharides, but also important glycobiological materials for the structural and functional analysis of polysaccharides or oligosaccharides. Natural nucleotides are difficult to extract, and in vitro preparation through biotechnology has been a common approach in recent years. However, due to the complexity of the de novo synthesis pathway and the numerous reactions involved, the product yield is often low. Therefore, nucleotide sugars are still very expensive, which limits the research on polysaccharides and oligosaccharides in fields such as glycochemistry and glycobiology.

[0007] The advantages of stereoselectivity and regioselectivity of enzyme catalysis can be fully utilized by using enzymatic methods to prepare nucleotide sugars and combining them with glycosyltransferases to transfer the sugar groups on the nucleotide sugars to the sugar chains to prepare target poly / oligosaccharide molecules. Figure 1 The figure shows the common biosynthesis pathway for nucleotide sugars in organisms, also known as the de novo synthesis pathway. After glucose enters the cell, various nucleotide sugars are converted under the catalysis of a series of carbohydrases. GDP-Man can also be synthesized through phosphorylation of mannose and further pyrophosphorylation. GDP-Fuc, formed using GDP-Man as a substrate, participates in the formation of Lewis antigens and is also a key monosaccharide component of human milk oligosaccharides. In addition to the de novo synthesis pathway, researchers have discovered salvage pathways for the synthesis of UDP-Glc and GDP-Man, enabling the synthesis of nucleotide sugars in fewer steps. Sucrose synthase is widely used to prepare UDP-Glc. Using sucrose as a substrate, it catalyzes the one-step synthesis of UDP-Glc and produces fructose (Fru) as a byproduct. Similarly, mannose (Man) can be converted to Man-1-P in a single step under the action of anomeric carbonyl kinases, and then further catalyzed by GDP-Man pyrophosphorylase to produce GDP-Man. These salvage pathways involve fewer catalytic steps, making the in vitro cell-free synthesis of nucleotide sugars easier to control and optimize.

[0008] Currently, research on the synthesis of nucleotide sugars focuses on a series of UDP-nucleotide sugars centered around UDP-Glc, and on GDP-nucleotide sugars centered around GDP-Man, including GDP-Fuc. The synthesis of UDP-Glc requires two or three catalytic steps, starting with Glc. Synthesis of UDP-Glc using sucrose synthase requires only one catalytic step, but the sucrose conversion rate is less than 20%. For the synthesis of GDP-Man, the salvage pathway using Man as the starting material is the most convenient synthetic route. The two-step catalytic salvage pathway currently achieves a mannose conversion rate of approximately 10%. However, compared to the production of UDP-Glc using inexpensive sucrose, the cost of synthesizing GDP-Man remains relatively high. These factors have become bottlenecks hindering the rapid development of glycobiology. Summary of the Invention

[0009] [Technical Issues]

[0010] The technical problem addressed by this invention is how to integrate the synthesis of two core sugars, UDP-Glc and GDP-Man, to achieve simultaneous, efficient, and economical production of these two sugars via a simplified route. This will provide precursors for the synthesis of polysaccharides and oligosaccharides in glycobiology.

[0011] [Technical solution]

[0012] The present invention provides a method for jointly preparing UDP-Glc and GDP-Man, which comprises cascading modules for synthesizing UDP-Glc and synthesizing GDP-Man together, and obtaining UDP-Glc and GDP-Man simultaneously under the shortest reaction route. The specific synthetic route is as follows: Figure 10 shown.

[0013] Sucrose is used as a substrate and is catalyzed by sucrose synthase to produce uridine diphosphate glucose (UDP-Glc) and fructose. Fructose is catalyzed by mannose isomerase or lyxose isomerase to produce mannose. Mannose is catalyzed by N-acetylhexose phosphokinase to produce mannose-1-phosphate. Mannose-1-phosphate is catalyzed by GDP-Man pyrophosphorylase to produce guanosine diphosphate mannose (GDP-Man).

[0014] In the method for jointly preparing UDP-Glc and GDP-Man, the sucrose synthase (EC 2.4.1.13) used can be selected from plants such as Arabidopsis thaliana, Glycine max, Oryza sativa, Pisum sativum, Solanumtuberosum, Zea mays, cyanobacteria such as Anabaena variabilis, Chroococcidiopsis thermalis, Oscillatoria acuminata, and other bacterial sources such as Acidithiobacillus caldus, Nitrosomonaseuropaea, Denitrovibrio acetiphilus, and Melioribacter roseus. Sucrose synthase can transfer a glucose group from sucrose to uridine diphosphate (UDP) to form UDP-glucose (UDP-Glc) and fructose (Fru). It can also catalyze the reverse reaction, transferring a glucose group from UDP-glucose to fructose to form sucrose and UDP. The direction of the reaction is affected by the concentrations of sucrose and fructose. Sucrose synthase is optimized for catalytic activity at pH 6.0-7.0 and 25-60°C.

[0015] In the method for the combined preparation of UDP-Glc and GDP-Man, the mannose isomerase (EC 5.3.1.7) employed can be selected from Xanthomonas rubrilineans, Streptomyces aerocolorigenes, Mycobacterium smegmatis, Pseudomonas cepacia, Agrobacterium radiobacter, Thermobifida fusca, Marinomonas mediterranea, or Escherichia coli. The mannose isomerase is capable of converting D-fructose into D-mannose. The mannose isomerase exhibits catalytic activity suitably at pH 6.5-8.0 and 30-60°C.

[0016] In the method for the combined preparation of UDP-Glc and GDP-Man, the lyxose isomerase (EC 5.3.1.15) employed can be selected from Thermosediminibacter Oceani, Providencia stuartii, Thermoflavimicrobium dichotomicum, Bacillus licheniformis, or Dictyoglomus turgidum. The lyxose isomerase can efficiently catalyze the epimerization reaction between D-fructose and D-mannose. The lyxose isomerase exhibits catalytic activity at pH 6.5-7.5 and 35-75°C.

[0017] In the method for the combined preparation of UDP-Glc and GDP-Man, the N-acetylhexosamine phosphokinase (EC 2.7.1.162) used can be selected from Bifidobactetium longum or Bifidobactetium infantis. The N-acetylhexosamine kinase can catalyze the attachment of a phosphate group at the 1-position of fructose. The N-acetylhexosamine kinase is suitable for exhibiting catalytic activity at pH 7-9 and 30-55°C.

[0018] In the method for the combined preparation of UDP-Glc and GDP-Man, the GDP-Man pyrophosphorylase (EC 2.7.7.13) employed can be selected from Escherichia coli, Pyrococcus furiosus, or Ganoderma sinense. The GDP-Man pyrophosphorylase catalyzes the production of guanosine diphosphate-mannose using GTP and mannose-1-phosphate as substrates. The GDP-Man pyrophosphorylase is suitable for catalytic activity at pH 5.5-9 and 30-80°C.

[0019] The method for jointly preparing UDP-Glc and GDP-Man can adopt a cell factory method, an enzyme catalysis method or a whole cell catalysis method.

[0020] The cell factory method refers to the production of UDP-Glc and GDP-Man by utilizing the life activities of cells capable of expressing the enzymes required for the synthesis of UDP-Glc and GDP-Man under aerobic or anaerobic conditions.

[0021] The enzymatic catalysis method refers to starting from raw materials, using enzymes, with or without separation of intermediates, to catalyze the production of products; for example, the raw materials and enzymes required for the synthesis of UDP-Glc and GDP-Man are mixed, and UDP-Glc and GDP-Man are synthesized under a temperature, time, and buffer system suitable for the activity of the enzymes. After the reaction is completed, UDP-Glc and GDP-Man are separated; the enzymes can also be added sequentially or in batches according to the reaction sequence; the reaction temperature can be determined based on the optimal reaction temperature of the enzyme, which is between 30°C and 55°C.

[0022] The whole-cell catalytic method refers to the use of intact biological organisms (i.e., whole cells, tissues, or even individuals) as catalysts to catalyze reactions. Its essence is to use enzymes within the cell for catalysis, which can achieve an enzyme cascade reaction. The biological organism is capable of expressing the enzymes required for the synthesis of UDP-Glc and GDP-Man.

[0023] In one embodiment, when using the cell factory method, the desired pathway can be constructed (in whole or in part) into a common metabolic engineering model strain (Escherichia coli or Saccharomyces cerevisiae), and metabolic pathway construction can be performed using homologous recombination or gene editing technology. The enzyme gene can be integrated into the genome or genome integration can be combined with plasmid expression to achieve the construction of the pathway. When only a portion of the metabolic pathway is constructed, subsequent catalysis can be combined with whole-cell catalysis or enzymatic catalysis to achieve the final synthesis of the product.

[0024] In one embodiment, when an enzyme catalysis method is adopted, the enzyme can be in the form of a crude enzyme liquid, a purified enzyme liquid, a lyophilized powder, or an immobilized enzyme. The crude enzyme liquid refers to an unrefined liquid enzyme separated from the natural source of the enzyme, or an unrefined liquid enzyme separated from a recombinant cell or its metabolite or its culture; for example, a liquid enzyme separated from the intracellular or extracellular secretions of a genetically engineered bacterium. The purified enzyme liquid refers to an enzyme liquid that has been refined by at least two means of centrifugation, membrane separation, and precipitation. The lyophilized powder refers to a product that is produced by extracting the enzyme produced in the cells or tissues of an organism using physical or chemical methods and then freeze-dried to produce a product that still has catalytic activity.

[0025] In one embodiment, when an enzyme catalysis method is used, the enzyme catalyzes the reaction at a temperature, pH, enzyme concentration, and substrate concentration suitable for the enzyme to exert its activity, and inhibitors, activators, or cofactors are added as needed by the enzyme. The appropriate pH is usually achieved using a buffer. The temperature is between 30°C and 55°C, preferably 37°C. The concentration of the enzyme can be between 5-30U, preferably 25U. In the substrate, the concentration of UDP can be 200-300mM, preferably 200mM, the concentration of sucrose can be 200-800mM, preferably 500mM, the concentration of GTP can be 1-50mM, preferably 50mM, and the concentration of ATP can be 1-50mM, preferably 30mM. The cofactor can be MgCl2 or MnCl2, and the concentration can be 1-5mM, preferably 2mM. The buffer system can be selected from phosphate buffer (pH 5.5-6.5), Tris-HCl buffer (pH 6.0-7.0), and morpholineethanesulfonic acid buffer (pH 5.5-7.0).

[0026] In one embodiment, when the enzyme catalysis method is used, the enzyme is in a mixture containing sucrose, UDP, ATP, GTP, metal ions (Mg 2 + 、Mn 2+ ) in a buffer system.

[0027] In one embodiment, when an enzyme-catalyzed method is employed, after completion of the reaction, ion chromatography and size exclusion chromatography are combined, or chromatography combined with organic reagent precipitation, to remove impurities and purify the products UDP-Glc and GDP-Man. Completion of the reaction refers to exhaustion of the substrate or no further increase in product.

[0028] In one embodiment, when using an enzymatic method, genetically engineered bacteria are used to produce the required enzyme. For example, the gene encoding the enzyme is ligated to the multiple cloning site of an expression vector, and the recombinant expression vector is transferred into a host for expression. The host can be a commonly used prokaryotic expression system such as Escherichia coli, Bacillus licheniformis, or a eukaryotic expression system such as Pichia pastoris or Sacillus cerevisiae. The Escherichia coli can be selected from BL21(DE3) and K12. Optional expression vectors include the pET28 series and the pET20 series. Optional integration sites include EcoR I and Sac I. The Bacillus subtilis can be selected from WB600 and WB800. Optional expression vectors include pHY300-plk and pUB110. Optional integration sites include EcoR I and Hind III. The Pichia pastoris can be selected from GS115 and X33. Optional expression vectors include pPIC3.5K, pPIC9K, and pPICZα. Optional integration sites include Sac I, Sal I, and Not I. The Saccharomyces cerevisiae can be selected from: INVSc1, YM4217, the optional expression vectors include: pYES, pYC, and the optional integration sites include: EcoR I and Sac I.

[0029] In one embodiment, whole-cell catalysis utilizes the same methods used for enzymatic protein production, with cells or cell fragments added directly to the catalytic system. This essentially utilizes the enzymes present in the cells to perform catalysis.

[0030] [Beneficial Effects]

[0031] When the method of the present invention is used to simultaneously prepare UDP-Glc and GDP-Man, the synthesis reaction can be completed in a four-step catalytic process. Sucrose synthase catalyzes the decomposition of sucrose to form UDP-Glc, while its byproduct fructose provides the raw material for GDP-Man synthesis, eliminating the need for exogenous addition of Man, thereby facilitating the subsequent separation of the byproduct fructose. Furthermore, since the price of mannose is approximately 27 times that of sucrose, the cost of producing the same amount of UDP-Glc and GDP-Man using traditional methods would be significantly higher than this method. Therefore, the method of the present invention uses inexpensive sucrose as a raw material, which can reduce the cost of UDP-Glc and GDP-Man biosynthesis, thereby reducing the cost of synthesizing high-value-added polysaccharides and oligosaccharides.

[0032] In addition, because different enzymes have different catalytic conditions, the more reactions there are, the more catalytic conditions need to be considered, and sometimes even the reaction conditions need to be changed for each step to proceed. The method of the present invention involves only four enzymes, and the range of suitable reaction conditions is relatively close. The synthesis reaction can be carried out under uniform conditions, and each enzyme can also be in its more appropriate reaction conditions, thus ensuring the conversion rate of each step. In order to further improve the yield, the optimization of the reaction process is also clearer and simpler.

[0033] The UDP-Glc and GDP-Man prepared using the method of the present invention can be used to further synthesize nucleotide sugars such as UDP-glucuronic acid, UDP-xylose, UDP-arabinose, and GDP-fucose. They can also serve as important sugar donors to provide more economical and readily available raw materials for the synthesis of active polysaccharides (such as human milk oligosaccharides and glycosaminoglycans). UDP-Glc and GDP-Man can also be used in biological activity research to explore and improve their physiological functions and effects related to diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 De novo synthesis pathway of UDP-Glc and GDP-Man (Glc: glucose, Glc-6-P: glucose-6-phosphate, Glc-1-P: glucose-1-phosphate, UDP-Glc: uridine diphosphate glucose, Fru-6-P: fructose-6-phosphate, Man: mannose, Man-6-P: mannose-6-phosphate, Man-1-P: mannose-1-phosphate, GDP-Man: guanosine diphosphate mannose)

[0035] Figure 2 Liquid phase diagram of GDP-Man measurement in Example 1

[0036] Figure 3 Liquid phase diagram of UDP-Glc determination in Example 1

[0037] Figure 4 Mass spectrum of GDP-Man in Example 1

[0038] Figure 5 Chromatogram and mass spectrum of UDP-Glc of Example 1

[0039] Figure 6 GDP-Man chromatogram of Example 2

[0040] Figure 7 UDP-Glc chromatogram of Example 2

[0041] Figure 8 GDP-Man mass spectrum of Example 2

[0042] Figure 9 UDP-Glc mass spectrum of Example 2

[0043] Figure 10 Synthesis route of the present invention DETAILED DESCRIPTION

[0044] In the following examples, the definition and assay method for sucrose synthase activity is as follows: 1 unit (U) of enzyme activity is defined as the amount of enzyme required to produce 1 μmol of UDP-Glc in 1 minute using sucrose as the substrate. The UDP-Glc product was determined by high-performance liquid chromatography (HPLC) using a C18 column with a mobile phase of 40% tetrabutylammonium bromide at a flow rate of 1.51 mL / min, and detection was by UV detection.

[0045] In the following examples, the definition and assay method for mannose isomerase activity is as follows: 1 unit (U) of enzyme activity is defined as the amount of enzyme that catalyzes the production of 1 μmol of D-mannose in 1 minute using fructose as the substrate. The mannose product was determined using a CarboPac PA10 column, 20% NaOH as the mobile phase, and electrochemical detection at a flow rate of 1 mL / min.

[0046] In the following examples, the definition and assay method for N-acetylhexose phosphatase activity is as follows: 1 unit (U) of enzyme activity is defined as the amount of enzyme required to generate 1 μmol of Man-1-P in 1 minute using mannose as the substrate. The Man-1-P product was determined using a C18 column, a mobile phase consisting of 0.1% formic acid, a flow rate of 1 mL / min, and UV detection.

[0047] In the following examples, the definition and assay method for GDP-Man pyrophosphorylase activity is as follows: 1 unit (U) of activity is defined as the amount of enzyme required to generate 1 μmol of GDP-Man in 1 minute using Man-1-P as the substrate. The GDP-Man product was assayed using a C18 column, 0.1% formic acid as the mobile phase, a flow rate of 1 mL / min, and UV detection.

[0048] The product determination methods of UDP-Glc and GDP-Man used in the following examples are:

[0049] ①UDP-Glc

[0050] Molecular formula: C 15 H 24 N2O 17 P2, molecular weight: 566, structural formula:

[0051] ②GDP-Man

[0052] Molecular formula: C 16 H25 N5O 16 P2, molecular weight: 605, structural formula:

[0053] The determination of GDP-Man was performed using a C18 column, a mobile phase of 0.1% formic acid, a flow rate of 1 mL / min, and a UV detector. The determination of UDP-Glc was performed using a C18 column, a mobile phase of 40% tetrabutylammonium bromide, a flow rate of 1.51 mL / min, and a UV detector.

[0054] The expression vectors described in the following examples refer to vectors that are based on the basic skeleton of a cloning vector and have expression elements such as a promoter, RBS, and terminator added to enable the expression of the target gene, such as pET28a and pPIC9K.

[0055] The host described in the following examples refers to a microorganism that can transcribe and translate the expression vector to ultimately produce the target protein, such as Escherichia coli DE3 and Pichia pastoris GS115.

[0056] The heterologous expression described in the following examples refers to the process of constructing an exogenous gene into a commercial expression vector and transferring it into an expression host to transcribe and translate the target gene to obtain the target protein.

[0057] The homologous recombination described in the following examples refers to the recombination between the target fragment containing homologous sequences and the vector, thereby fusing the target gene to the expression vector.

[0058] The PCR described in the following examples refers to a method for selectively amplifying DNA or RNA fragments in vitro using primers.

[0059] The transformation described in the following examples refers to the transformation of exogenous expression plasmids into competent cells of the host by chemical methods or electroporation methods.

[0060] The induction described in the following examples refers to the addition of the inducer IPTG to the host, thereby enabling the promoter on the expression plasmid to initiate the transcription and translation of the downstream target gene.

[0061] Example 1:

[0062] In this example, Escherichia coli was used as a host to synthesize sucrose synthase, mannose isomerase, N-acetylhexose phosphokinase, and GDP-Man pyrophosphorylase, and these four enzymes were used to synthesize UDP-Glc and GDP-Man using sucrose as a substrate.

[0063] Sucrose synthase from Nitrosospira europaea was selected. The amino acid sequence of the enzyme is shown in UniProt ID: Q820M5. The following primers were used for amplification: upstream primer: ATGACCACGATTGACACACTCGCCA, downstream primer: TCATATCTCATGGGCCAGCCTG.

[0064] Mannose isomerase (aldose isomerase) from Escherichia coli was selected. The amino acid sequence of the enzyme is shown in GI:CDL26975.1. The following primers were used for amplification: upstream primer: ATGAAATGGTTTAACACCCTAAGCC, downstream primer: TTTCGCATTAATATCCAGCAGACC.

[0065] N-acetylhexose aminophosphokinase from Bifidobactetium longum was selected. The amino acid sequence of the enzyme is shown in GI:BAF73925. The following primers were used for amplification: upstream primer: ATGACCGAAAGCAATGAAGTTTTATTC, downstream primer: CCTGGCAGCCTCCATGATG.

[0066] GDP-Man pyrophosphorylase from Ganoderma sinense was selected, and the amino acid sequence of the enzyme was GI:PIL36047.1. The following primers were used for amplification: upstream primer: ATGTTCAAGCAGATCTTGGACGCC, downstream primer: CAGAAGTTGCTTCCA.

[0067] (1) Construction of expression vector

[0068] pET28a was selected as the expression vector and Escherichia coli DE3 (BL21) was selected as the host to heterologously express the genes encoding sucrose synthase, mannose isomerase, N-acetylhexose phosphokinase and GDP-Man pyrophosphorylase, respectively.

[0069] Select EcoR I and Sac I on pET28a as the sites for inserting the target gene and amplify the target gene so that it contains restriction enzyme sites. Double-digest pET28a and purify to obtain a linearized plasmid fragment. The target gene with restriction enzyme sites and the linearized plasmid fragment are ligated together through homologous recombination. The system used for homologous recombination contains: 1 μL of restriction enzyme-linear plasmid, 1 μL of target fragment, 2 μL of buffer, 1 μL of recombinase, and 5 μL of HO. Homologous recombination is carried out at 37°C for 30 minutes. The ligation product is then stored at -20°C.

[0070] The ligation product was transformed into competent Escherichia coli DE3 (BL21) and cultured at 37°C for 1 hour. The bacterial solution was then spread on a plate containing kanamycin resistance. After overnight culture, a single colony was picked and colony PCR was performed using universal primers. Colonies with positive PCR results were sequenced to verify the correct recombinant transformants (recombinant Escherichia coli BL21 (DE3)).

[0071] (2) Induced expression of target protein

[0072] The recombinant Escherichia coli BL21 (DE3) expressing sucrose synthase, mannose isomerase, N-acetylhexose aminophosphokinase, and GDP-Man pyrophosphorylase obtained in step (1) were induced to express: the recombinant transformants were cultured in a shake flask for 12 h, 1 mL of the bacterial solution was inoculated into 50 mL of fresh LB medium, and the culture was carried out at 37 ° C and 200 rpm until the OD 600 The induction agent IPTG was added to a final concentration of 0.2 mM and cultured at 16°C and 200 rpm for 30 hours. After induction, the cells were centrifuged and the precipitate was collected. The precipitate was processed with a cell disruptor and centrifuged again, and the supernatant was collected to obtain a crude enzyme solution for enzyme-catalyzed reactions. The LB solution formulation was: 10 g / L peptone, 5 g / L yeast extract, and 10 g / L NaCl.

[0073] (3) One-pot synthesis of nucleotide sugars

[0074] To a phosphate buffer (pH 6.5) containing 200 mM UDP, 500 mM sucrose, 50 mM GTP, 50 mM ATP, and 5 mM MgCl₂, 20 units of each crude enzyme solution of sucrose synthase, mannose isomerase, N-acetyhexose phosphokinase, and GDP-Man pyrophosphorylase were added and reacted at 37°C for 20 hours. After completion of the reaction, the reaction solution was analyzed by liquid chromatography-mass spectrometry (HPLC-MS). Under these reaction conditions, 175 mM UDP-Glc and 16 mM GDP-Man were catalyzed. The molar conversion of sucrose was 35% (product UDP-Glc).

[0075] The test results are shown in Figure 2-Figure 5 .

[0076] Example 2:

[0077] Sucrose synthase from Acidithiobacillus caldus was selected. The amino acid sequence of the enzyme is shown in UniProtKB: A0A059ZV61. The following primers were used for amplification: upstream primer: ATGATTGAAGCCCTGCGCCAA, downstream primer: TTATTCCATCGGGACTGCGTG.

[0078] Lyxose isomerase from Bacillus licheniformis was selected. The enzyme sequence is shown in Protein ID: WP_003179036.1. The following primers were used for amplification: upstream primer ATGAAGGTGACAAAGGAAG, downstream primer: AATTCTCCGGGTCTGTGAACACATCG.

[0079] N-acetylhexose aminophosphokinase from Bifidobacterium infantis was selected. The sequence of the enzyme is shown in PDBID: 4OCV_A. The following primers were used for amplification: upstream primer: ATGAACAACACCAATGAAGCCCTG, downstream primer: CTTGGTCGTCTCCATGACGTCG.

[0080] GDP-Man pyrophosphorylase from Escherichia coli was selected. The amino acid sequence of the enzyme is shown in GenBank AAC77846.1. The following primers were used for amplification: upstream primer: ATGGCGCAGTCGAAACTCTATCC, downstream primer: CGGCTCGTTCAGCAACGTCAG.

[0081] (1) Construction of expression vector

[0082] Using pET28a as the expression vector, EcoR I and Sac I were selected as insertion sites. Homologous recombination primers were designed, and the amplified product was purified after PCR. pET28a was double-digested with EcoR I and Sac I, and the linearized plasmid fragment was purified. The target fragment with the restriction enzyme cleavage sites was integrated into the expression plasmid. The homologous recombination system consisted of 1 μL of the linearized plasmid, 1 μL of the target fragment, 2 μL of buffer, 1 μL of recombinase, and 5 μL of HO. Mix thoroughly and react at 37°C for 30 minutes. The product can be stored at -20°C. The ligation product was transformed into competent Escherichia coli DE3 (BL21) cells. The transformation solution was plated on a plate containing kanamycin resistance. After overnight incubation, single colonies were picked and subjected to colony PCR using universal primers. Colonies with positive PCR results were verified by sequencing to obtain the correct recombinant transformants.

[0083] (2) Induced expression of target protein

[0084] Induced expression using Escherichia coli BL21 (DE3) as the host: After the transformant was cultured in a shake flask for 12 h, 1 mL was inoculated into 50 mL of fresh LB medium and cultured at 37°C and 200 rpm until the OD 600 The induction agent IPTG was added to a final concentration of 1 mM and cultured at 25°C and 200 rpm for 20 hours. After induction, the cells were centrifuged and the precipitate was collected. The precipitate was processed through a cell disruptor and centrifuged again, and the supernatant was collected to obtain a crude enzyme solution for enzyme-catalyzed reactions. The LB solution formulation is: 10 g / L peptone, 5 g / L yeast extract, and 10 g / L NaCl.

[0085] (3) One-pot synthesis of nucleotide sugars

[0086] To phosphate buffer (pH 6.5) was added 300 mM UDP, 800 mM sucrose, 50 mM GTP, 30 mM ATP, and 2 mM MgCl2. 20 U each of the crude enzyme solutions AD were added and the reaction was allowed to proceed at 37°C for 24 h. The reaction solution was analyzed by liquid chromatography-mass spectrometry. Under these reaction conditions, 285 mM UDP-Glc and 23 mM GDP-Man were catalyzed. The molar conversion of sucrose was 35.6% (product UDP-Glc).

[0087] Test results are shown in Figure 6-Figure 9 .

[0088] Example 3:

[0089] (1) Construction of expression vector

[0090] The preparation methods of sucrose synthase, mannose isomerase and N-acetylhexose phosphokinase are as described in Example 1.

[0091] For GDP-Man pyrophosphorylase from Ganoderma sinense, pPIC9k was used as the expression vector. Homologous recombination primers were designed based on the desired gene fragment and the multiple cloning site on the expression plasmid, using SnaBI and EcoRI as insertion sites. PCR amplification and purification of the product were performed. pPIC9k was double-digested to obtain a linearized vector plasmid. The target fragment was then integrated into the expression plasmid via homologous recombination. The homologous recombination system consisted of 1 μL of the linearized plasmid, 1 μL of the target fragment, 2 μL of buffer, 1 μL of recombinase, and 5 μL of HO. The mixture was mixed thoroughly and incubated at 37°C for 30 minutes. The product was further linearized with StuI and electroporated into a competent Pichia pastoris culture medium. The transformant was plated onto a plate containing G418 antibiotic and cultured overnight. After overnight culture, individual colonies were picked and subjected to colony PCR using universal primers. Colonies that tested positive for PCR were verified by sequencing to obtain recombinant transformants that were correctly sequenced.

[0092] (2) Induced expression of target protein

[0093] Induced expression in Pichia pastoris: Single colonies were transferred to BMGY solution and cultured in a shaker at 30°C, 200 rpm for 24 hours. The culture was centrifuged at 30°C, 6000 rpm for 10 minutes to collect the cells. The cells were resuspended in BMMY medium and cultured in a shaker at 30°C, 200 rpm for 5 days. During the induction process, 0.5% methanol (v / v) was added every 12 hours. After the induction, the fermentation broth was centrifuged, the supernatant was collected, and concentrated 5-fold using an ultrafiltration tube before use in the enzyme-catalyzed reaction. Among them, the BMGY formula is: yeast powder 10.0 g / L, peptone 20.0 g / L, 10×YNB 13.4 g / L, dipotassium hydrogen phosphate 3.0 g / L, potassium dihydrogen phosphate 11.8 g / L, and glycerol 10 mL / L; the BMMY formula is: yeast powder 10.0 g / L, peptone 20.0 g / L, 10×YNB 13.4 g / L, dipotassium hydrogen phosphate 3.0 g / L, and potassium dihydrogen phosphate 11.8 g / L.

[0094] (3) Enzyme-catalyzed synthesis of nucleotide sugars

[0095] 25 units of each of the aforementioned enzyme solutions (sucrose synthase, mannose isomerase, N-acetylhexose aminophosphokinase, and GDP-Man pyrophosphorylase) were added sequentially to the synthesis reaction system. Each step was allowed to react for 7-10 hours before the next enzyme was added. The temperature was determined based on the optimal reaction temperature of the enzyme. The reaction system was as follows: pH 6.5, 120 mM UDP, 280 mM sucrose, 30 mM GTP, 30 mM ATP, and 2 mM MgCl2. The final catalytic yield was 114 mM UDP-Glc and 10 mM GDP-Man. The molar conversion of sucrose was 40.7% (UDP-Glc product).

[0096] Example 4:

[0097] Sucrose synthase from Acidithiobacillus caldus was selected. The amino acid sequence of the enzyme is shown in UniProtKB: A0A059ZV61. The following primers were used for amplification: upstream primer: ATGATTGAAGCCCTGCGCCAA, downstream primer: TTATTCCATCGGGACTGCGTG.

[0098] Lyxose isomerase from Bacillus licheniformis was selected. The amino acid sequence of the enzyme is shown in Protein ID: WP_003179036.1. The following primers were used for amplification: upstream primer ATGAAGGTGACAAAGGAAG, downstream primer: AATTCTCCGGGTCTGTGAACACATCG.

[0099] N-acetylhexose aminophosphokinase from Bifidobacterium infantis was selected. The amino acid sequence of the enzyme is shown in PDB ID: 4OCV_A. The following primers were used for amplification: upstream primer: ATGAACAACACCAATGAAGCCCTG, downstream primer: CTTGGTCGTCTCCATGACGTCG.

[0100] GDP-Man pyrophosphorylase from Escherichia coli was selected. The amino acid sequence of the enzyme is shown in GenBank AAC77846.1. The following primers were used for amplification: upstream primer: ATGGCGCAGTCGAAACTCTATCC, downstream primer: CGGCTCGTTCAGCAACGTCAG.

[0101] (1) Construction of expression vector

[0102] pPIC9k was selected as the expression vector. Homologous recombination primers were designed based on the desired gene fragment and the multiple cloning site on the expression plasmid, using SnaBI and EcoRI as insertion sites. PCR amplification and purification of the product were performed. pPIC9k was double-digested to obtain a linearized vector plasmid. The target fragment was then integrated into the expression plasmid via homologous recombination. The homologous recombination system consisted of 1 μL of the linearized plasmid, 1 μL of the target fragment, 2 μL of buffer, 1 μL of recombinase, and 5 μL of HO. The mixture was mixed thoroughly and reacted at 37°C for 30 minutes. The product was further linearized with StuI and electroporated into a competent Pichia pastoris culture medium. The transformant was plated onto a plate containing G418 antibiotic resistance and cultured overnight. After overnight culture, individual colonies were picked and subjected to colony PCR using universal primers. Positive colonies were sequenced to confirm the correct recombinant transformants.

[0103] (2) Induced expression of target protein

[0104] Induced expression in Pichia pastoris: Single colonies were transferred to BMGY solution and cultured in a shaker at 30°C, 200 rpm for 24 hours. The culture was centrifuged at 30°C, 6000 rpm for 10 minutes to collect the cells. The cells were resuspended in BMMY medium and cultured in a shaker at 30°C, 200 rpm for 5 days. During the induction process, 0.5% methanol (v / v) was added every 12 hours. After the induction, the fermentation broth was centrifuged, the supernatant was collected, and concentrated 5-fold using an ultrafiltration tube before use in the enzyme-catalyzed reaction. Among them, the BMGY formula is: yeast powder 10.0 g / L, peptone 20.0 g / L, 10×YNB 13.4 g / L, dipotassium hydrogen phosphate 3.0 g / L, potassium dihydrogen phosphate 11.8 g / L, and glycerol 10 mL / L; the BMMY formula is: yeast powder 10.0 g / L, peptone 20.0 g / L, 10×YNB 13.4 g / L, dipotassium hydrogen phosphate 3.0 g / L, and potassium dihydrogen phosphate 11.8 g / L.

[0105] (3) One-pot synthesis of nucleotide sugars

[0106] The enzymes were added to the synthesis system in a ratio of A:B:C:D = 3:1:1:2, with 15 U of enzyme A. The reaction system was as follows: pH 5.5, 200 mM UDP, 500 mM sucrose, 50 mM GTP, 15 mM ATP, and 2 mM MgCl2. The reaction was carried out at 30°C for 24 hours, yielding 160 mM UDP-Glc and 5.2 mM GDP-Man. The molar conversion of sucrose to product UDP-Glc was 32%.

[0107] Example 5:

[0108] The preparation methods of sucrose synthase, mannose isomerase, N-acetylhexose phosphokinase and GDP-Man pyrophosphorylase are as described in Example 1.

[0109] (1) Immobilization of sucrose synthase

[0110] NmSuSy was immobilized using chitosan as a carrier. The specific immobilization conditions were as follows: 0.5% glutaraldehyde was added to 2 mL of 1 mg / mL enzyme solution to activate chitosan for 1 h, and the enzyme and chitosan were cross-linked at 10°C and 100 rpm for 46 h.

[0111] (2) Enzyme-catalyzed synthesis of nucleotide sugars

[0112] To a phosphate buffer (pH 6.5) containing 200 mM UDP, 500 mM sucrose, 45 mM GTP, 25 mM ATP, and 2 mM MgCl₂, 10 U of immobilized sucrose synthase and 25 U each of crude enzymes of mannose isomerase, N-acetylglucose phosphokinase, and GDP-Man pyrophosphorylase were added. The reaction was allowed to proceed at 40°C for 10 hours. After completion of the reaction, the reaction solution was analyzed by liquid chromatography-mass spectrometry (HPLC-MS). Under these reaction conditions, 150 mM UDP-Glc and 10 mM GDP-Man were catalyzed. The molar conversion of sucrose was 30% (product UDP-Glc).

[0113] Example 6:

[0114] The UDP-Glc prepared in Example 4 was used to generate uridine diphosphate galactose (UDP-Gal) under the action of galactose epimerase.

[0115] Example 7:

[0116] Combination of recombinant cells: Using Escherichia coli as a host, sucrose synthase, mannose isomerase, N-acetylhexose aminophosphokinase, and GDP-Man pyrophosphorylase are expressed and synthesized respectively. This combination of four recombinant cells can synthesize UDP-Glc and GDP-Man using sucrose as a substrate.

[0117] Sucrose synthase from Nitrosospira europaea was selected. The amino acid sequence of the enzyme is shown in UniProt ID: Q820M5. The following primers were used for amplification: upstream primer: ATGACCACGATTGACACACTCGCCA, downstream primer: TCATATCTCATGGGCCAGCCTG.

[0118] Mannose isomerase (aldose isomerase) from Escherichia coli was selected. The amino acid sequence of the enzyme is shown in GI:CDL26975.1. The following primers were used for amplification: upstream primer: ATGAAATGGTTTAACACCCTAAGCC, downstream primer: TTTCGCATTAATATCCAGCAGACC.

[0119] N-acetylhexose aminophosphokinase from Bifidobactetium longum was selected. The amino acid sequence of the enzyme is shown in GI:BAF73925. The following primers were used for amplification: upstream primer: ATGACCGAAAGCAATGAAGTTTTATTC, downstream primer: CCTGGCAGCCTCCATGATG.

[0120] GDP-Man pyrophosphorylase from Ganoderma sinense was selected, and the amino acid sequence of the enzyme was GI:PIL36047.1. The following primers were used for amplification: upstream primer: ATGTTCAAGCAGATCTTGGACGCC, downstream primer: CAGAAGTTGCTTCCA.

[0121] pET28a was selected as the expression vector and Escherichia coli DE3 (BL21) was selected as the host to heterologously express the genes encoding sucrose synthase, mannose isomerase, N-acetylhexose phosphokinase and GDP-Man pyrophosphorylase, respectively.

[0122] Select EcoR I and Sac I on pET28a as the sites for inserting the target gene and amplify the target gene so that it contains restriction enzyme sites. Double-digest pET28a and purify to obtain a linearized plasmid fragment. The target gene with restriction enzyme sites and the linearized plasmid fragment are ligated together through homologous recombination. The system used for homologous recombination contains: 1 μL of restriction enzyme-linear plasmid, 1 μL of target fragment, 2 μL of buffer, 1 μL of recombinase, and 5 μL of HO. Homologous recombination is carried out at 37°C for 30 minutes. The ligation product is then stored at -20°C.

[0123] The ligation product was transformed into competent Escherichia coli DE3 (BL21) and cultured at 37°C for 1 hour. The bacterial solution was then spread on a plate containing kanamycin resistance. After overnight culture, a single colony was picked and colony PCR was performed using universal primers. Colonies with positive PCR results were sequenced to verify the correct recombinant transformants (recombinant Escherichia coli BL21 (DE3)).

[0124] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims. SEQUENCE LISTING <110> Jiangnan University <120> A method for synthesizing nucleotide sugars catalyzed by enzymes <130> IBAA211269A <160> twenty four <170> PatentIn version 3.3 <210> 1 <211> 25 <212> DNA <213> Artificial sequence <400> 1 atgaccacga ttgacacact cgcca 25 <210> 2 <211> twenty two <212> DNA <213> Artificial sequence <400> 2 tcatatctca tgggccagcc tg 22 <210> 3 <211> 25 <212> DNA <213> Artificial sequence <400> 3 atgaaatggt ttaacaccct aagcc 25 <210> 4 <211> twenty four <212> DNA <213> Artificial sequence <400> 4 tttcgcatta atatccagca gacc 24 <210> 5 <211> 27 <212> DNA <213> Artificial sequence <400> 5 atgaccgaaa gcaatgaagttttattc 27 <210> 6 <211> 19 <212> DNA <213> Artificial sequence <400> 6 cctggcagcc tccatgatg 19 <210> 7 <211> twenty four <212> DNA <213> Artificial sequence <400> 7 atgttcaagc agatcttgga cgcc 24 <210> 8 <211> 15 <212> DNA <213> Artificial sequence <400> 8 cagaagttgc ttcca 15 <210> 9 <211> twenty one <212> DNA <213> Artificial sequence <400> 9 atgattgaag ccctgcgcca a 21 <210> 10 <211> twenty one <212> DNA <213> Artificial sequence <400> 10 ttattccatc gggactgcgt g 21 <210> 11 <211> 19 <212> DNA <213> Artificial sequence <400> 11 atgaaggtga caaaggaag 19 <210> 12 <211> 25 <212> DNA <213> Artificial sequence <400> 12 aattctcggg tctgtgaaca catcg 25 <210> 13 <211> twenty four <212> DNA <213> Artificial sequence <400> 13 atgaacaaca ccaatgaagc cctg 24 <210> 14 <211> twenty two <212> DNA <213> Artificial sequence <400> 14 cttggtcgtc tccatgacgt cg 22 <210> 15 <211> twenty three <212> DNA <213> Artificial sequence <400> 15 atggcgcagt cgaaactcta tcc 23 <210> 16 <211> twenty one <212> DNA <213> Artificial sequence <400> 16 cggctcgttc agcaacgtca g 21 <210> 17 <211> twenty one <212> DNA <213> Artificial sequence <400> 17 atgattgaag ccctgcgcca a 21 <210> 18 <211> twenty one <212> DNA <213> Artificial sequence <400> 18 ttattccatc gggactgcgt g 21 <210> 19 <211> 19 <212> DNA <213> Artificial sequence <400> 19 atgaaggtga caaaggaag 19 <210> 20 <211> 25 <212> DNA <213> Artificial sequence <400> 20 aattctcggg tctgtgaaca catcg 25 <210> twenty one <211> twenty four <212> DNA <213> Artificial sequence <400> twenty one atgaacaaca ccaatgaagc cctg 24 <210> twenty two <211> twenty two <212> DNA <213> Artificial sequence <400> twenty two cttggtcgtc tccatgacgt cg 22 <210> twenty three <211> twenty three <212> DNA <213> Artificial sequence <400> twenty three atggcgcagt cgaaactcta tcc 23 <210> twenty four <211> twenty one <212> DNA <213> Artificial sequence <400> twenty four cggctcgttc agcaacgtca g 21

Claims

1. A method for jointly preparing UDP-Glc and GDP-Man, characterized in that, Sucrose was used as substrate, Nitrosospiraeuropaea The sucrose synthase from the source catalyzes the production of uridine diphosphate glucose and fructose. Escherichia coli Mannose isomerase catalyzes the production of mannose, which is then Bifidobactetiumlongum The N-acetylhexose phosphokinase from the source catalyzes the production of mannose-1-phosphate, which is then Ganoderma sinense The GDP-Man pyrophosphorylase from the source catalyzes the conversion of guanosine diphosphate mannose; Nitrosospiraeuropaea The amino acid sequence of the sucrose synthase from the source is shown in UniProt ID: Q820M5. Escherichia coli The amino acid sequence of the mannose isomerase from the source is shown in GI: CDL26975.

1. Bifidobactetiumlongum The amino acid sequence of the N-acetylhexose phosphokinase from the source is shown in GI: BAF73925. Ganoderma sinense The amino acid sequence of the GDP-Man pyrophosphorylase from the source is GI: PIL36047.1; Alternatively, sucrose is used as a substrate. Acidithiobacilluscaldus The sucrose synthase from the source catalyzes the production of uridine diphosphate glucose and fructose. Bacillus licheniformis Lyxose isomerase from the source catalyzes the production of mannose, which is then Bifidobacterium infantis The N-acetylhexose phosphokinase from the source catalyzes the production of mannose-1-phosphate, which is then Escherichia coli The GDP-Man pyrophosphorylase from the source catalyzes the conversion of guanosine diphosphate mannose; Acidithiobacilluscaldus The amino acid sequence of the sucrose synthase from the source is shown in UniProtKB: A0A059ZV61. Bacillus licheniformis The lyxose isomerase sequence from the source is shown in Protein ID: WP_003179036.

1. Bifidobacterium infantis The sequence of the N-acetylhexose phosphokinase from the source is shown in PDB ID: 4OCV_A. Escherichia coli The amino acid sequence of the derived GDP-Man pyrophosphorylase is shown in GenBank AAC77846.

1.

2. A method for jointly preparing UDP-Glc and GDP-Man according to claim 1, characterized in that, Use cell factory method, enzyme catalysis method or whole cell catalysis method.

3. A method for jointly preparing UDP-Glc and GDP-Man according to claim 2, characterized in that, The cell factory method refers to the production of UDP-Glc and GDP-Man by utilizing the life activities of cells capable of expressing the enzymes required for the synthesis of UDP-Glc and GDP-Man under aerobic or anaerobic conditions.

4. A method for jointly preparing UDP-Glc and GDP-Man according to claim 2, characterized in that, The enzymatic catalysis method refers to starting from raw materials, using enzymes, with or without separation of intermediates, to catalyze the production of products.

5. A method for jointly preparing UDP-Glc and GDP-Man according to claim 2, characterized in that, The whole-cell catalytic method refers to the use of a complete biological organism or a combination of biological organisms as a catalyst to catalyze the reaction, wherein the biological organism expresses sucrose synthase, mannose isomerase or lyxose isomerase, N-acetylhexose phosphokinase, and GDP-Man pyrophosphorylase, and the combination of biological organisms is a combination of biological organisms that express one or more of sucrose synthase, mannose isomerase or lyxose isomerase, N-acetylhexose phosphokinase, and GDP-Man pyrophosphorylase, respectively.

6. A method for jointly preparing UDP-Glc and GDP-Man according to claim 2 or 3, characterized in that, When using the cell factory method, some or all genes of the synthetic pathway are constructed into metabolic engineering model strains using homologous recombination or gene editing technology.

7. A method for jointly preparing UDP-Glc and GDP-Man according to claim 2 or 4, characterized in that, When the enzyme catalysis method is adopted, crude enzyme solution, purified enzyme solution, lyophilized powder or immobilized enzyme is used.

8. A method for jointly preparing UDP-Glc and GDP-Man according to claim 2 or 4, characterized in that, When using the enzyme catalysis method, the enzyme catalyzes the reaction at a temperature, pH, enzyme concentration, and substrate concentration suitable for the enzyme's activity, and inhibitors, activators, or cofactors are added according to the needs of the enzyme.

9. A method for jointly preparing UDP-Glc and GDP-Man according to claim 8, characterized in that, The enzyme catalyzes the reaction in a buffer system containing sucrose, UDP, ATP, GTP, and metal ions.

10. A method for jointly preparing UDP-Glc and GDP-Man according to claim 9, characterized in that, When the enzyme catalysis method is used, after the reaction is completed, ion chromatography and exclusion chromatography are combined, or chromatography is combined with organic reagent precipitation to remove impurities and purify the products UDP-Glc and GDP-Man.

11. A method for jointly preparing UDP-Glc and GDP-Man according to claim 2 or 4, characterized in that, When using the enzyme catalysis method, genetically engineered bacteria are used to prepare the required enzymes.

12. Use of the method according to any one of claims 1 to 11 in the preparation of polysaccharides or oligosaccharides.

13. A recombinant cell or a combination of recombinant cells for the combined production of UDP-Glc and GDP-Man using sucrose as a substrate, characterized in that: The recombinant cell can express the enzymes required for synthesizing UDP-Glc and GDP-Man, and the enzymes include Nitrosospiraeuropaea Sucrose synthase from Escherichia coli Mannose isomerase Bifidobactetiumlongum N-acetylhexosamine phosphokinase and Ganoderma sinense GDP-Man pyrophosphorylase from a source, or Acidithiobacillus caldus Sucrose synthase from Bacillus lichen-like Threonose isomerase from Bifidobacterium infantis N-acetylhexosamine phosphokinase and Escherichia coli GDP-Man pyrophosphorylase from source; The combination of the recombinant cells can express the enzymes required for synthesizing UDP-Glc and GDP-Man, and is composed of Nitrosospira europaea Sucrose synthase from Escherichia coli Mannose isomerase from Ganoderma sinensis N-acetylhexose phosphokinase from Ganoderma sinensis The combination of recombinant cells expressing at least one of the GDP-Man pyrophosphorylases from the source, or the combination of recombinant cells capable of expressing the enzymes required for synthesizing UDP-Glc and GDP-Man, is obtained by expressing Acidithiobacillus caldus Sucrose synthase from Bacillus lichen-like Threonose isomerase from Bifidobacterium infantis N-acetylhexose phosphokinase from Escherichia coli obtained by combining at least one recombinant cell that produces a GDP-Man pyrophosphorylase from a source; Nitrosospira europaea The amino acid sequence of the sucrose synthase from the source is shown in UniProt ID: Q820M5. Escherichia coli The amino acid sequence of the mannose isomerase from the source is shown in GI: CDL26975.

1. Bifidobacterium longum The amino acid sequence of the N-acetylhexose phosphokinase from the source is shown in GI: BAF73925. Ganoderma sinensis The amino acid sequence of the GDP-Man pyrophosphorylase from the source is GI: PIL36047.1; Acidithiobacillus caldus The amino acid sequence of the sucrose synthase from the source is shown in UniProtKB: A0A059ZV61. Bacillus licheniformis The lyxose isomerase sequence from the source is shown in Protein ID: WP_003179036.

1. Bifidobacterium infantis The sequence of the N-acetylhexose phosphokinase from the source is shown in PDB ID: 4OCV_A. Escherichia coli The amino acid sequence of the derived GDP-Man pyrophosphorylase is shown in GenBank AAC77846.1.

Images