Use of pesticidal proteins
By expressing the ACe1 protein in plants, the limitations of traditional control methods for the two-spotted leaf beetle have been overcome, achieving effective pest control and yield improvement while avoiding environmental pollution.
Patent Information
- Application Number
- CN202211573718.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-12-13
- Filing Date
- 2022-12-08
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2042-12-08
AI Technical Summary
Existing technologies are insufficient to effectively control the two-spotted leaf beetle. Traditional agricultural, chemical, physical, and biological control methods have limitations, and no transgenic crops effective against the two-spotted leaf beetle have been found.
By expressing the ACe1 protein in plants and using this protein to contact the two-spotted leaf beetle, the beetle can be inhibited or killed, thus achieving control over the two-spotted leaf beetle.
It effectively controls the two-spotted leaf beetle, reduces plant damage, increases yield, and is not limited by planting location or time, thus avoiding the shortcomings of traditional control methods.
Smart Images

Figure CN116253779B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the use of a pesticidal protein, in particular to the use of an ACel protein to control Monolepta hieroglyphica by expressing in plants. BACKGROUND
[0002] Monolepta hieroglyphica (Motschulsky) also called long-faliped leaf beetle, belongs to Coleoptera Chrysomelidae, is a new type of pest that damages corn. It is a holometabolic insect of Monolepta hieroglyphica (Motschulsky). It mainly occurs in July-September, and the adult damages corn leaves. Lightly, the leaves are in a gauze-like shape, and heavily, the whole corn leaves are withered. The insect has the habit of aggregation and the habit of feeding on the tender, and often concentrates on a plant from top to bottom to feed on the corn leaves. The tender leaves are bitten into holes, and the middle and lower leaves are damaged, leaving the residual net-like leaf veins or epidermis, which looks like a small irregular white spot from a distance, and has a greater impact on photosynthesis. After the corn silks are extruded, the insect likes to feed on the anthers and filaments, which seriously affects the normal corn flowering and pollination, and easily causes ear rot.
[0003] Corn and soybean are important food crops in China, and the annual food loss caused by Monolepta hieroglyphica is huge, and more than that, it affects the survival of local population. In order to control Monolepta hieroglyphica, people usually use the following main control methods: agricultural control, chemical control, physical control and biological control.
[0004] Agricultural control is the comprehensive and coordinated management of the whole farmland ecosystem with multiple factors, and the regulation and control of crops, pests, environmental factors, to create a farmland ecological environment that is conducive to the growth of crops and not conducive to the occurrence of Monolepta hieroglyphica, such as using large-scale flooding to drown the eggs and larvae of the insect in the soil. However, this method has little effect, and consumes a lot of water resources.
[0005] Chemical control, i.e. pesticide control, is to kill pests by using chemical insecticides, which is an important part of the comprehensive management of Diabrotica virgifera virgifera. It has the characteristics of rapid, convenient, simple and high economic benefit, especially in the case of large occurrence of Diabrotica virgifera virgifera, it is an indispensable emergency measure. At present, the main methods of chemical control are liquid spraying and seed coating. Liquid spraying is to start control when the number of corn reaches 50 or more per 100 plants, and to spray imidacloprid 2000 times liquid during the high occurrence period of Diabrotica virgifera virgifera. Methyl phosphorus emulsion can also be used, and a point is placed every 50 to 100 square meters, and the dipped cotton wool is placed on the upper leaf sheath of the corn ear for control. However, Diabrotica virgifera virgifera larvae live underground, and pesticide spraying cannot control the underground larvae. Diabrotica virgifera virgifera adults can fly and jump, and migrate between fields and hosts, which requires large-scale unified prevention and control. This requires a large amount of organization and management cost, and it is extremely difficult to implement. At present, small farmers only spray their own small plots of land, which cannot effectively control Diabrotica virgifera virgifera adults. Seed coating is to coat the seeds in dry or wet state with a pesticide composition containing a binder, so as to form a protective layer with certain function and coating strength outside the seeds. This process is called seed coating, and the composition coated outside the seeds is called seed coating agent. Because the seed coating agent contains pesticide components, it has a certain control effect on underground pests that damage seeds. However, the effect of seed coating agent is affected by time and rainwater environment, and cannot maintain stable control effect. Generally, the effective period of seed coating agent is only one month, that is, according to the corn planting conditions in northeast China, the seed coating agent is most effective in May, and the effect has begun to decline in June. The eggs of Diabrotica virgifera virgifera often hatch at the end of May, and the larvae are damaged in June. Therefore, the best effective period of seed coating agent is out of sync with the development period of Diabrotica virgifera virgifera larvae, and cannot well control Diabrotica virgifera virgifera larvae. Moreover, chemical control also has its limitations, such as improper use often leads to crop phytotoxicity, pest resistance, killing of natural enemies, environmental pollution, destruction of farmland ecosystem, and threat to human and animal safety due to pesticide residues.
[0006] Physical control mainly uses various physical factors such as light, electricity, color, temperature and humidity, as well as mechanical equipment to control pests by trapping, radiation sterilization and other methods according to the response of pests to various physical factors in the environment. However, Diabrotica virgifera virgifera adults do not have obvious color preference, so hanging yellow plates cannot be used for trapping to kill them. Diabrotica virgifera virgifera adults are active during the day, especially in summer, which is not conducive to the use of light traps (the light intensity cannot exceed that of sunlight, and it does not have an attractive effect), and at night Diabrotica virgifera virgifera hibernates in the grass near the ground and the lower part of corn, and does not accept the attraction. Therefore, so far no physical control measures with certain effect on Diabrotica virgifera virgifera have been found.
[0007] Biological control is to use some beneficial organisms or biological metabolites to control the number of pest population, so as to reduce or eliminate pests. For example, pesticides with low toxicity to natural enemies are selected, and the pesticide application time is adjusted according to the difference between the occurrence period of pests and natural enemies, so as to protect natural enemies by avoiding pesticide application when natural enemies are in large numbers. The characteristics are safety to human and livestock, less environmental pollution, and long-term control of some pests. However, the effect is often unstable, and the same investment is required regardless of the severity of the Diabrotica virgifera virgifera. Since Diabrotica virgifera virgifera lays eggs underground, it is not suitable for the use of egg parasitic beneficial insects such as trichogramma. The adult itself is a coleopteran that can fly and jump, and cannot exert stress on Diabrotica virgifera virgifera adults. Therefore, no biological control measures with certain effect on Diabrotica virgifera virgifera damage have been found so far.
[0008] In order to solve the limitations of agricultural control, chemical control, physical control and biological control in practical application, scientists have found that by transferring insecticidal protein-encoding pest-resistant genes into plants, some pest-resistant transgenic plants can be obtained to control plant pests.
[0009] By genetically engineering crops and introducing Bacillus thuringiensis (Bt) proteins into crops, pest-resistant crops have been developed. For example, Cry1Ab has been used to develop corn resistant to corn borer. Now, these transgenic crops are widely used in agriculture and provide farmers with an environmentally friendly alternative to traditional insect control methods. Although they have been proven to have quite good control effect on lepidopteran pests (corn borer, cotton bollworm, etc.), no transgenic crops capable of preventing and controlling Diabrotica virgifera virgifera have been found so far. The main reason is that no Bt protein with toxicity to Diabrotica virgifera virgifera has been found so far.
[0010] ACe1 is a new class of insecticidal proteins, which is completely different from traditional Bt proteins. Through the analysis of protein secondary structure, it is speculated that this protein belongs to β-hole protein. The mechanism of this type of protein is generally enzyme activation, receptor binding, oligomer formation, and hole opening on the membrane surface. Among them, the enzyme activation in the insect gut, the binding of the receptor on the insect gut, and the physicochemical environment in the gut determine whether the protein can complete the hole opening on the insect gut cell membrane. After the bacteria secrete the protein, it needs to be activated by enzyme cutting in the target organism. The enzyme cutting process mainly occurs at the amino or carboxyl end of the protein, which changes the protein into an active fragment. The active protein binds to the receptor on the epithelial cell membrane of the insect gut, forms an oligomer, inserts into the gut membrane, causes cell membrane perforation, disrupts the osmotic pressure change and pH balance between the cell membrane, and disturbs the digestion process of the insect, ultimately leading to its death.
[0011] It has been reported that ACe1 protein has an insect resistance effect on Coleoptera corn rootworm pests. However, there is no report on controlling Diabrotica balteata damage to plants by producing transgenic plants expressing ACe1 protein. SUMMARY
[0012] The purpose of the present application is to provide a use of an insecticidal protein, and for the first time to provide a method of controlling Diabrotica balteata by producing transgenic plants expressing ACe1 protein, and effectively overcome the technical defects of prior art agricultural control, chemical control, physical control and biological control.
[0013] To achieve the above-mentioned purpose, the present application provides a method for controlling Diabrotica balteata pests, comprising contacting Diabrotica balteata pests with at least ACe1 protein.
[0014] Further, the ACe1 protein is present in at least a host cell producing the ACe1 protein, and the Diabrotica balteata pests are contacted with at least the ACe1 protein by feeding the host cell.
[0015] Still further, the ACe1 protein is present in at least a bacterium or a transgenic plant producing the ACe1 protein, and the Diabrotica balteata pests are contacted with at least the ACe1 protein by feeding tissues of the bacterium or the transgenic plant, and after the contact, the Diabrotica balteata pests are inhibited in growth and / or caused to die, so as to achieve control of Diabrotica balteata damage to plants.
[0016] The transgenic plant can be in any growth stage.
[0017] The tissue of the transgenic plant is root, leaf, stem, fruit, tassel, ear, anther or filament.
[0018] The control of Diabrotica balteata damage to plants does not change with changes in planting location and / or planting time.
[0019] The plant is soybean, wheat, barley, corn, tobacco, rice, oilseed rape, cotton or sunflower.
[0020] The step before the contacting step is planting a plant containing a polynucleotide encoding the ACe1 protein.
[0021] On the basis of the above technical scheme, the ACe1 protein is ACe1_3 protein, ACe1_4 protein, ACe1_5 protein, ACe1_6 protein, ACe1_8 protein, ACe1_9 protein, ACe1_10 protein, ACe1_11 protein, ACe1_12 protein, ACe1_13 protein, ACe1_14 protein, ACe1_15 protein, ACe1_16 protein, ACe1_17 protein, ACe1_18 protein, ACe1_19 protein, ACe1_20 protein or ACe1_21 protein.
[0022] Preferably, the ACe1 protein amino acid sequence has the amino acid sequence shown in SEQ ID NO:1 to SEQ ID NO:18.
[0023] On the basis of the above technical scheme, the plant further comprises at least one second nucleotide different from the nucleotide encoding the ACe1 protein.
[0024] Further, the second nucleotide encodes a Cry class insecticidal protein, a Vip class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase or a peroxidase.
[0025] Preferably, the second nucleotide encodes Cry3Bb, Cry3Aa, Cry34Ab, Cry35Ab protein.
[0026] Further, the amino acid sequence of the Cry3Bb, Cry3Aa, Cry34Ab, Cry35Ab protein has the amino acid sequence shown in SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58. The second nucleotide has the nucleotide sequence shown in SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62.
[0027] Alternatively, the second nucleotide is a dsRNA that inhibits an important gene in the target insect pest.
[0028] To achieve the above object, the present application further provides a use of an ACe1 protein for controlling Diabrotica balteata pest.
[0029] To achieve the above object, the present application further provides a method for producing a plant for controlling Diabrotica balteata pest, comprising introducing a polynucleotide sequence encoding an ACe1 protein into the genome of the plant.
[0030] To achieve the above object, the present application further provides a method for producing a plant seed for controlling a Diabrotica balteata pest, comprising crossing a first plant obtained by the method with a second plant, thereby producing a seed containing a polynucleotide sequence encoding an ACel protein.
[0031] To achieve the above object, the present application further provides a method for cultivating a plant for controlling a Diabrotica balteata pest, comprising:
[0032] planting at least one plant seed, the genome of the plant seed comprising a polynucleotide sequence encoding an ACel protein;
[0033] growing the plant seed into a plant;
[0034] growing the plant under conditions of artificial inoculation of a Diabrotica balteata pest and / or natural occurrence of a Diabrotica balteata pest, and harvesting a plant having reduced plant damage and / or increased plant yield as compared to other plants not having the polynucleotide sequence encoding an ACel protein.
[0035] In the present application, "contacting" refers to the touching, staying and / or feeding of an insect and / or a pest on a plant, a plant organ, a plant tissue or a plant cell, which can express a pesticidal protein in vivo, or has a pesticidal protein on the surface of the plant, the plant organ, the plant tissue or the plant cell and / or has a microorganism producing a pesticidal protein.
[0036] The terms "control" and / or "manage" as used herein mean that the D. balteata leaffolder pest is contacted with the ACel protein, and as a result of the contact, the D. balteata leaffolder pest is inhibited from growing and / or is caused to die. Further, the D. balteata leaffolder pest is contacted with the ACel protein by feeding on plant tissue, and as a result of the contact, all or a portion of the D. balteata leaffolder pest is inhibited from growing and / or is caused to die. Inhibition means sublethal, i.e., not lethal but causing some effect on growth and development, behavior, physiology, biochemistry, and organization, such as slowing and / or stopping growth and development. At the same time, the plant is morphologically normal and can be cultivated under conventional methods for consumption and / or production of products. In addition, a plant and / or plant seed that contains a polynucleotide sequence encoding the ACel protein that controls the D. balteata leaffolder pest, under conditions of artificial inoculation of the D. balteata leaffolder pest and / or natural occurrence of the D. balteata leaffolder pest, has reduced plant damage as compared to a wild-type plant that is not transgenic, as manifested by, but not limited to, improved stalk resistance, and / or increased grain weight, and / or increased yield. The "control" and / or "management" of the D. balteata leaffolder by the ACel protein is independently present and is not diminished and / or lost by the presence of another substance that can "control" and / or "manage" the D. balteata leaffolder pest. Specifically, any tissue of a transgenic plant that contains a polynucleotide sequence encoding the ACel protein, simultaneously and / or asynchronously, has present and / or produces the ACel protein and / or another substance that can control the D. balteata leaffolder pest, and the presence of the other substance neither affects nor causes the "control" and / or "management" of the D. balteata leaffolder by the ACel protein to be completely and / or partially effected by the other substance independent of the ACel protein. Typically, in the field, the process of the D. balteata leaffolder pest feeding on plant tissue is brief and difficult to observe with the naked eye, and therefore, under conditions of artificial inoculation of the D. balteata leaffolder pest and / or natural occurrence of the D. balteata leaffolder pest, such as a transgenic plant that contains a polynucleotide sequence encoding the ACel protein having present a dead D. balteata leaffolder pest, and / or having present a D. balteata leaffolder pest that is inhibited from growing, and / or having reduced plant damage as compared to a wild-type plant that is not transgenic, is indicative of the method and / or use of the present application, i.e., the method and / or use of contacting the D. balteata leaffolder pest with the ACel protein to control the D. balteata leaffolder pest.
[0037] In the present application, the expression of the ACel protein in a transgenic plant can be accompanied by the expression of one or more Cry class insecticidal proteins and / or Vip class insecticidal proteins. The co-expression of more than one insecticidal toxin in the same transgenic plant can be achieved by genetically engineering the plant to contain and express the desired genes. Alternatively, one plant (1stparent) can be genetically engineered to express the ACel protein and a second plant (2ndparent) can be genetically engineered to express a Cry class insecticidal protein and / or a Vip class insecticidal protein. The offspring plant expressing all the genes introduced in the 1stparent and the 2ndparent can be obtained by crossing the 1stparent and the 2ndparent.
[0038] RNA interference (RNAi) refers to a highly conserved phenomenon in evolution, induced by double-stranded RNA (dsRNA), and efficient and specific degradation of homologous mRNA. Therefore, in the present application, the RNAi technology can be used to specifically eliminate or close the expression of a particular gene in a target insect pest.
[0039] The Monolepta hieroglyphica (Motschulsky) described in the present application is a holometabolic insect of the family Chrysomelidae in the order Coleoptera. The adult has a body length of 3.6-4.8 mm and a width of 2-2.5 mm, the antennae are 11-segmented and filamentous, the end part is black, and the length is 2 / 3 of the body length; the compound eyes are large and oval-shaped; the pronotum is wider than long, the surface is raised, and is densely covered with many small pits; the scutellum is black and triangular; the elytra are covered with linear fine pits, each elytron has one light-colored spot at the base half, which is surrounded by black color, and the light-colored spot is mostly not completely closed at the outside rear, and the two wings are rounded at the rear end. The simple identification method is that the adult has one large light yellow spot at the base of each elytron, which is surrounded by black color, and the end half of the elytron is yellow.
[0040] Diabrotica balteata is widely distributed in China, mainly in Northeast China, North China, Jiangsu, Zhejiang, Hubei, Jiangxi, Fujian, Guangdong, Guangxi, Ningxia, Gansu, Shaanxi, Sichuan, Yunnan, Guizhou, Taiwan and other provinces. It is an omnivorous pest, mainly damaging legumes, potatoes, alfalfa, corn, chrysanthemum, carrots, cruciferous vegetables, sunflowers, apricot trees, apples and other crops. The larvae mainly feed on the roots of crops in the field, and the damage cannot be reflected in the aboveground parts; the adults can be found damaging the leaves in corn and soybean fields in mid-July every year; from the end of July to early August, a large number of adults mainly damage the corn silk, bite off the corn silk, seriously affect pollination, cause sharp and spindle-shaped ears, and lead to corn yield reduction; then, D. balteata migrates to soybean fields to feed on soybean leaves, and can also migrate to surrounding vegetable fields to cause damage to vegetables. From 2009 to 2016, the damage area of D. balteata on corn increased from 16 million mu to nearly 40 million mu, with a 2-fold increase in the occurrence area. Moreover, the damage area has spread from the northwest to the northeast and north China, the main corn production areas.
[0041] Diabrotica virgifera virgifera belongs to the Chrysomelidae family, which is the most diverse family in the Coleoptera order. Although D. virgifera virgifera and D. balteata are both in the Chrysomelidae family, they are quite different in other morphological structures and habits, just like strawberries and apples in the Rosales Rosaceae family. They both have bisexual flowers, radial symmetry, and five petals, but their fruits and plant morphologies are quite different. Because people have less contact with insects, especially agricultural pests, they pay less attention to the differences in insect morphology, and thus believe that the morphology of insects is similar. In fact, there are great differences between them. First, there are differences in geographical distribution. D. virgifera virgifera is distributed in the United States, a few countries in South America, and a few countries in Europe, while D. balteata is distributed in China and a few countries in Northeast Asia. Second, there are differences in morphological characteristics. The adult D. virgifera virgifera is yellow-green with three black stripes on the back, and the body length is about 6.35 mm. The adult D. balteata has a light-colored round spot on the back, and the body length is about 3.6-4.8 mm. Third, there are differences in feeding habits. D. virgifera virgifera is almost a corn-specific parasitic pest, and it has been reported that its larvae only feed on corn, yellow fox tail grass, and wheat (Journal of the Kansas Entomological Society Vol. 40, No. 3 (Jul., 1967)). However, D. balteata has a wide range of hosts, and it has caused serious damage in corn, millet, and sorghum fields in Northeast China and Xinjiang. After investigating the hosts of D. balteata in the field, Gao Yu et al. from Jilin Agricultural University found that its hosts involved ferns, dicotyledons, and monocotyledons, totaling 3 classes, 45 families, and 218 species (Hunan Agricultural Sciences, Vol. 56, No. 5). The differences in feeding habits also suggest that the enzymes and receptor proteins in the digestive system are different. The enzyme cleavage activation, receptor binding, and the physicochemical environment in the intestinal tract are the key points for the action of β-hemolysin. Only after the β-hemolysin is cleaved into active fragments and binds to the receptors on the membrane of the intestinal epithelial cells, can a certain β-hemolysin have an insect-resistant effect on the pest. The receptor binding process requires precise matching, and a difference in one amino acid in the hemolysin or receptor protein can cause changes in the binding to the same receptor. For example, the aerolysin protein, which belongs to the same β-hemolysin, had a qualitative change in toxicity to the CTLL-2 cell line after R336A mutation (Osusky, Teschk et al. 2008). Similarly, changes in receptors can also cause changes in the toxicity of the same β-hemolysin. For example, the inhibition of the HAVCR1 gene in the MDCK cell line using dsRNA resulted in a hundred-fold difference in the toxicity of epsilon-toxin to cells (Ivie, Fennessey et al. 2011).This illustrates that the interaction of beta-hairpin proteins with enzymes and receptors in insects is complex and unpredictable.
[0042] The Callosobruchus chinensis (Linnaeus) described in the present application is a kind of warehouse pest, and belongs to the same family as the corn rootworm. It mainly harms kidney beans, cowpeas, lentils, peas, broad beans, green beans, and red beans. Adult females can lay 70-80 eggs on beans in the warehouse or on bean pods in the field. The larvae hatch and bore into the bean pods, and the adults have a false death. Each stage can overwinter in the bean, and pupate and emerge in the spring of the following year.
[0043] The Henosepilachna vigintioctomaculata (Motschulsky) described in the present application belongs to the family of Coccinellidae, and mainly harms potatoes. Its diet and living space are consistent with those of the potato beetle, both of which are adult insects that feed on potato leaves and lay eggs on potato leaves and leaf axils, and the larvae still feed on potato leaves after hatching.
[0044] The genome of the plant, plant tissue, or plant cell described in the present application refers to any genetic material within the plant, plant tissue, or plant cell, and includes the genomes of the nucleus, plastid, and mitochondria.
[0045] The polynucleotide and / or nucleotide described in the present application form a complete "gene" that encodes a protein or polypeptide in the desired host cell. Those skilled in the art will readily recognize that the polynucleotide and / or nucleotide of the present application can be placed under the control of regulatory sequences in the host of interest.
[0046] As is well known to those skilled in the art, DNA typically exists in a double-stranded form. In this arrangement, one strand is complementary to the other, and vice versa. Other complementary strands of DNA are produced by replication of the DNA in plants. Thus, the present application includes the use of the polynucleotide exemplified in the sequence listing and its complementary strand. The "coding strand" is commonly used in the art to refer to the strand that is bound to the antisense strand. To express a protein in vivo, typically one strand of DNA is transcribed into a complementary strand of mRNA, which serves as a template to translate the protein. The mRNA is actually transcribed from the "antisense" strand of the DNA. The "sense" or "coding" strand has a series of codons (a codon is three nucleotides, read three at a time to produce a specific amino acid) that can be read as an open reading frame (ORF) to form the protein or peptide of interest. The present application also includes RNA that has substantially the same function as the exemplified DNA.
[0047] In this invention, nucleic acid molecules or fragments thereof hybridize with the ACe1 gene of this invention under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the ACe1 gene of this invention. Nucleic acid molecules or fragments thereof can specifically hybridize with other nucleic acid molecules under certain conditions. In this invention, if two nucleic acid molecules can form antiparallel double-stranded nucleic acid structures, it can be said that these two nucleic acid molecules can specifically hybridize with each other. If two nucleic acid molecules exhibit perfect complementarity, one nucleic acid molecule is called a "complement" of the other nucleic acid molecule. In this invention, when every nucleotide of one nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to exhibit "perfect complementarity". If two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under at least conventional "low-string" conditions, the two nucleic acid molecules are called "minimally complementary". Similarly, if two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under conventional "high-string" conditions, the two nucleic acid molecules are called "complementary". Deviations from perfect complementarity are permissible, as long as such deviations do not completely prevent the two molecules from forming a double-stranded structure. In order for a nucleic acid molecule to be used as a primer or probe, it is only necessary to ensure that it has sufficient sequence complementarity so that it can form a stable double-stranded structure under the specific solvent and salt concentration used.
[0048] In this invention, the substantially homologous sequence is a nucleic acid molecule that, under highly stringent conditions, can specifically hybridize with the complementary strand of a matching nucleic acid molecule. Suitable stringent conditions that promote DNA hybridization, such as treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C followed by washing with 2.0× SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from approximately 2.0× SSC, 50°C for low-stringent conditions to approximately 0.2× SSC, 50°C for high-stringent conditions. Furthermore, the temperature conditions in the washing step can be increased from approximately 22°C (room temperature) for low-stringent conditions to approximately 65°C for high-stringent conditions. Both the temperature conditions and the salt concentration can be changed, or one can remain constant while the other is changed. Preferably, the stringent conditions described in this invention can be as follows: specific hybridization occurs at 65°C in a 6×SSC, 0.5% SDS solution, followed by washing the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.
[0049] Thus, sequences having insecticidal activity and hybridizing under stringent conditions to SEQ ID NO: 19 to SEQ ID NO: 36 of the present application are included in the present application. These sequences are at least about 40% - 50% homologous, about 60%, 65% or 70% homologous, and even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence homology to the sequences of the present application.
[0050] The genes and proteins described in the present application include not only the specific example sequences, but also portions and fragments (including truncations compared to the full-length protein), variants, mutants, substitutions (proteins with alternative amino acids), chimeras and fusion proteins that retain the insecticidal activity characteristics of the specific example proteins. By "variant" or "variation" is meant a nucleotide sequence that encodes the same protein or an equivalent protein that has insecticidal activity. By "equivalent protein" is meant a protein that has the same or substantially the same biological activity against the diamondback moth pest as the proteins of the claims.
[0051] By "fragment" or "truncation" of a DNA molecule or protein sequence described in the present application is meant a portion of the original DNA or protein sequence (nucleotides or amino acids) involved or an artificially engineered version thereof (e.g., a sequence suitable for plant expression) that varies in length but is sufficient to ensure (encode) a protein that is an insect toxin.
[0052] Genes can be modified and variants of genes readily constructed using standard techniques. For example, techniques for making point mutations are well known in the art. Also, for example, U.S. Patent No. 5,605,793 describes a method for generating additional molecular diversity using DNA reassembly after random fragmentation. Fragments of full-length genes can be made using commercially available endonucleases, and exonucleases can be used according to standard procedures. For example, enzymes such as Bal31 or site-directed mutagenesis can be used to systematically remove nucleotides from the ends of these genes. A variety of restriction endonucleases can also be used to obtain genes that encode active fragments. Proteases can be used to directly obtain active fragments of these toxins.
[0053] Equivalent proteins and genes encoding such equivalent proteins can be derived from the β-holin isolates and / or DNA libraries of the present application. There are a variety of ways to obtain the pesticidal proteins of the present application. For example, antibodies to the pesticidal proteins disclosed and claimed herein can be used to identify and isolate other proteins from a mixture of proteins. In particular, the antibodies can be raised to the most constant and most different portion of the protein from other β-holin. These antibodies can then be used to specifically identify equivalent proteins having the characteristic activity by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), or western blotting procedures. Antibodies to the proteins disclosed in the present application or to fragments of such proteins or equivalent proteins can be readily prepared using standard procedures in the art. Genes encoding such proteins can then be obtained from the microorganism.
[0054] Due to the redundancy of the genetic code, a variety of different DNA sequences can encode the same amino acid sequence. It is within the skill in the art to generate alternative DNA sequences that encode the same or substantially identical proteins. Such different DNA sequences are included within the scope of the present application. By "substantially identical" sequences is meant sequences that have amino acid substitutions, deletions, additions, or insertions that do not substantially affect the pesticidal activity, as well as fragments that retain pesticidal activity.
[0055] Substitutions, deletions or additions to the amino acid sequences of the present application are within the routine skill in the art, and are preferably of a small nature, that is conservative amino acid substitutions, small deletions, typically of one to about 30 amino acids, small amino or carboxyl terminal extensions, for example of one methionine residue, or a small linker peptide, for example of about 20-25 residues.
[0056] Examples of conservative substitutions are substitutions within groups of amino acids that have similar side chains. These groups include: (1) acidic amino acids (for example, aspartic acid and glutamic acid); (2) basic amino acids (for example, lysine, arginine, and histidine); (3) polar amino acids (for example, glutamine, asparagine, serine, and threonine); (4) hydrophobic amino acids (for example, valine, isoleucine, leucine, and alanine); (5) aromatic amino acids (for example, phenylalanine, tryptophan, and tyrosine); and (6) small amino acids (for example, glycine, alanine, serine, and threonine). Conservative substitution of amino acids can be performed by one of skill in the art in accordance with methods well known in the art. Typically, these amino acid substitutions do not alter the specific activity of the particular activity. Such substitutions are well known in the art and are described, for example, in Protein by N. Neurath and R.L. Hill, Academic Press, Inc., New York, 1979. The most commonly encountered interchanges are Ala / Ser, Val / lle, Asp / Glu, Thr / Ser, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Tyr / Phe, Ala / Gly, Lys / Arg, Asp / Asn, Leu / lle, Leu / Val, Ala / Glu, and Asp / Gly, and vice versa.
[0057] It will be apparent to those of ordinary skill in the art that such substitutions can occur at locations outside of those which are important for function of the molecule and still result in an active polypeptide. For polypeptides of the present application, amino acid residues whose selection is essential for activity and thus whose substitution would be expected to result in a decrease in activity can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham and Wells, 1989, Science 244: 1081-1085). The latter technique is described in more detail in the literature (see, e.g., Cunningham and Wells, 1989, supra; and Wold, 1987, Ann. Rev. Biophys. Chem. 16: 79- 99). In this method, a single amino acid is changed at a time, with the resulting mutant molecules tested for biological activity. Alternatively, the sites of interaction with the substrate can also be determined by analysis of the three-dimensional structure of the molecule, as determined by nuclear magnetic resonance analysis, crystallography or photoaffinity labeling (see, e.g., de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).
[0058] In the present application, the ACel protein includes, but is not limited to, SEQ ID NO: 1 to SEQ ID NO: 18, and amino acid sequences having homology to the amino acid sequences shown in SEQ ID NO: 1 to SEQ ID NO: 18 are also included in the present application. These sequences typically have greater than 78%, preferably greater than 85%, more preferably greater than 90%, even more preferably greater than 95%, and can be greater than 99% identity / similarity to the sequences of the present application. Preferred polynucleotides and proteins of the present application can also be defined according to more specific identity and / or similarity ranges. For example, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity and / or similarity to the sequences exemplified in the present application.
[0059] The regulatory sequences described in the present application include, but are not limited to, promoters, transit peptides, terminators, enhancers, leaders, introns, and other regulatory sequences operably linked to the ACel protein.
[0060] The promoter is a plant-expressible promoter, which means a promoter that ensures expression of the coding sequence linked thereto in a plant cell. The plant-expressible promoter can be a constitutive promoter. Examples of promoters that direct constitutive expression in plants include, but are not limited to, the 35S promoter from cauliflower mosaic virus, the maize Ubi promoter, the promoter of the GOS2 gene of rice, and the like. Alternatively, the plant-expressible promoter can be a tissue-specific promoter, i.e., a promoter that directs higher expression of the coding sequence in some tissues of the plant, such as in green tissues, than in other tissues of the plant (as can be determined by routine RNA assays), such as the PEP carboxylase promoter. Alternatively, the plant-expressible promoter can be a wound-inducible promoter. A wound-inducible promoter or a promoter that directs a wound-induced expression pattern means a promoter that confers significantly higher expression of the coding sequence under its control when the plant is subjected to mechanical or insect feeding-induced wounding than under normal growth conditions. Examples of wound-inducible promoters include, but are not limited to, the promoters of the protease inhibitor genes (pin I and pin II) of potato and tomato and the maize protease inhibitor (MPI) gene.
[0061] The transit peptide (also known as a secretion signal sequence or a targeting sequence) is a sequence that directs the transgenic product to a specific organelle or cellular compartment, and the transit peptide can be heterologous to the recipient protein, e.g., a chloroplast transit peptide sequence is used to target the protein to chloroplasts, or a 'KDEL' retention sequence is used to target the protein to the endoplasmic reticulum, or a CTPP from the barley lectin gene is used to target the protein to the vacuole.
[0062] The leader sequence includes, but is not limited to, a picornavirus leader sequence, such as the EMCV leader sequence (Encephalomyocarditis virus 5' noncoding region); a potyvirus leader sequence, such as the MDMV (Maize Dwarf Mosaic Virus) leader sequence; the human immunoglobulin protein heavy chain binding protein (BiP); the untranslated leader sequence of the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4); and the tobacco mosaic virus (TMV) leader sequence.
[0063] The enhancer includes, but is not limited to, a cauliflower mosaic virus (CaMV) enhancer, a figwort mosaic virus (FMV) enhancer, a carnation etch ring virus (CERV) enhancer, a cassava vein mosaic virus (CsVMV) enhancer, a mungbean yellow mosaic virus (MMV) enhancer, a nightshade yellow leaf curl virus (CmYLCV) enhancer, a cotton leaf curl Multan virus (CLCuMV), a Commelina yellow mottle virus (CoYMV), and a peanut chlorotic line pattern virus (PCLSV) enhancer.
[0064] For monocot applications, the intron includes, but is not limited to, a maize hsp70 intron, a maize ubiquitin intron, an Adh intron 1, a sucrose synthase intron, or a rice Actl intron. For dicot applications, the intron includes, but is not limited to, a CAT-1 intron, a pKANNIBAL intron, a PIV2 intron, and a "super ubiquitin" intron.
[0065] The terminator can be a suitable polyadenylation signal sequence that functions in plants, including, but not limited to, a polyadenylation signal sequence derived from the Agrobacterium tumefaciens nopaline synthase (NOS) gene, a polyadenylation signal sequence derived from the protease inhibitor II (pin II) gene, a polyadenylation signal sequence derived from the pea ssRUBISCO E9 gene, and a polyadenylation signal sequence derived from the α-tubulin gene.
[0066] "operably linked" in the present invention means the joining of nucleic acid sequences in a manner which enables them to be co-expressed. In the present invention, "operably linked" can mean the joining of a promoter to a sequence of interest such that the transcription of the sequence of interest is controlled and regulated by the promoter. "Operably linked" means, when the sequence of interest encodes a protein and expression of the protein is desired, that the promoter is joined to the sequence in such a way that the resulting transcript is efficiently translated. If the joining of the promoter to the coding sequence is a transcript fusion and expression of the encoded protein is desired, the joining is made in such a way that the first translation initiation codon in the resulting transcript is the start codon of the coding sequence. Alternatively, if the joining of the promoter to the coding sequence is a translation fusion and expression of the encoded protein is desired, the joining is made in such a way that the first translation initiation codon contained in the 5' untranslated sequence is operably linked to the promoter and the joining is made in such a way that the resulting translation product is in frame with the open reading frame encoding the protein of interest. Nucleic acid sequences which can be "operably linked" include, but are not limited to, sequences which provide gene expression functions (i.e., gene expression elements such as promoters, 5' untranslated regions, introns, protein coding regions, 3' untranslated regions, polyadenylation sites, and / or transcription terminators), sequences which provide DNA transfer and / or integration functions (i.e., T-DNA border sequences, site-specific recombinase recognition sites, integrase recognition sites), sequences which provide selectable functions (i.e., antibiotic resistance markers, biosynthetic genes), sequences which provide scorable marker functions, sequences which facilitate in vitro or in vivo manipulation of sequences (i.e., polylinker sequences, site-specific recombination sequences), and sequences which provide replication functions (i.e., bacterial origin of replication sequences, autonomously replicating sequences, centromere sequences).
[0067] "pesticidal" or "antipathogenic" in the present invention means toxic to a crop pest, thereby achieving "control" and / or "prevention" of the crop pest. Preferably, "pesticidal" or "antipathogenic" means killing the crop pest. More specifically, the target insect is a Diabrotica virgifera virgifera pest.
[0068] The ACel protein is toxic to Diabrotica virgifera virgifera pests in the present invention. The plants, particularly corn and soybean, in the present invention contain in their genome foreign DNA comprising a nucleotide sequence encoding the ACel protein, and Diabrotica virgifera virgifera pests come into contact with the protein by feeding on the plant tissues, and upon contact, the Diabrotica virgifera virgifera pests are inhibited from growing and / or caused to die. Inhibition means lethal or sublethal. At the same time, the plants are morphologically normal and can be cultivated under conventional methods for the consumption and / or production of products. In addition, the plants can substantially eliminate the need for chemical or biological pesticides (which are pesticides against Diabrotica virgifera virgifera pests targeted by the ACel protein).
[0069] The expression level of the pesticidal protein in the plant material can be detected by various methods described in the art, for example, by quantifying the mRNA encoding the pesticidal protein produced in the tissue using specific primers, or directly detecting the amount of the produced pesticidal protein.
[0070] Different tests can be applied to determine the insecticidal effect of the pesticidal protein in the plant. The target insect in the present application is mainly Diabrotica balteata.
[0071] In the present application, the ACe1 protein can have the amino acid sequence shown in SEQ ID NO: 1 to SEQ ID NO: 18 in the sequence listing. In addition to comprising the coding region of the ACe1 protein, other elements can also be included, for example, a protein encoding a selectable marker.
[0072] In addition, the expression cassette comprising the nucleotide sequence encoding the ACe1 protein of the present application can also be expressed in plants together with at least one protein encoding a herbicide resistance gene, including but not limited to, a phosphinothricin resistance gene (such as a bar gene, a pat gene), a bengamid resistance gene (such as a pmph gene), a glyphosate resistance gene (such as an EPSPS gene), a bromoxynil resistance gene, a sulfonylurea resistance gene, a resistance gene to the herbicide dalapon, a resistance gene to cyanamide, or a resistance gene to glutamine synthetase inhibitors (such as PPT), thereby obtaining a transgenic plant with both high insecticidal activity and herbicide resistance.
[0073] In the present application, the exogenous DNA is introduced into plants, such as the gene or expression cassette or recombinant vector encoding the ACe1 protein is introduced into plant cells. The conventional transformation methods include but are not limited to Agrobacterium-mediated transformation, microprojectile bombardment, direct DNA uptake into protoplasts, electroporation or whisker silicon-mediated DNA introduction.
[0074] The present application provides a use of a pesticidal protein, which has the following advantages:
[0075] 1. Internal control. The prior art mainly controls the damage of Diabrotica balteata pests by external action, i.e. external factors, such as agricultural control, chemical control, physical control and biological control. The present application controls Diabrotica balteata pests by producing ACe1 protein in the plant body which can kill Diabrotica balteata, i.e. by internal control.
[0076] 2. No pollution, no residue. Although the chemical control method used in the prior art plays a certain role in controlling the damage of Diabrotica balteata pests, it also brings pollution, destruction and residue to humans, animals and farmland ecosystems. The method for controlling Diabrotica balteata pests using the present application can eliminate the above-mentioned adverse consequences.
[0077] 3. Control throughout the entire growth cycle. Existing technologies for controlling the two-spotted leaf beetle are all phased, while this invention provides protection for plants throughout their entire growth cycle. Transgenic plants (ACe1 protein) can avoid being infested by the two-spotted leaf beetle from germination and growth to flowering and fruiting.
[0078] 4. Whole-plant control. Most existing methods for controlling the two-spotted leaf beetle are localized, such as foliar spraying; however, this invention protects the entire plant, including the roots, leaves, stems, fruits, male and female ears, anthers, and filaments of the transgenic plant (ACe1 protein), all of which are resistant to two-spotted leaf beetle infestation.
[0079] 5. Stable efficacy. Existing technologies, whether agricultural or physical control methods, rely on environmental conditions for pest control, which are subject to numerous variables. This invention, by expressing the ACe1 protein within plants, effectively overcomes the instability of environmental conditions. Furthermore, the control efficacy of the transgenic plants (ACe1 protein) of this invention remains stable and consistent across different locations, times, and genetic backgrounds.
[0080] 6. Simple, convenient, and economical. This invention only requires planting transgenic plants that can express the ACe1 protein, without the need for other measures, thus saving a lot of manpower, material resources, and financial resources.
[0081] 7. Thorough effect. Existing methods for controlling the two-spotted leaf beetle are not thorough and only alleviate the problem; however, the transgenic plant (ACe1 protein) of this invention can cause a large number of newly hatched two-spotted leaf beetle larvae to die.
[0082] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0083] Figure 1 A flowchart illustrating the construction process of the recombinant expression vector DBN01-P containing the ACe1 nucleotide sequence for the purpose of the insecticidal protein of this invention.
[0084] Figure 2 A flowchart illustrating the construction process of the recombinant expression vector DBN001-T containing the ACe1 nucleotide sequence for the purpose of the insecticidal protein of this invention.
[0085] Figure 3 The flowchart shows the construction process of the plant recombinant expression vector DBN001-B containing the ACe1 nucleotide sequence for the purpose of the insecticidal protein of the present invention. Detailed Implementation
[0086] The use of the insecticidal proteins of the present application will be further illustrated by specific examples.
[0087] First embodiment, obtaining and synthesis of genes
[0088] 1. Obtaining nucleotide sequences
[0089] The amino acid sequences of the ACe1 insecticidal proteins are shown in Table 1 as SEQ ID NO: 1 to 18; the ACe1 bacterial nucleotide sequences encoding the amino acid sequences of the ACe1 insecticidal proteins in bacteria are shown in Table 1 as SEQ ID NO: 19 to 36; the ACe1 transgenic plant nucleotide sequences encoding the amino acid sequences of the ACe1 insecticidal proteins in transgenic plants are shown in Table 1 as SEQ ID NO: 37 to 54.
[0090] Table 1, ACe1 proteins and their corresponding amino acid and nucleotide sequences
[0091]
[0092]
[0093] 2. Synthesis of the above nucleotide sequences
[0094] The bacterial nucleotide sequences of the 18 ACe1 proteins (as SEQ ID NO: 19 to SEQ ID NO: 36) and the plant nucleotide sequences of the 3 ACe1 proteins (as SEQ ID NO: 38, SEQ ID NO: 42, SEQ ID NO: 48) synthesized in the first embodiment.
[0095] Second embodiment, construction of recombinant expression vectors and transformation of E. coli with the recombinant expression vectors to obtain ACe1 proteins
[0096] 1. Construction of recombinant expression vectors containing ACe1 genes
[0097] The bacterial nucleotide sequences of the ACe1 proteins (ACe1_3 to ACe1_6, ACe1_8 to ACe1_21) synthesized in the first embodiment were ligated into the protein expression vector pET28a (Novagen, USA, CAT: 69864-3), and the procedures were performed according to the instructions of the pET28a vector of Novagen, to obtain recombinant expression vectors DBN01-P to DBN18-P, the construction process of which is shown in Figure 1 (wherein, Kan represents the kanamycin resistance gene; f1 ori represents the replication origin of phage f1; LacI is the LacI start codon; ACe1_3 is the ACe1_3 bacterial nucleotide sequence (SEQ ID NO: 19); MCS is the multiple cloning site).
[0098] The names of the ACe1 proteins and their corresponding recombinant expression vectors are shown in Table 2:
[0099] Table 2, the names of the ACe1 proteins and their corresponding recombinant expression vectors
[0100]
[0101]
[0102] 2. Recombinant expression vector transformed E. coli to obtain ACe1 protein
[0103] The recombinant expression vectors DBN01-P to DBN18-P were then transformed into E. coli BL21(DE3) competent cells (Transgen, China, CAT: CD501) using the heat shock method. Positive clones were selected and cultured in LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 100 mg / L ampicillin, pH adjusted to 7.5 with NaOH) at a temperature of 37°C and a rotation speed of 200 r / min for 16 h. The culture was then transferred to YT medium at a ratio of 1:10 and incubated at a temperature of 37°C and a rotation speed of 200 r / min. When the OD = 600 value of the culture reached 0.6-0.8, IPTG was added to a final concentration of 0.5 mM for induction expression for 6 h. The culture was centrifuged to collect the bacterial cells, the supernatant was discarded, and the cells were resuspended in PBS and sonicated. The expressed protein was detected by SDS-PAGE, the protein concentration was estimated, and the sample was stored at a temperature of -20°C for future use.
[0104] Third embodiment, feeding ACe1 protein to identify the insect resistance effect on Diabrotica balteata
[0105] The ACe1 series (ACe1_3 to ACe1_6, ACe1_8 to ACe1_21) proteins obtained in Example 2 were tested for insect resistance against Diabrotica balteata, Callosobruchus chinensis, and Epilachna vigintioctopunctata. A total of 18 treatments were set up for each insect, including ACe1_3 to ACe1_6, ACe1_8 to ACe1_21, and one negative control treatment: GFP.
[0106] Diabrotica balteata: The protein solutions of ACe1_3 to ACe1_6, ACe1_8 to ACe1_21, and GFP were mixed into the feed at a final concentration of 50 g / g. Each treatment was repeated 3 times.
[0107] Callosobruchus chinensis: The protein solutions of ACe1_3 to ACe1_6, ACe1_8 to ACe1_21, and GFP were soaked into green beans at a concentration of 50 g / g. Each treatment was repeated 3 times.
[0108] P. octodecimguttata: ACe1_3 to ACe1_6, ACe1_8 to ACe1_21, and GFP protein solution was soaked into potato leaves at a concentration of 50 g / g. Each group of treatment was repeated 3 times.
[0109] Table 3, the insect resistance results of ACe1 protein feeding to D. undecimpunctata, C. chinensis, and P. octodecimguttata
[0110]
[0111]
[0112] “+” represents insect resistance effect; “-” represents no insect resistance effect; “NT” represents not tested
[0113] The results of Table 3 show that ACe1_3 to ACe1_6, ACe1_8 to ACe1_11, and ACe1_13 to ACe1_19 proteins all exhibit good insect resistance effect on D. undecimpunctata, while no insect resistance effect is exhibited on C. chinensis (same family) and P. octodecimguttata (same order).
[0114] The above results fully demonstrate that the toxicity of insect resistance protein to insects does not have a certain connection with the family of the insects, and is inseparable from the mechanism of action of the insect resistance protein, i.e., the enzyme cutting activation in the intestinal tract of the insect, the combination with the receptors on the intestinal tract of the insect, and the physical and chemical environment in the intestinal tract are the key points for the action of the β-pore-forming protein, and the interaction mode of the β-pore-forming protein with the enzymes and receptors in the insect body is complex and unpredictable.
[0115] Fourth embodiment, construction of a plant expression vector
[0116] 1. Construction of a recombinant cloning vector containing an ACe1 gene
[0117] The synthesized ACe1_4 plant nucleotide sequence was connected to the cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), and the operation steps were performed according to the pGEM-T vector instruction manual of Promega, to obtain a recombinant cloning vector DBN001-T, and the construction process thereof is shown in Figure 2 The figure shows that Amp represents an ampicillin resistance gene; f1 ori represents the replication origin of phage f1; LacZ is the LacZ start codon; SP6 is the SP6 RNA polymerase promoter; T7 is the T7 RNA polymerase promoter; ACe1_4 is the ACe1_4 plant nucleotide sequence (SEQ ID NO: 38); and MCS is a multiple cloning site.
[0118] Then the recombinant cloning vector DBN001-T is transformed into E. coli T1 competent cells (Transgen, Beijing, China, CAT: CD501) by heat shock method, and white colonies are picked and cultured in LB liquid medium (10 g / L of tryptone, 5 g / L of yeast extract, 10 g / L of NaCl, 100 mg / L of ampicillin, pH 7.5 adjusted with NaOH) at a temperature of 37°C overnight. The plasmid is extracted by alkaline method and stored at a temperature of -20°C for standby use.
[0119] After the extracted plasmid is identified by enzyme digestion, the positive clone is verified by sequencing, and the results show that the inserted ACe1_4 plant nucleotide sequence in the recombinant cloning vector DBN001-T is the nucleotide sequence shown in the sequence listing (SEQ ID NO: 38), i.e., the ACe1_4 plant nucleotide sequence is correctly inserted.
[0120] According to the method for constructing the recombinant cloning vector DBN001-T, the synthesized ACe1_9 nucleotide sequence is connected to the cloning vector pGEM-T to obtain a recombinant cloning vector DBN002-T, wherein ACe1_9 is an ACe1_9 nucleotide sequence (SEQ ID NO: 42). The recombinant cloning vector DBN002-T is verified by enzyme digestion and sequencing to confirm that the ACe1_9 nucleotide sequence is correctly inserted.
[0121] According to the method for constructing the recombinant cloning vector DBN001-T, the synthesized ACe1_15 nucleotide sequence is connected to the cloning vector pGEM-T to obtain a recombinant cloning vector DBN003-T, wherein ACe1_15 is an ACe1_15 nucleotide sequence (SEQ ID NO: 48). The recombinant cloning vector DBN003-T is verified by enzyme digestion and sequencing to confirm that the ACe1_15 nucleotide sequence is correctly inserted.
[0122] 2. Construction of a recombinant expression vector containing an ACe1 gene
[0123] The recombinant cloning vector DBN001-T and the expression vector DBNBC-01 (vector backbone: pCAMBIA2301 (CAMBIA institution can provide)) are respectively digested by restriction enzymes, and the cut ACe1_4 plant nucleotide sequence fragment is inserted between the restriction enzyme digestion sites of the expression vector DBNBC-01. The construction of the vector by conventional enzyme digestion method is well known to those skilled in the art, and the recombinant expression vector DBN001-B is constructed, and the construction process is as follows Figure 3(Kan: kanamycin gene; RB: right border; prUbi: maize ubiquitin gene promoter (SEQ ID NO: 63); ACe1_4: ACe1_4 nucleotide sequence (SEQ ID NO: 38); tNos: terminator of nopaline synthase gene (SEQ ID NO: 64); Hpt: hygromycin phosphotransferase gene (SEQ ID NO: 65); LB: left border).
[0124] The recombinant expression vector DBN001-B was transformed into E. coli T1 competent cells by heat shock method, white colonies were picked and cultured in LB liquid medium (10 g / L of tryptone, 5 g / L of yeast extract, 10 g / L of NaCl, 50 mg / L of kanamycin, pH 7.5 adjusted with NaOH) at a temperature of 37°C overnight, and the plasmid was extracted by alkaline method. The extracted plasmid was digested with restriction enzymes for identification, and the positive clones were sequenced for identification. The results showed that the nucleotide sequence in the recombinant expression vector DBN001-B contained the nucleotide sequence shown in SEQ ID NO: 38 in the sequence listing, i.e., the ACe1_4 plant nucleotide sequence.
[0125] According to the above method for constructing the recombinant expression vector DBN001-B, the ACe1_9 nucleotide sequence cut from the recombinant cloning vector DBN002-T was inserted into the expression vector DBNBC-01 to obtain the recombinant expression vector DBN002-B. The nucleotide sequence in the recombinant expression vector DBN002-B was verified by enzyme digestion and sequencing to contain the nucleotide sequence shown in SEQ ID NO: 42 in the sequence listing, i.e., the ACe1_9 nucleotide sequence. The ACe1_9 nucleotide sequence can be connected to the Ubi promoter and the Nos terminator.
[0126] According to the above method for constructing the recombinant expression vector DBN001-B, the ACe1_15 nucleotide sequence cut from the recombinant cloning vector DBN003-T was inserted into the expression vector DBNBC-01 to obtain the recombinant expression vector DBN003-B. The nucleotide sequence in the recombinant expression vector DBN003-B was verified by enzyme digestion and sequencing to contain the nucleotide sequence shown in SEQ ID NO: 48 in the sequence listing, i.e., the ACe1_15 nucleotide sequence. The ACe1_15 nucleotide sequence can be connected to the Ubi promoter and the Nos terminator.
[0127] 3. Transformation of Agrobacterium with recombinant expression vector
[0128] The correctly constructed recombinant expression vectors DBN001-B, DBN002-B, DBN003-B were transformed into Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) by liquid nitrogen method, the transformation conditions were as follows: 100 μl Agrobacterium LBA4404, 3 μl plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 minutes, 37°C water bath for 10 minutes; the transformed Agrobacterium LBA4404 was inoculated in LB test tube at a temperature of 28°C and a rotation speed of 200 rpm for 2 hours, and then coated on LB plate containing 50 mg / L of Rifampicin and 100 mg / L of Kanamycin until positive monoclonal colonies were grown, and the monoclonal colonies were picked and cultured, and the plasmid was extracted, and the recombinant expression vectors DBN001-B, DBN002-B, DBN003-B were cut by restriction endonuclease and verified, and the results showed that the structures of the recombinant expression vectors DBN001-B, DBN002-B, DBN003-B were completely correct.
[0129] Fifth embodiment, obtaining of transgenic maize plants
[0130] According to the commonly used Agrobacterium infection method, the sterile cultured immature embryos of maize variety Zeng 31 (Z31) were co-cultured with the Agrobacterium transformed with the recombinant expression vector described in the fourth embodiment 3, so as to transfer the T-DNA (including the promoter sequence of the maize ubiquitin gene, the ACe1_4 nucleotide sequence, the ACe1_9 nucleotide sequence, the ACe1_15 nucleotide sequence, the Hpt gene and the Nos terminator sequence) in the recombinant expression vectors DBN001-B, DBN002-B, DBN003-B constructed in the fourth embodiment 2 into the maize chromosome, and the maize plants into which the ACe1_4 nucleotide sequence was transferred, the maize plants into which the ACe1_9 nucleotide sequence was transferred, and the maize plants into which the ACe1_15 nucleotide sequence was transferred were obtained; and the wild type maize plant was used as a control.
[0131] For Agrobacterium-mediated maize transformation, briefly, immature embryos were isolated from maize, and the embryos were contacted with an Agrobacterium suspension, wherein the Agrobacterium was capable of delivering the ACe1_4 nucleotide sequence, the ACe1_9 nucleotide sequence and / or the ACe1_15 nucleotide sequence to at least one cell of one of the embryos (step 1: infection step), in which step the embryos were preferably immersed in the Agrobacterium suspension (OD 660= 0.4-0.6, in infection medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 68.5 g / L, glucose 36 g / L, acetosyringone (AS) 40 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, pH 5.3) to initiate inoculation. The immature embryos are co-cultivated with the Agrobacterium for a period of time (3 days) (step 2: co-cultivation step). Preferably, the immature embryos are cultured on solid medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 100 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH 5.8) after the infection step. After this co-cultivation phase, there can be an optional "recovery" step. In the "recovery" step, a recovery medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH 5.8) is used in which at least one antibiotic (cefotaxime) known to inhibit the growth of Agrobacterium is present, but no selection agent for plant transformants is added (step 3: recovery step). Preferably, the immature embryos are cultured on solid medium with the antibiotic but without the selection agent to eliminate Agrobacterium and to provide a recovery period for the infected cells. Next, the inoculated immature embryos are cultured on medium containing the selection agent (hygromycin) and growing transformed calli are selected (step 4: selection step). Preferably, the immature embryos are cultured on selection solid medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 5 g / L, hygromycin 50 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH 5.8) with the selection agent, resulting in the selective growth of transformed cells. Then, the calli are regenerated into plants (step 5: regeneration step), preferably, the calli grown on medium with the selection agent are cultured on solid medium (MS differentiation medium and MS rooting medium) to regenerate plants.
[0132] The selected resistant calli are transferred to the MS differentiation medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzylaminopurine 2 mg / L, hygromycin 50 mg / L, agar 8 g / L, pH 5.8) and cultured to differentiate at 25°C. The differentiated plantlets are transferred to the MS rooting medium (MS salts 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH 5.8) and cultured at 25°C to a height of about 10 cm and transferred to a greenhouse to set seed. In the greenhouse, the plants are cultured at 28°C for 16 hours and at 20°C for 8 hours per day.
[0133] Sixth embodiment, obtaining of transgenic soybean plants
[0134] According to the Agrobacterium infection method routinely adopted, the cotyledon node tissue of the aseptic culture soybean variety Jack was co-cultured with the Agrobacterium transformed with the recombinant expression vector described in 3 of the fourth embodiment, so as to transfer the T-DNA (including the maize ubiquitin promoter sequence, the ACel_4 nucleotide sequence, the ACel_9 nucleotide sequence, the ACel_15 nucleotide sequence, the Hpt gene and the Nos terminator sequence) in the recombinant expression vector DBN001-B, DBN002-B, DBN003-B constructed in the second embodiment of the fourth embodiment into the soybean chromosome, and corn plants into which the ACel_4 nucleotide sequence was transferred, corn plants into which the ACel_9 nucleotide sequence was transferred, and corn plants into which the ACel_15 nucleotide sequence was transferred were obtained; at the same time, wild-type corn plants were used as controls.
[0135] For Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds were germinated in a soybean germination medium (B5 salt 3.1 g / L, B5 vitamin, sucrose 20 g / L, agar 8 g / L, pH 5.6), and the seeds were inoculated on the germination medium and cultured under the following conditions: temperature 25±1℃; light cycle (light / dark) 16 / 8 h. After 4-6 days of germination, the fresh green cotyledon node of the soybean aseptic seedlings was taken, and the hypocotyl was cut off at 3-4 mm below the cotyledon node, the cotyledon was cut longitudinally, and the apical bud, lateral bud and seed root were removed. The back of the scalpel was used to wound the cotyledon node, and the wounded cotyledon node tissue was contacted with the Agrobacterium suspension, wherein the Agrobacterium was capable of delivering the RX nucleotide sequence to the wounded cotyledon node tissue (step 1: infection step). In this step, the cotyledon node tissue was preferably immersed in the Agrobacterium suspension (OD 660= 0.5-0.8, in infection medium (MS salts 2.15 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 40 mg / L, 2-morpholinoethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, pH 5.3) to initiate inoculation. The cotyledonary node tissue is co-cultivated with Agrobacterium for a period of time (3 days) (step 2: co-cultivation step). Preferably, the cotyledonary node tissue is cultured on solid medium (MS salts 4.3 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, 2-morpholinoethanesulfonic acid (MES) 4 g / L, zeatin 2 mg / L, agar 8 g / L, pH 5.6) after the infection step. Following this co-cultivation phase, there can be an optional "recovery" step. In the "recovery" step, a recovery medium (B5 salts 3.1 g / L, B5 vitamins, 2-morpholinoethanesulfonic acid (MES) 1 g / L, sucrose 30 g / L, zeatin (ZT) 2 mg / L, agar 8 g / L, cefotaxime 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, pH 5.6) is provided with at least one antibiotic (cefotaxime) known to inhibit the growth of Agrobacterium, but without the addition of a selection agent for plant transformants (step 3: recovery step). Preferably, the cotyledonary node regenerated tissue pieces are cultured on solid medium with the antibiotic but without the selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the cotyledonary node regenerated tissue pieces are cultured on medium containing the selection agent (hygromycin) and growing transformed callus is selected (step 4: selection step). Preferably, the cotyledonary node regenerated tissue pieces are cultured on selection solid medium (B5 salts 3.1 g / L, B5 vitamins, 2-morpholinoethanesulfonic acid (MES) 1 g / L, sucrose 30 g / L, 6-benzylaminopurine (6-BAP) 1 mg / L, agar 8 g / L, cefotaxime 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, hygromycin 50 mg / L, pH 5.6) with the selection agent, resulting in the selective growth of transformed cells. The transformed cells are then regenerated into plants (step 5: regeneration step), preferably, the cotyledonary node regenerated tissue pieces grown on medium with the selection agent are cultured on solid medium (B5 differentiation medium and B5 rooting medium) to regenerate plants.
[0136] The resistant tissue pieces obtained by screening are transferred to the B5 differentiation medium (B5 salt 3.1 g / L, B5 vitamin, 2-morpholinoethanesulfonic acid (MES) 1 g / L, sucrose 30 g / L, zeatin (ZT) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, hygromycin 50 mg / L, pH 5.6) and cultured to differentiate at 25°C. The seedlings differentiated are transferred to the B5 rooting medium (B5 salt 3.1 g / L, B5 vitamin, 2-morpholinoethanesulfonic acid (MES) 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid (IBA) 1 mg / L) and cultured to about 10 cm high at 25°C and then moved to a greenhouse for cultivation to bear fruit. In the greenhouse, the plants are cultured at 26°C for 16 hours and at 20°C for 8 hours per day.
[0137] Seventh embodiment, verifying transgenic corn plants, transgenic soybean plants by TaqMan
[0138] About 100 mg of leaf of each of the corn plants into which the ACe1_4 nucleotide sequence, the ACe1_9 nucleotide sequence and the ACe1_15 nucleotide sequence is transferred is taken as a sample, and the genomic DNA of the sample is extracted by using Qiagen's DNeasy Plant Maxi Kit. The copy number of the Hpt gene is detected by Taqman probe fluorescence quantitative PCR method to determine the copy number of the ACe1_4 gene, the ACe1_9 gene and the ACe1_15 gene. Meanwhile, wild-type corn plants are taken as controls, and the detection and analysis are performed according to the above method. The experiment is set for 3 repetitions, and the average value is taken.
[0139] The specific method for detecting the copy number of the Hpt gene is as follows:
[0140] Step 11, about 100 mg of leaf of each of the corn plants into which the ACe1_4 nucleotide sequence, the ACe1_9 nucleotide sequence and the ACe1_15 nucleotide sequence is transferred and wild-type corn plants is taken, and each sample is ground into a homogenate in a mortar by using liquid nitrogen. Three repetitions are taken for each sample.
[0141] Step 12, the genomic DNA of the above samples is extracted by using Qiagen's DNeasy Plant Mini Kit, and the specific method is referred to the product manual of the kit.
[0142] Step 13, the concentration of the genomic DNA of the above samples is determined by using NanoDrop 2000 (Thermo Scientific).
[0143] Step 14, adjust the genomic DNA concentration of the above samples to the same concentration value, the concentration value ranges from 80 to 100 ng / μl;
[0144] Step 15, identify the copy number of the samples by using Taqman probe fluorescence quantitative PCR method, take the samples with identified known copy number as standard, take the sample of wild type corn plant as control, 3 repeats for each sample, and take the average value; the fluorescence quantitative PCR primer and probe sequences are as follows:
[0145] The following primer and probe are used to detect Hpt nucleotide sequence:
[0146] Primer 1: cagggtgtcacgttgcaaga as SEQ ID NO: 66 in the sequence listing;
[0147] Primer 2: ccgctcgtctggctaagatc as SEQ ID NO: 67 in the sequence listing;
[0148] Probe 1: tgcctgaaaccgaactgcccgctg as SEQ ID NO: 68 in the sequence listing;
[0149] The PCR reaction system is as follows:
[0150]
[0151] The 50x primer / probe mixture contains 45 μl of each primer at 1 mM concentration, 50 μl of probe at 100 μM concentration and 860 μl of 1x TE buffer, and is stored in a centrifuge tube at 4°C.
[0152] The PCR reaction conditions are as follows:
[0153]
[0154] The data is analyzed by using SDS2.3 software (Applied Biosystems).
[0155] The experimental results of analyzing the copy number of Hpt gene show that the ACe1_4 nucleotide sequence, the ACe1_9 nucleotide sequence and the ACe1_15 nucleotide sequence have all been integrated into the chromosome set of the detected corn plants, and the corn plants into which the ACe1_4 nucleotide sequence, the ACe1_9 nucleotide sequence and the ACe1_15 nucleotide sequence are transferred all obtain single copy transgenic corn plants.
[0156] The transgenic soybean plants were detected and analyzed according to the above method of verifying the transgenic maize plants by TaqMan. Through the analysis of the experimental results of the Hpt gene copy number, it was further confirmed that the ACel_4 nucleotide sequence, the ACel_9 nucleotide sequence and the ACel_15 nucleotide sequence were all integrated into the chromosome set of the detected soybean plants, and the soybean plants into which the ACel_4 nucleotide sequence, the ACel_9 nucleotide sequence and the ACel_15 nucleotide sequence were transferred obtained single copy of the transgenic plants.
[0157] Eighth embodiment, identifying the insect resistance effect of the transgenic maize plants
[0158] The maize plants into which the ACel_4 nucleotide sequence was transferred, the maize plants into which the ACel_9 nucleotide sequence was transferred, the maize plants into which the ACel_15 nucleotide sequence was transferred, the corresponding wild type maize plants, and the maize plants identified as non-transgenic by TaqMan were subjected to insect resistance detection of Diabrotica balteata.
[0159] Fresh leaves (heart leaves) of the maize plants into which the ACel_4 nucleotide sequence was transferred, the maize plants into which the ACel_9 nucleotide sequence was transferred, the maize plants into which the ACel_15 nucleotide sequence was transferred, the wild type maize plants and the maize plants identified as non-transgenic by TaqMan (V3-V4 stage) were washed with sterile water and the water on the leaves was absorbed with gauze, then the veins of the maize leaves were removed and the leaves were cut into about 1 cm x 2 cm strips, one piece of the cut strip was placed on the bottom of a round plastic culture dish, 10 Diabrotica balteata (larvae) were placed in each culture dish, the culture dish was covered, and then placed in a condition of temperature 24±2℃, relative humidity 70%-80%, light cycle (light / dark) 24:0 for 1 day without moving. Starting from the 2nd day after inoculation, the positive leaves were replaced every 2 days until the end of the experiment on the 10th day, and whether there was a significant difference in survival rate was tested. There were 3 strains of maize plants into which the ACel_4 nucleotide sequence was transferred, 3 strains of maize plants into which the ACel_9 nucleotide sequence was transferred, 3 strains of maize plants into which the ACel_15 nucleotide sequence was transferred, 1 strain of maize plants identified as non-transgenic (NGM) by TaqMan, and 1 strain of wild type (CK). Five plants were selected from each strain for testing, and each strain was repeated 3 times. The results are shown in Table 4.
[0160] Table 4, insect resistance experiment results of transgenic maize plants inoculated with Diabrotica balteata
[0161]
[0162] “+” represents insect resistance effect; “-” represents no insect resistance effect
[0163] The results show that the corn plants into which the ACel_4 plant nucleotide sequence is introduced, the corn plants into which the ACel_9 plant nucleotide sequence is introduced, and the corn plants into which the ACel_15 plant nucleotide sequence is introduced have good lethal effect on the D. balteata.
[0164] Ninth embodiment, identifying the insect resistance effect of transgenic soybean plants
[0165] The soybean plants into which the ACel_4 nucleotide sequence is introduced, the soybean plants into which the ACel_9 nucleotide sequence is introduced, the soybean plants into which the ACel_15 nucleotide sequence is introduced, the corresponding wild-type soybean plants, and the soybean plants identified as non-transgenic by Taqman are subjected to insect resistance effect detection.
[0166] The insect resistance effect of the transgenic soybean plants is analyzed according to the above method for detecting the insect resistance effect of corn leaves.
[0167] There are 3 strains into which the ACel_4 nucleotide sequence is introduced, 3 strains into which the ACel_9 nucleotide sequence is introduced, 3 strains into which the ACel_15 nucleotide sequence is introduced, 1 strain identified as non-transgenic (NGM), and 1 wild-type (CK) strain. 5 plants are selected from each strain for testing, and each strain is repeated 3 times. The results are shown in Table 5.
[0168] Table 5, insect resistance experiment results of transgenic soybean plants inoculated with D. balteata
[0169]
[0170] “+” represents insect resistance effect; “-” represents no insect resistance effect
[0171] The results show that the soybean plants into which the ACel_4 plant nucleotide sequence is introduced, the soybean plants into which the ACel_9 plant nucleotide sequence is introduced, and the soybean plants into which the ACel_15 plant nucleotide sequence is introduced have lethal effect on D. balteata.
[0172] It is thus proved that the ACel protein (ACel_4, ACel_9, ACel_15) shows resistance activity to D. balteata in bacteria and in plants, and this activity is sufficient to produce adverse effects on the growth of D. balteata so as to control it in the field. At the same time, by controlling the damage of D. balteata, it is also possible to reduce the occurrence of diseases on the transgenic ACel gene plants, greatly improving the yield and quality of the transgenic ACel gene plants.
[0173] In summary, the use of the insecticidal protein of the present application can control the Diabrotica balteata through producing the ACe1 protein capable of killing the Diabrotica balteata in bacteria or plants; compared with the agricultural control method, the chemical control method, the physical control method and the biological control method used in the prior art, the present application protects the whole growth period and the whole plant of the plant to prevent the Diabrotica balteata from causing damage, and has no pollution, no residue, stable and complete effect, and is simple, convenient and economical.
[0174] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application and are not limiting. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present application.
Claims
1. A method for controlling the two-spotted leaf beetle, characterized in that, This includes ensuring that the two-spotted leaf beetle is in contact with the ACe1 protein at least once; The amino acid sequence of the ACe1 protein is as shown in SEQ ID NO:1 to SEQ ID NO:8 or SEQ ID NO:10 to SEQ ID NO:
16.
2. The method according to claim 1, characterized in that, The ACe1 protein is present in at least the host cells that produce the ACe1 protein, and the two-spotted leaf beetle comes into contact with the ACe1 protein by ingesting the host cells.
3. The method according to claim 2, characterized in that, The ACe1 protein is present in at least the bacteria or transgenic plants that produce the ACe1 protein. The two-spotted leaf beetle comes into contact with the ACe1 protein by ingesting the tissues of the bacteria or the transgenic plants. After contact, the growth of the two-spotted leaf beetle is inhibited and / or it leads to death, thereby achieving control of the two-spotted leaf beetle-damaged plants.
4. The method for controlling the two-spotted leaf beetle according to claim 3, characterized in that, The genetically modified plants are soybeans, wheat, barley, corn, tobacco, rice, rapeseed, cotton, or sunflower.
5. The method for controlling the two-spotted leaf beetle according to claim 3 or 4, characterized in that, The tissues of the transgenic plant are roots, leaves, stems, fruits, male ears, female ears, anthers, or filaments.
6. The method for controlling the two-spotted leaf beetle according to any one of claims 1-4, characterized in that, The nucleotide sequence of the ACe1 protein in bacteria is as shown in SEQ ID NO:19 to SEQ ID NO:26 or SEQ ID NO:28 to SEQ ID NO:
34. The nucleotide sequence of the ACe1 protein in the transgenic plant is as shown in SEQ ID NO:37 to SEQ ID NO:44 or SEQ ID NO:46 to SEQ ID NO:
52.
7. The method for controlling the two-spotted leaf beetle according to claim 5, characterized in that, The nucleotide sequence of the ACe1 protein in bacteria is as shown in SEQ ID NO:19 to SEQ ID NO:26 or SEQ ID NO:28 to SEQ ID NO:
34. The nucleotide sequence of the ACe1 protein in the transgenic plant is as shown in SEQ ID NO:37 to SEQ ID NO:44 or SEQ ID NO:46 to SEQ ID NO:
52.
8. The method for controlling the two-spotted leaf beetle according to claims 3, 4, and 7, characterized in that, The transgenic plant also includes at least one second nucleotide that is different from the nucleotide encoding the ACe1 protein.
9. The method for controlling the two-spotted leaf beetle according to claim 8, characterized in that, The second type of nucleotide encodes Cry-type insecticidal proteins, Vip-type insecticidal proteins, protease inhibitors, lectins, α-amylases, or peroxidases.
10. The method for controlling the two-spotted leaf beetle according to claim 9, characterized in that, The second type of nucleotide encodes Cry3Bb protein, Cry3Aa protein, Cry34Ab or Cry35Ab.
11. The method for controlling the two-spotted leaf beetle according to claim 10, characterized in that, The amino acid sequences of the Cry3Bb protein, Cry3Aa protein, Cry34Ab protein, and Cry35Ab protein are as shown in SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, and SEQ ID NO:
58.
12. The method for controlling the two-spotted leaf beetle according to claim 11, characterized in that, The nucleotide sequence of the second type of nucleotide is as shown in SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, and SEQ ID NO:
62.
13. The method for controlling the two-spotted leaf beetle according to claim 8, characterized in that, The second nucleotide is a dsRNA that inhibits important genes in the target insect pest.
14. The method for controlling the two-spotted leaf beetle according to claim 5, characterized in that, The transgenic plant also includes at least one second nucleotide that is different from the nucleotide encoding the ACe1 protein.
15. The method for controlling the two-spotted leaf beetle according to claim 14, characterized in that, The second type of nucleotide encodes Cry-type insecticidal proteins, Vip-type insecticidal proteins, protease inhibitors, lectins, α-amylases, or peroxidases.
16. The method for controlling the two-spotted leaf beetle according to claim 15, characterized in that, The second type of nucleotide encodes Cry3Bb protein, Cry3Aa protein, Cry34Ab or Cry35Ab.
17. The method for controlling the two-spotted leaf beetle according to claim 16, characterized in that, The amino acid sequences of the Cry3Bb protein, Cry3Aa protein, Cry34Ab protein, and Cry35Ab protein are as shown in SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, and SEQ ID NO:
58.
18. The method for controlling the two-spotted leaf beetle according to claim 17, characterized in that, The nucleotide sequence of the second type of nucleotide is as shown in SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, and SEQ ID NO:
62.
19. The method for controlling the two-spotted leaf beetle according to claim 14, characterized in that, The second nucleotide is a dsRNA that inhibits important genes in the target insect pest.
20. The method for controlling the two-spotted leaf beetle according to claim 6, characterized in that, The transgenic plant also includes at least one second nucleotide that is different from the nucleotide encoding the ACe1 protein.
21. The method for controlling the two-spotted leaf beetle according to claim 20, characterized in that, The second type of nucleotide encodes Cry-type insecticidal proteins, Vip-type insecticidal proteins, protease inhibitors, lectins, α-amylases, or peroxidases.
22. The method for controlling the two-spotted leaf beetle according to claim 21, characterized in that, The second type of nucleotide encodes Cry3Bb protein, Cry3Aa protein, Cry34Ab or Cry35Ab.
23. The method for controlling the two-spotted leaf beetle according to claim 22, characterized in that, The amino acid sequences of the Cry3Bb protein, Cry3Aa protein, Cry34Ab protein, and Cry35Ab protein are as shown in SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO:
58.
24. The method for controlling the two-spotted leaf beetle according to claim 23, characterized in that, The nucleotide sequence of the second type of nucleotide is as shown in SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, and SEQ ID NO:
62.
25. The method for controlling the two-spotted leaf beetle according to claim 20, characterized in that, The second nucleotide is a dsRNA that inhibits important genes in the target insect pest.
26. The use of an ACe1 protein to control the two-spotted leaf beetle pest; characterized in that, The amino acid sequence of the ACe1 protein is as shown in SEQ ID NO:1 to SEQ ID NO:8 or SEQ ID NO:10 to SEQ ID NO:
16.
27. A method for producing a plant to control the two-spotted leaf beetle, characterized in that, This includes introducing a polynucleotide sequence encoding the ACe1 protein into the genome of the plant; The amino acid sequence of the ACe1 protein is as shown in SEQ ID NO:1 to SEQ ID NO:8 or SEQ ID NO:10 to SEQ ID NO:
16.
28. A method for producing plant seeds that control the two-spotted leaf beetle, characterized in that, This includes hybridizing a first plant obtained by the method of claim 27 with a second plant to produce seeds containing a polynucleotide sequence encoding the ACe1 protein; The amino acid sequence of the ACe1 protein is as shown in SEQ ID NO:1 to SEQ ID NO:8 or SEQ ID NO:10 to SEQ ID NO:
16.
29. A method for cultivating plants to control the two-spotted leaf beetle, characterized in that, include: Plant at least one plant seed, the genome of which includes a polynucleotide sequence encoding the ACe1 protein; To allow the plant seeds to grow into plants; The plants were grown under conditions of artificial inoculation with the two-spotted leaf beetle and / or natural damage caused by the two-spotted leaf beetle, and the plants were harvested with reduced plant damage and / or increased plant yield compared to other plants that do not have a polynucleotide sequence encoding the ACe1 protein. The amino acid sequence of the ACe1 protein is as shown in SEQ ID NO:1 to SEQ ID NO:8 or SEQ ID NO:10 to SEQ ID NO:16.
Citation Information
Patent Citations
Methods for in vitro recombination
US5605793A
Preparation and use of wild silkworm 1 acetylcholine esterase active protein
CN101487014A
Meloidogyne incognita acetylcholinesterase genes Miace1, Miace2 and Miace3 as well as related proteins and application of acetylcholinesterase genes
CN104630246A