HHC4, a gene that controls rice grain length and yield, and its applications.

Abstract

This invention provides a gene, HHC4, that regulates rice grain length and yield, the nucleotide sequence of which is shown in SEQ NO.1. This invention also provides the protein encoded by the rice HHC4 gene, the amino acid sequence of which is shown in SEQ NO.2. The HHC4 protein provided by this invention positively regulates rice grain length and yield, and can be directly applied to production practices, providing a new and useful gene resource for basic research related to rice grain size and for high-yield breeding practices.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a gene HHC4 that regulates rice grain length and yield, its encoded protein, and its applications. Background Technology

[0002] Rice ( Oryza sativa Rice (L.) is a staple food crop in China, and maintaining and increasing its yield is of great strategic importance in ensuring national food security. Effective tiller number, number of grains per panicle, and grain weight are the constituent traits of rice yield. Among these, rice grain weight is determined by grain size and grain filling, and grain size can be further broken down into grain length, width, and thickness traits. In the past two decades, the isolation of rice grain size genes and the exploration of their related molecular regulatory mechanisms using genetic mapping and modern molecular biology techniques have become a frontier and hot topic in plant science research. At the same time, these research advances have important theoretical guiding significance for improving rice grain yield and appearance quality in breeding practices.

[0003] Several genes controlling rice grain size and yield have been cloned, including GW2, GW6a, GW6, GS2 / GL2 / GRF4, TGW3, GS5, GL3 / GL3.1, TGW6, LGY3, GW8 / SPL16, GW5 / SW5, and GLW7 / SPL13. However, due to the complexity of grain size and yield regulation in crops, and the limitations of current research methods, our understanding of the molecular regulatory mechanisms and gene networks of these traits remains limited. Therefore, discovering and identifying new rice grain size gene resources and conducting in-depth research on their molecular regulatory mechanisms is of great theoretical significance for high-yield molecular breeding of rice. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides a gene HHC4 and its encoded protein that regulate rice grain length and yield. This gene simultaneously regulates rice grain length and yield per plant, providing a new gene resource for high-yield molecular breeding practices in rice.

[0005] To achieve the above objectives, the technical solution provided by the present invention is as follows:

[0006] A gene HHC4 that regulates rice grain size and yield, characterized in that the nucleotide sequence is shown in SEQ NO.1 of the sequence listing.

[0007] The protein encoding the above-mentioned gene HHC4 is characterized in that the amino acid sequence is shown as SEQ NO.2 in the sequence listing.

[0008] Biological materials containing the gene described in claim 1 or claim 2, wherein the biological material is a nucleic acid molecule, a recombinant expression vector, an engineered bacterium (host cell), or a transformed plant cell.

[0009] The application of the rice grain length and yield regulating gene HHC4 as described in claim 1 or claim 2 in regulating rice grain length and yield.

[0010] The application of the biomaterial described in claim 3 in regulating rice grain length and yield.

[0011] The application according to claim 4 is characterized in that: the application is to create transgenic rice with higher grain length and yield than wild type.

[0012] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0013] The HHC4 protein provided by this invention has a positive regulatory effect on rice grain length and yield, and can be directly applied to production practice, providing a brand-new gene resource for basic research related to rice grain shape and yield as well as high-yield molecular breeding practices. Attached Figure Description

[0014] Figure 1 This is a schematic diagram of the structure of the HHC4 gene overexpression vector pCAMBIA2300-HHC4.

[0015] Figure 2 The transcriptional level of HHC4 in rice with increased expression of the HHC4 gene for grain length and yield (HHC4-ox) is shown in the figure. CK represents the genetic transformation recipient parent Zhonghua 11 (ZH11), HHC4-ox#2 represents a positive overexpression plant transformed into the recombinant vector pCAMBIA2300-HHC4, and HHC4-ox#4 represents a positive overexpression plant transformed into the recombinant vector pCAMBIA2300-HHC4. HHC4-ox#2 and HHC4-ox#4 represent different genetic transformation events.

[0016] Figure 3 This image shows the morphological appearance of a transgenic rice plant overexpressing the HHC4 gene.

[0017] Figure 4 Image showing the size and morphology of transgenic rice grains overexpressing the HHC4 gene.

[0018] Figure 5 The statistical results show the grain size of transgenic rice overexpressing the HHC4 gene.

[0019] Figure 6 Morphological diagram of epidermal cells of glumes in transgenic rice grains overexpressing the HHC4 gene.

[0020] Figure 7 The statistical results show the size of epidermal cells in the hull of HHC4 gene-overexpressing transgenic rice grains.

[0021] Figure 8 The yield statistics are for transgenic rice overexpressing the HHC4 gene. Detailed Implementation

[0022] The following examples are provided to help better understand the present invention, but are not intended to limit the invention.

[0023] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0024] Unless otherwise specified, all experimental materials used in the following examples are commercially available.

[0025] Example 1: Construction of an overexpression vector for HHC4, a gene regulating rice grain shape and yield.

[0026] (1) Obtaining HHC4, a gene regulating rice grain shape and yield

[0027] Wild-type rice Nipponbare ( Oryza sativa ssp. japonica Using cv. Nipponbare cDNA as a template, and following the TOYOBO KOD FX Neo DNA polymerase instruction manual, PCR amplification was performed using the following primers, primer1 and primer2, to obtain the target gene:

[0028] primer1:5'-ATGGTGTGCATACGGCAGG-3'

[0029] primer2: 5'-TCATGAATCGGTCTTCTCTGG-3'

[0030] The PCR amplification products were recovered, purified, and ligated into the Blunt3 sequencing vector (purchased from Beijing TransGen Biotech Co., Ltd.), transformed into Trans-T1 competent cells, positive clones were selected, and the corresponding plasmids were extracted for DNA sequencing.

[0031] Sequencing results showed that the amplified PCR product had a nucleotide sequence as shown in SEQ ID No. 1, with a length of 597 bp, and was named the HHC4 gene. The amino acid sequence of the protein encoded by the HHC4 gene is shown in SEQ ID No. 2.

[0032] (2) Construction of the rice grain shape and yield regulating gene HHC4 overexpression vector (recombinant binary expression vector pCAMBIA2300-HHC4):

[0033] Using the Blunt3-HHC4 plasmid as a template, PCR amplification was performed with primers primer3 and primer4 according to the instructions of TOYOBO's KOD FX Neo DNA polymerase. The PCR amplified fragment was then seamlessly cloned into the plant overexpression vector pCAMBIA2300 according to the instructions of Zhuangmeng's SESeamless Cloning and Assembly Kit, forming a 35S promoter-driven HHC4 gene overexpression construct.

[0034] primer3:5'-GGGTACCCGGGGATCCATGGTGTGC-3'

[0035] primer4: 5'TCACCATGGTACTAGTTGAATCGGT 3'

[0036] Sequencing of the obtained recombinant plasmid vector pCAMBIA2300-HHC4 showed that the recombinant vector pCAMBIA2300-HHC4 had a nucleotide sequence as shown in SEQ ID No. 1 inserted forward at the BamHI restriction site of the expression vector pCAMBIA2300. This successfully replaced the DNA sequence between the BamHI restriction endonuclease and the SpeI recognition site (recognition sequence) of pCAMBIA2300 with the DNA sequence shown in SEQ ID No. 1. Figure 1 ).

[0037] Example 2: Transformation of rice receptor variety ZH11 with HHC4 overexpression vector.

[0038] (1) Overexpression plasmid vector transformed into Agrobacterium EHA105

[0039] The plasmid of the constructed HHC4 overexpression vector pCAMBIA2300-HHC4 was transformed into competent Agrobacterium EHA105 cells. The transformation method is as follows:

[0040] Remove EHA105 competent cells from the -80℃ freezer and thaw them on ice. Add 2 μL of plasmid to a 100 μL tube of competent cells and incubate on ice for 30 minutes. Freeze in liquid nitrogen for 1 minute. Incubate in a 37℃ water bath for 5 minutes. Incubate on ice for 2-3 minutes. Immediately afterward, add 1 mL of antibiotic-free LB liquid medium and incubate at 28℃ on a shaker at 180 rpm for 2-3 hours. Centrifuge at 4000 rpm for 2 minutes and then resuspend in 100 μL of LB liquid medium. Spread the suspension onto LB agar plates containing rifampicin and kanamycin resistance and incubate upside down at 28℃ for 2-3 days. Pick single clones growing on the plates, culture them in liquid medium, extract the recombinant plasmid, identify positive clones by enzyme digestion, and store the positive clones at -80℃ for later use.

[0041] (2) Transformation of rice using Agrobacterium-mediated transformation

[0042] The above-mentioned Agrobacterium containing the overexpression vector was used to transform the wild-type rice variety ZH11 through infection. The specific operation steps are as follows.

[0043] a. Callus induction: Remove the glumes from mature rice seeds of the Nipponbare variety, disinfect them by soaking in 75% alcohol for no more than 1 minute; then rinse with sterile water at least 5 times; soak in 50% sodium hypochlorite for 25 minutes, and gently shake at room temperature; rinse with sterile water at least 8 times; blot dry with sterile filter paper, and evenly place on the rice callus induction medium; finally, place in a 30℃ light incubator for 2-3 weeks until callus grows; after that, subculture for 1-2 generations, and select callus with good growth for Agrobacterium infection experiments.

[0044] b. Agrobacterium activation: Take 20 μL of Agrobacterium containing the HHC4 overexpression plasmid vector stored at -80℃ and inoculate it into 3 mL of liquid YEP medium containing kanamycin and rifampicin. Then, culture it in a shaker at 200 rpm (28℃) until the OD600 is about 0.3-0.5. Take 1 mL of bacterial culture and inoculate it into 50 mL of fresh liquid YEP medium containing kanamycin and rifampicin. Continue to culture it in a shaker at 28℃ and 200 rpm until the OD600 is about 0.3-0.5. Finally, centrifuge to collect the bacterial culture and resuspend the bacterial cells in AAM medium containing 100 μM acetylsylsyringone (AS).

[0045] c. Co-culture of callus with Agrobacterium, screening of callus resistance, and differentiation and rooting: The callus obtained in step a was immersed in the AAM bacterial solution obtained in step b for 30 minutes, and gently shaken. Then, excess bacterial solution was removed with sterile filter paper, and the infected callus was transferred to a co-culture solid medium and cultured in the dark at 28°C for 3 days. Then, it was transferred to a screening medium for culture. It was then transferred to a differentiation medium for differentiation and regeneration, and then transferred to MS medium for rooting and seedling strengthening. After the seedlings were established, they were transplanted to the field and managed according to conventional field management to obtain transgenic plants overexpressing HHC4.

[0046] Example 3: Identification and phenotypic analysis of HHC4 overexpressing rice plants.

[0047] (a) PCR identification of pCAMBIA2300-HHC4 transgenic plants with increased HHC4 gene expression levels

[0048] The genomic DNA of the T0 generation seedlings of the pCAMBIA2300-HHC4 (HHC4-ox#2; HHC4-ox#4) plants obtained in step (2) and the seedlings of the recipient control parent (referred to as CK) was collected. The positive seedlings were identified by PCR using primers primer 5: 5'-ACTATCCTTCGCA AGACCCTTC-3' and primer 6: 5'-TGAACTTCAGGG TCAGCTTG-3'. The plants with 832 bp PCR product were identified as positive seedlings, namely HHC4-ox#2 and HHC4-ox#4 mentioned above.

[0049] (II) Identification of HHC4 expression levels in transgenic plants overexpressing HHC4, a gene regulating rice grain shape and yield:

[0050] RNA was extracted from leaves of HHC4-ox#2 and HHC4-ox#4 plants obtained in step (I) and the recipient parental control plant (CK), and reverse transcribed into cDNA. Actin1 was set as the internal control. Real-time quantitative PCR amplification was performed using the internal control primers Actin1-F and Actin1-R, and the HHC4 gene-specific primers HHC4-qRT-F and HHC4-qRT-R, respectively, to detect the expression level of the HHC4 gene in different transgenic plants. The results showed that ( Figure 2 In positive plants transformed with the recombinant vector pCAMBIA2300-HHC4, the expression level of the HHC4 gene was significantly increased compared to the control (CK). The primers used are as follows:

[0051] Actin1-F: 5'-TGCTATGTACGTCGCCATCCAG-3';

[0052] Actin2-R: 5'-AATGAGTAACCACGCTCCGTCA-3';

[0053] HHC4-qRT-F: 5'-CAAGAAGCACCACCATCACCA-3';

[0054] HHC4-qRT-R: 5'-CGGTCTTCTCTGGCGAATTAGA-3'.

[0055] (III) Phenotypic identification of transgenic plants overexpressing HHC4 with increased expression levels of the rice grain size and yield regulating gene HHC4

[0056] The HHC4-ox #2 and #4 plants obtained in step (I) and the recipient parent rice ZH11 plants (referred to as CK) were planted at the Beijing experimental base to observe the phenotypic differences between HHC4-ox and CK plants throughout the entire growth period.

[0057] like Figure 3 The image shown is a morphological diagram of HHC4-overexpressing transgenic rice. Grain shape and yield were measured, revealing that the HHC4-ox#2 and #4 transgenic rice plants exhibited longer grains and significantly increased yield per plant (e.g., ...). Figure 4 , 5 (As shown in Figure 6).

[0058] Depend on Figure 4 and 5 The test results showed that, compared with the control, the grain length of HHC4-ox #2 and #4 increased by 9.4% and 8.7%, respectively, and the thousand-grain weight increased by 7.5% and 8.1%, respectively. The glumes of HHC4-ox and its control were observed using a scanning electron microscope (e.g., Figure 5 As shown), HHC4-ox significantly increased the length and number of epidermal cells in the glumes compared to the control (e.g., ...). Figure 7 This further demonstrates that the elongation of HHC4-ox rice grains is due to the elongation and proliferation of its glumes. Finally, it was found that the yield per plant of HHC4-ox rice was significantly increased. Figure 8 This indicates that HHC4 can positively regulate rice grain length and thousand-grain weight, and has the potential to increase yield.

[0059] In conclusion, HHC4 can positively regulate rice grain length and thousand-grain weight, and can be applied to improve rice grain shape and yield, showing significant potential for high-yield breeding.

[0060] The foregoing description of specific exemplary embodiments of the invention is for illustrative and explanatory purposes. These descriptions are not intended to limit the invention to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application, thereby enabling those skilled in the art to implement and utilize various different exemplary embodiments of the invention, as well as various different choices and variations. The scope of the invention is intended to be defined by the claims and their equivalents. sequence list <110> Song Xianjun Shen Shaoyan Ma Ming Gao Qiong Wang Weiqing <120> A gene controlling rice grain length and yield and its application <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 597 <212> DNA <213> Rice (Oryza sativa) <400> 1 atggtgtgca tacggcaggc gacgatcgac gacctgctgg cgatgcaggc gtgcaacctg 60 atgtgcctgc cggagaacta ccagatgaag tactacctct accacatgct gtcgtggccg 120 cagctgctgt tcgtggcgga ggattacggc ggccggatcg tcggctacgt gctcgcgaag 180 atggaggagg acccctcgga gccttgccac ggccacatca cctccctcgc cgtgctccgc 240 tcccaccgca agctcggcct cgccaccaag ctcatgtccg ccgcgcaggc tgccatggac 300 caggtgttcg gcgccgagta cgtctccctc cacgtccgcc gctccaaccg cgcggccttc 360 aacctctaca cctccacgct cgggtaccag atccacgacg tcgaggccaa gtactacgcc 420 gacggcgagg acgcctacga catgcgcaag ccgctgcggc agccgcagcc caagaagcac 480 caccatcacc accaccatca tcacggcccc ggtggttgtt gctcacacga tgctcctccc 540 gcggcatctg ggtcttctcc gccgtcctct aattcgccag agaagaccga ttcatga 597 <210> 2 <211> 198 ​​​​​​​​​​​​​​​​​​​​​​​​​​Ser His Arg Lys Leu Gly Leu Ala Thr Lys Leu Met Ser Ala Ala Gln 85 90 95 Ala Ala Met Asp Gln Val Phe Gly Ala Glu Tyr Val Ser Leu His Val 100 105 110 Arg Arg Ser Asn Arg Ala Ala Phe Asn Leu Tyr Thr Ser Thr Leu Gly 115 120 125 Tyr Gln Ile His Asp Val Glu Ala Lys Tyr Tyr Ala Asp Gly Glu Asp 130 135 140 Ala Tyr Asp Met Arg Lys Pro Leu Arg Gln Pro Gln Pro Lys Lys His 145 150 155 160 His His His His His His His His Gly Pro Gly Gly Cys Cys Ser His 165 170 175 Asp Ala Pro Pro Ala Ala Ser Gly Ser Ser Pro Pro Ser Ser Asn Ser 180 185 190 Pro Glu Lys Thr Asp Ser 195

Claims

1. Application of rice grain length and yield regulating gene HHC4 in positively regulating rice grain length and yield, characterized in that, The sequence of the gene is shown as SEQ NO.

1.

2. Application of a biological material containing a HHC4 gene in positively regulating rice grain length and yield, wherein the biological material is a nucleic acid molecule, an expression cassette, a recombinant expression vector or a host cell, and the sequence of the gene is shown as SEQ NO.

1.

3. Use according to claim 2, characterized in that, The application is to create and obtain transgenic rice with higher grain length and yield than the corresponding wild type.

Images