Exosomes carrying both miR-155-5p inhibitor and miR-19b-3p, preparation method and application thereof

Abstract

The present invention belongs to the technical field of genetic engineering and osteoarthritis, and provides an exosome, comprising a miR-155-5p inhibitor and miR-19b-3p; the miR-155-5p inhibitor comprises a small molecule containing an antisense complementary sequence of miR-155-5p or cholesterol modification and 2'OMe modification based on miR-155-5p. The present invention also relates to a preparation method and application of the exosome. The present invention prepares stem cell-derived exosomes simultaneously comprising a miR-155-5p inhibitor and miR-19b-3p by incubation or electroporation, and the exosomes can enhance the autophagy level of chondrocytes, significantly inhibit the activation of M1 macrophages and the release of inflammatory factors, and are well suitable for improving the microenvironment and repairing damage of osteoarthritis, and have extremely high application value.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and inflammation prevention and treatment, and relates to an exosome and a preparation method thereof. The present invention also relates to the use of the exosome in the preparation of a drug for treating osteoarthritis (OA). Background Art

[0002] Osteoarthritis (OA), also known as osteoarthritis, degenerative arthritis, hyperplastic arthritis, and senile arthritis, is prone to occur in heavy-loaded knee joints, hip joints, spine, and distal interphalangeal joints. Clinically, it manifests as progressive joint pain, morning stiffness, and joint swelling. Osteoarthritis is often characterized by cartilage degeneration and secondary bone hyperplasia. Synovial inflammation significantly affects the degree of cartilage degeneration in OA, especially macrophages in the synovium are closely related to the pathological development of OA. Further studies have found that the increase in M1 polarized macrophages on the surface of the synovium is closely related to synovial inflammation and is an important structural morphological evaluation indicator of synovial inflammation.

[0003] As people age, the pathological changes of OA are usually irreversible. The goal of treatment is to relieve or eliminate symptoms, delay joint degeneration, and maintain and restore patients' daily lives to the greatest extent possible. Conventional treatments include medication, surgery, physical therapy, etc. Among them, medication includes local medication, systemic analgesics, and joint cavity medication injections. However, these drugs have more or less side effects, and some are prone to drug resistance, so it is necessary to develop related drugs with better effects.

[0004] Various substances in human adipose-derived stem cells (hADSCs) can affect the regeneration capacity of damaged tissues through various pathways and promote the recovery of damaged tissue structure and function, and hADSCs-derived exosomes are the main mechanism for their therapeutic effects. By sequencing exosomes derived from ADSCs, it was found that miR-19b-3p can significantly inhibit the activation of activated macrophages in vitro and the release of inflammatory factors, showing an anti-inflammatory function. Summary of the invention

[0005] The technical problem to be solved by the present invention is to find and prepare an exosome capable of inhibiting chondrocyte inflammation, and on this basis, provide its application in the preparation of a drug for relieving and treating osteoarthritis.

[0006] The present invention provides an exosome, wherein the exosome contains a miR-155-5p inhibitor and miR-19b-3p. Experiments of the present invention show that the exosome can significantly inhibit the activation of M1 macrophages and the release of inflammatory factors, and is well suitable for improving the microenvironment and repairing injuries of osteoarthritis.

[0007] In the present invention, the miR-155-5p inhibitor includes a small molecule containing an antisense complementary sequence of miR-155-5p or cholesterol-modified and 2'OMe-modified miR-155-5p. In the present invention, the sequence of miR-155-5p is uuaaugcuaauugugauaggggu (SEQ ID NO 1). For details, please refer to the Chinese invention patent application with application number 202211056579.4.

[0008] In the present invention, the sequence of miR-19b-3p is shown as ugugcaaauccaugcaaaacuga (SEQ ID NO 2).

[0009] In another aspect, the present invention provides a method for preparing exosomes, the preparation method comprising:

[0010] S1, MSCs were cultured using medium prepared with exosome-free serum;

[0011] S2, collecting the supernatant of the culture medium of the mesenchymal stem cells cultured in step S1, and separating and obtaining exosomes;

[0012] S3, obtaining mesenchymal stem cell-derived exosomes containing miR-155-5p inhibitor and miR-19b-3p;

[0013] The miR-155-5p inhibitor includes a small molecule containing an antisense complementary sequence of miR-155-5p or a miR-155-5p modified with cholesterol and 2'OMe.

[0014] The mesenchymal stem cells of the present invention may include hADSCs, human umbilical cord-derived mesenchymal stem cells, and the like.

[0015] Preferably, the miR-155-5p inhibitor includes a complementary single strand of mature miR-155-5p; or a complementary single strand of a chemically modified mature miR-155-5p strand (such as cholesterol modification and 2'OMe modification). Preferably, the miR-155-5p inhibitor includes methylation modification based on miR-155-5p, 2 and 4 bases are optionally thio-modified within 10 bases at the 5' end and 3' end, respectively, and a high-affinity cholesterol modification is connected to the 3' end, which can be achieved according to conventional technical means in the art.

[0016] Preferably, the step of isolating and obtaining exosomes comprises:

[0017] The collected supernatant was pre-centrifuged at 0-5°C with a centrifugal speed of 500g-10000g increasing step by step;

[0018] Take the supernatant, resuspend in PBS and add 1.0*10 5 -1.5*10 5 Centrifuge at 4000 g for 60-100 min and repeat this step 1-2 times.

[0019] Preferably, in a preferred example of the present invention, the enrichment method of hADSCs-derived exosomes includes: enrichment of wild-type exosomes (WT-EXO): after P1-P6 generation hADSCs are cultured in complete medium of DMEM F12+10% FBS+10ng / ml bFGF to 80%, the culture medium is switched to one prepared with exosome-free serum (EXO-free FBS) and cultured for 24 hours, the cell culture supernatant is collected, and the exosomes adhered to the cell surface are washed with PBS and collected together.

[0020] The method for extracting exosomes also includes: pre-centrifuging the collected supernatant at 4°C 500g* for 10min, 2000g* for 30min, and 10000g* for 70min, carefully transferring the supernatant to a sterilized ultracentrifuge tube (Beckman Coulter, #lot P22192, USA), sealing it, weighing it to two decimal places, and centrifuging it at 4°C, 100000g* for 70min using an ultracentrifuge (Beckman Coulter, Optima XPN-100, USA), carefully removing the supernatant with a sterile Pasteur pipette and resuspending it with 20-25ml cold PBS, centrifuging it again at 100000g* for 70min, finally removing the PBS and resuspending each tube with 100ul sterile PBS, and storing it at -80°C.

[0021] Preferably, the ultracentrifugation method is used to prepare exosome-free serum (EXO-free FBS). Fetal bovine serum (GIBICO, USA) is dispensed into ultracentrifuge tubes (Beckman Coulter, #lot P22192, USA), sealed, weighed and balanced to two decimal places, and centrifuged at 100000g* for 16 hours at 4°C in an ultracentrifuge (Beckman Coulter, Optima XPN-100, USA). The serum in the upper 2 / 3 of the tube is carefully aspirated with a sterile Pasteur pipette, and filtered with a 0.22um filter for later use.

[0022] Preferably, the exosomes are identified by particle size analysis: the concentration and purity of the exosomes are identified using a particle size analyzer NS300, the exosomes are made into a 1 mL solution of appropriate concentration and injected into the sample tank until it is full, the instrument parameters are adjusted, and the distribution intensity and scattering intensity of the exosomes are obtained.

[0023] In another aspect, the present invention provides the use of the exosomes, and the use of the exosomes in the preparation of a drug for alleviating or treating osteoarthritis.

[0024] Preferably, the drug has one or more of the following effects:

[0025] Inhibit the expression of inflammatory cytokines in macrophages;

[0026] Promote autophagy in chondrocytes;

[0027] Improve the inflammatory microenvironment of cartilage tissue; or

[0028] Diagnose osteoarthritis or monitor the progression of osteoarthritis.

[0029] The present invention also provides a medicine or reagent, which contains the above-mentioned stem cell-derived exosomes carrying both the miR-155-5p inhibitor and miR-19b-3p.

[0030] The research of the present invention shows that the differentially expressed miR-155-5p molecules in OA are screened out based on RNA sequencing technology, and the miR-155-5p inhibitor promotes the autophagy level of chondrocytes by increasing the expression level of autophagy regulation-related genes (Beclin1, Atg3, Atg7, LC3a / b, P62 and Lamp1) of articular chondrocytes, so that the anabolism and degradation metabolism of chondrocytes are balanced, and the microenvironment homeostasis of chondrocytes is maintained, thereby repairing the cartilage tissue degeneration caused by osteoarthritis. Further, the present invention prepares stem cell-derived exosomes containing both miR-155-5p inhibitors and miR-19b-3p by incubation or electroporation technology. Based on the combined effect of stem cell exosomes, miR-155-5p inhibitors and miR-19b-3p in inhibiting synovial inflammation, it can obtain exosomes that are better suitable for osteoarthritis injury repair than those carrying miR-155-5p inhibitors, and has extremely high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the technical solution of the present application, the drawings required for use in the embodiments will be briefly introduced below. Obviously, each drawing in the following description is for some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0032] Figure 1It is to identify ADSC and ADSC-derived exosomes. Among them, A. Cell morphology of third-generation-ADSCs was observed under optical microscope. B. Flow cytometric analysis of third-generation-ADSCs markers (including CD44, CD73, CD90, CD105). C. Transmission electron microscopy (TEM) analysis of ADSC-EXO (scale bar 100nm). D. Western blot analysis of exosome protein markers Alix, Tsg101, CD63 and ER marker Calnexin in ADSC-EXO lysates, with ADSC protein as control. EG. NTA analysis of size distribution, concentration and intensity of ADSC-EXO.

[0033] Figure 2 This is a graph showing the expression of related miRNAs in ADSCs. Exosomes derived from stem cells containing miR-19b-3p were prepared by incubation or electroporation technology, and the results showed that miR-19b-3p was highly expressed in ADSC-EVs.

[0034] Figure 3 This is a graph of miR-19b-3p content in miR-19-EXO constructed by artificial intervention. Among them, the WT-EXO group refers to exosomes derived from ordinary hADSCs, and the miR-19-EXO (miR19-EXO) group refers to exosomes derived from hADSCs with high expression of miR-19b-3p.

[0035] Figure 4 This is a diagram of miR-19b-3p inhibiting the polarization of M1 macrophages. Among them, the M1-NC group is macrophages in M1-induced cells transfected with mimic NC, the M1+WT-EXO group is macrophages in M1-induced cells treated with exosomes from ordinary hADSCs, and the M1+miR-19-EXO group is macrophages in M1-induced cells treated with exosomes from hADSCs that highly express miR-19b-3p.

[0036] Figure 5 This is a flow cytometry graph. Using Thp1 to induce the formation of M1 and M2 macrophages in vitro, it was found that transfection of miR-19b-3p mimic can promote the reduction of M1 macrophages and the increase of M2 macrophages. At the same time, when WT-EXO and miR19-EXO were used for intervention, similar phenotypes appeared, promoting the reduction of M1 macrophages and the increase of M2 macrophages, and miR19-EXO had a more significant effect. This shows that miR-19b-3p exosomes have the function of regulating macrophage polarization, participating in the balance of immune cells under inflammatory conditions, and thus improving the tissue microenvironment.

[0037] Figure 6Figure 1 shows that miR-19b-3p has an inhibitory effect on the expression of inflammatory cytokines in activated macrophages. Among them, WT: wild type, which is an ordinary mouse without treatment; WT-EXO is an exosome derived from ordinary hADSC; miR-D is mir-19-3p. The ELISA method was used to detect the changes in the secretion of inflammatory factors in the supernatant of activated macrophages after miR-19b-3p transfection, and it was found that the expression of proinflammatory cytokines IL-1α, IL-6 and TNF-α was significantly reduced (P < 0.05), while the expression of anti-inflammatory cytokine IL-10 was significantly increased. The above experiments show that miR-19b-3p has an inhibitory effect on the expression of inflammatory cytokines in activated macrophages.

[0038] Figure 7 This is a graph showing the effects of exosomes carrying both miRNA-155-5p inhibitor and miR-19b-3p on the cartilage-related functional indicators of chondrocytes.

[0039] Figure 8 This is a graph showing the changes in chondrocyte autophagy-related functional indicators by exosomes carrying both miRNA-155-5p inhibitor and miR-19b-3p. DETAILED DESCRIPTION

[0040] The technical solution will be clearly and completely described below through the embodiments of the present application. Obviously, the described embodiments are only part of the preferred embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present application.

[0041] Materials used in the present invention:

[0042] Kits, reagents, enzymes, antibodies, etc., from Invitrogen (CA, USA), Sigma (CA, USA), CST (CA, USA), Abcam (CA, USA), NEB (CA, USA), Bio-Tech (China), Genetron (China), Ruibo (China), Vazyme (China), etc. Small RNA (miRNA mimic / inhibitor, siRNA, etc.), electroporation buffer (bio-rad), sterile PBS, TrizolTMLS (Invitrogen, Ct: 10296010), HiScript® III 1st Strand cDNA Synthesis Kit (Vazyme, Ct: R312-02); ChamQTM Universal SYBR® qPCR Master Mix (Vazyme, Ct: Q711-03).

[0043] Experimental equipment:

[0044] Electroporator (bio-rad), real-time fluorescence quantitative PCR instrument (Lightcycle480, Roche), centrifuge (Thermo Fisher Scientific), etc.

[0045] Example 1 Preparation of ASDC-EV

[0046] a. Isolation and identification of hADSCs

[0047] hADSCs were extracted from healthy human fat (provided by the 85th PLA Hospital and reviewed by the hospital ethics committee). The adipose tissue was washed 3 times with PBS, minced and digested with 0.1% collagenase I for 60 minutes, centrifuged at 1200rpm for 5 minutes, and cultured in F12 / DMEM medium containing 10% FBS. The medium was changed after culturing in a cell culture incubator at 37°C and 5% CO2 for 24 hours. When the cells grew to 80% confluence, they were digested with 0.25% trypsin and subcultured at a ratio of 1:3. Digested cells were made into 7 tubes of 500ul single cell suspension, and 2ul anti-human CD44-FITC, CD90-FITC, CD73-FITC, CD19-FITC, CD34-FITC, CD45-FITC, and CD105-PE monoclonal antibodies were added respectively. The cells were incubated at 37°C for 30 minutes, washed 3 times with PBS, and CD molecules on the surface of hADSCs were detected by flow cytometry. The morphology of hADSCs was observed under an optical microscope.

[0048] b. Isolation and identification of exosomes from hADSCs

[0049] (1) Preparation of exosome-free serum (EXO-free FBS) by ultracentrifugation: Fetal bovine serum (GIBICO, USA) was dispensed into ultracentrifuge tubes (Beckman Coulter, #lot P22192, USA), sealed, and weighed to two decimal places. Ultracentrifuge (Beckman Coulter, Optima XPN-100, USA) was used for centrifugation at 100,000 g* for 16 h at 4°C. The serum in the upper 2 / 3 of the tube was carefully aspirated with a sterile Pasteur pipette and filtered with a 0.22 μm filter for later use.

[0050] (2) Enrichment of hADSCs-derived exosomes:

[0051] Enrichment of wild-type exosomes (WT-EXO): After P1-P6 hADSCs were cultured in complete medium of DMEM F12+10% FBS+10ng / ml bFGF and grown to 80%, the medium was switched to EXO-free FBS for 24h, and the cell culture supernatant was collected. The exosomes adhered to the cell surface were washed with PBS and collected together.

[0052] (3) Extraction of exosomes: The collected supernatant was pre-centrifuged at 4°C at 500g* for 10 min, 2000g* for 20 min, and 10000g* for 60 min. The supernatant was carefully transferred to a sterilized ultracentrifuge tube (Beckman Coulter, #lot P22192, USA). After sealing, the tube was weighed and balanced to two decimal places. The tube was centrifuged at 4°C and 100000g for 70 min in an ultracentrifuge (Beckman Coulter, Optima XPN-100, USA). The supernatant was carefully removed with a sterile Pasteur pipette and resuspended in 20-25 ml of cold PBS. The tube was centrifuged again at 100000g for 70 min. The PBS was removed and each tube was resuspended in 100 ul of sterile PBS and stored at -80°C.

[0053] (4) Particle size analysis of exosomes: The concentration and purity of exosomes were identified using a particle size analyzer (NS300). The exosomes were made into a 1 mL solution of appropriate concentration and injected into the sample tank until it was full. The instrument parameters were adjusted to obtain the distribution intensity and scattering intensity of the exosomes.

[0054] Figure 1 The use of multiple methods to detect and identify ADSCs and ADSC-derived exosomes (abbreviated as ADSC exosomes) is demonstrated. A. Cell morphology of third-generation-ADSCs observed under an optical microscope. B. Flow cytometric analysis of third-generation-ADSCs markers (including CD44, CD73, CD90, CD105). C. Transmission electron microscopy (TEM) analysis of ADSC-EXO (scale bar 100nm). D. Western blot analysis of exosomal protein markers Alix, Tsg101, CD63 and ER marker Calnexin in ADSC-EXO lysates, with ADSC protein as a control. EG. NTA analysis of size distribution, concentration and intensity of ADSC-EXO ( Figure 1 ). Figure 1 The results showed that the present method successfully obtained pure ADSC-derived exosomes.

[0055] Example 2 Cartilage repair of OA rats by ADSC-EV

[0056] Detection of inclusions in ADSC-derived exosomes, among which miR-19b-3p was highly expressed in ADSC-derived exosomes ( Figure 2 ). Exosomes from stem cells containing miR-19b-3p were prepared by incubation or electroporation technology. The results showed that the content of miR-19b-3p was significantly higher than that of exosomes from ADSCs. At the same time, the content of miR-19b-3p in ADSC cells transfected with miR-19b-3p was significantly higher than that in wild-type ADSC cells ( Figure 3 ).

[0057] THP1 monocytes were treated with 50 ng / ml PMA for 48 h (for M0 induction) and then treated with 20 ng / mL LPS and 20 ng / mL IFN-γ (for M1 induction) or 20 ng / mL IL4 and 20 ng / mL IL-13 (for M2 induction). THP1 induced M1 and M2 macrophages transfected with mimic NC or mimic were analyzed by flow cytometry for CD11b+TNF-a+ cell population.

[0058] Experimental results: We used Thp1 to induce the formation of M1 and M2 macrophages in vitro and found that transfection of miR-19b-3p mimic can promote the reduction of M1 macrophages and the increase of M2 macrophages. At the same time, similar phenotypes appeared when WT-EXO and miR19-EXO were used for intervention, promoting the reduction of M1 macrophages and the increase of M2 macrophages, and miR19-EXO had a more significant effect. This shows that miR-19b-3p exosomes have the function of regulating macrophage polarization, participating in the balance of immune cells under inflammatory conditions, and thus improving the tissue microenvironment ( Figure 4 ).

[0059] Example 3 Effect of exosome therapy on cytokine release of macrophages under inflammatory conditions

[0060] The supernatant was detected by ELISA method: IL1a, TNF-a, IL-6 were pro-inflammatory factors, and IL-10 was an anti-inflammatory factor.

[0061] Experimental results: ELISA method was used to detect the changes in inflammatory factors secreted in the supernatant of activated macrophages after miR-19b-3p transfection, and it was found that the expression of proinflammatory cytokines IL-1α, IL-6 and TNF-α was significantly reduced (P < 0.05), while the expression of anti-inflammatory cytokine IL-10 was significantly increased. According to the above experiments, miR-19b-3p has an inhibitory effect on the expression of inflammatory cytokines in activated macrophages.

[0062] Example 4 Exosomes carrying both miRNA-155-5p inhibitor and miR-19b-3p

[0063] The exosomes were made to contain miRNA-155-5p inhibitor by electroporation, and miR-19b-3p by liposome transfection. The exosomes were collected separately, and then the two exosomes were placed in the culture medium of chondrocytes at the same time to make the two exosomes fuse. Exosomes carrying both miRNA-155-5p inhibitor and miR-19b-3p have a better effect on cartilage repair in OA rats than exosomes carrying miRNA-155-5p inhibitor or miR-19b-3p alone.

[0064] 4.1 Cartilage function indicators

[0065] Experimental results: Western blot technology was used to detect the expression of cartilage function-related proteins in C28 / I2 chondrocytes in each group. The results showed that compared with the OA group, the COL2A1 and Sox9 protein levels in C28 / I2 cells in the EXO-ADSC group were significantly increased, and the MMP-13 protein level was significantly decreased. Compared with the EXO-ADSC group, the COL2A1 and Sox9 protein levels in C28 / I2 cells in the EXO-ADSC+miRNA-155-5p inhibitor NC group and the EXO-ADSC+miRNA-19-3p group were significantly increased, and the MMP-13 protein level was significantly decreased. In addition, the COL2A1 and Sox9 protein levels in the EXO-ADSC+miRNA-155-5p+miRNA-19-3p C28 / I2 cells increased most significantly, and the MMP-13 protein level was most significantly decreased. This indicates that EXO-ADSC, miRNA-155-5p inhibitor and miRNA-19-3p have a repairing effect on the cartilage function of OA chondrocytes, and the combination of the three has a better effect.

[0066] 4.2 Autophagy Function Indicators

[0067] Experimental results: Western blot technology was used to detect the expression of autophagy function-related proteins (Beclin1, Atg3, Atg7, LC3a / b and Lamp1 proteins) in C28 / I2 chondrocytes in each group. The results showed that compared with those in the OA group, the levels of Beclin1, Atg3, Atg7, LC3a / b and Lamp1 proteins in C28 / I2 cells in the EXO-ADSC group were significantly increased.

[0068] Compared with the EXO-ADSC group, the levels of autophagy-related proteins in C28 / I2 cells in the EXO-ADSC+miRNA-155-5p inhibitor NC group and the EXO-ADSC+miRNA-19-3p group increased significantly, and the levels of autophagy-related proteins in the EXO-ADSC+miRNA-155-5p+miRNA-19-3p C28 / I2 cells increased most significantly. This indicates that EXO-ADSC, miRNA-155-5p inhibitor, and miRNA-19-3p improve the autophagy function of OA chondrocytes, and the combination of the three has a better effect.

[0069] The above-described embodiments are only specific implementation methods of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be thought of by any technician familiar with the art within the technical scope disclosed in the present application without creative work should be included in the protection scope of the present application. Therefore, the protection scope of the present application shall be based on the protection scope of the claims in the present application.

Claims

1. An exosome, characterized in that: The exosomes contain miR-155-5p inhibitor and miR-19b-3p; The exosomes are derived from human adipose stem cells; The miR-155-5p inhibitor is a small molecule containing the antisense complementary sequence of miR-155-5p; The sequence of miR-155-5p is uuaaugcuaauugugauaggggu; The sequence of the miR-19b-3p is such as ugugcaaauccaugcaaaacuga.

2. The exosome according to claim 1, characterized in that The method for preparing exosomes comprises: (1) Cultivating mesenchymal stem cells using culture medium prepared with exosome-free serum; (2) collecting the supernatant of the culture medium in which the mesenchymal stem cells were cultured in step (1) and isolating and obtaining exosomes; (3) The miR-155-5p inhibitor and miR-19b-3p are introduced into the exosomes obtained in step (2) by incubation or electroporation.

3. The exosome according to claim 1, characterized in that The diameter of the exosomes ranges from 30-150 nm.

4. A method for preparing exosomes according to claim 1, characterized in that: The preparation method comprises: S1, MSCs were cultured using medium prepared with exosome-free serum; S2, collecting the supernatant of the culture medium of the mesenchymal stem cells cultured in step S1, and separating and obtaining exosomes; S3, adding miR-155-5p inhibitor and miR-19b-3p to the exosomes obtained in step S2; The miR-155-5p inhibitor includes a small molecule containing an antisense complementary sequence of miR-155-5p.

5. The method for preparing exosomes according to claim 4, characterized in that: The steps for isolating and obtaining exosomes include: The collected supernatant was pre-centrifuged at 0-5°C with a centrifugal speed of 500g-10000g increasing step by step; Take the supernatant, resuspend in PBS and add 1.0*10 5 -1.5*10 5 Centrifuge at 4000 g for 60-100 min and repeat this step 1-2 times.

6. The method for preparing exosomes according to claim 4, characterized in that: include: Enrichment of mesenchymal stem cell-derived exosomes: Enrichment of wild-type exosomes: Primary mesenchymal stem cells were cultured in complete medium of DMEM F12+10% FBS+10ng / ml bFGF for 1-6 generations. After hADSCs grew to 80%, they were cultured for 24 hours with medium prepared with exosome-free serum. The cell culture supernatant was collected and the exosomes adhered to the cell surface were washed with PBS and collected together; and / or extraction of exosomes: The collected supernatant was pre-centrifuged at 4°C, 500g* for 10 min, 2000g* for 30 min, and 10000g* for 70 min, then transferred to a sterilized ultracentrifuge tube, sealed and weighed to two decimal places, centrifuged in an ultracentrifuge at 4°C, 100,000g for 70 min, carefully removed the supernatant with a sterile Pasteur pipette and resuspended with 20-25 ml of cold PBS, then centrifuged again at 100,000g for 70 min, finally removed the PBS and resuspended each tube with sterile PBS.

7. The method for preparing exosomes according to claim 4, characterized in that: The miR-155-5p inhibitor and miR-19b-3p are added to the exosomes obtained in step S2 by using liposomes or electroporation.

8. The use of exosomes according to claim 1, characterized in that: The use of the exosomes in the preparation of a drug for alleviating or treating osteoarthritis.

9. A medicament, characterized in that: The medicament contains the exosomes according to claim 1.

Images