Biosensor and method of making and using same

Abstract

The application belongs to the field of bioelectrochemical sensors, and discloses a biosensor and a preparation method and application thereof. The preparation method is as follows: gold source solution is used as an electrolyte, an electrode part (including a working electrode, a reference electrode and a counter electrode) is placed in the electrolyte to perform electrochemical deposition, thereby uniformly depositing gold nanoparticles on the surface of the working electrode to prepare a gold nanoparticle modified working electrode; the deposition voltage is 0.4-0.6 V; a thiol-modified redox mediator-single-stranded DNA solution is added dropwise on the surface of the gold nanoparticle modified working electrode, and after incubation, the biosensor is prepared. The method can complete the direct deposition of gold nanoparticles on the surface of the working electrode through one-step operation, is simple and efficient, is conducive to batch production and application, and can be used for the detection of target nucleic acids.

Description

Technical Field

[0001] This invention belongs to the field of bioelectrochemical sensors, specifically relating to biosensors, their preparation methods, and applications. Background Technology

[0002] Electrochemical biosensors have attracted considerable attention as powerful analytical tools in medical diagnostics due to their superior advantages over other diagnostic procedures, such as high sensitivity, simplicity, rapid response, and cost-effectiveness. With the rapid development of research fields such as precision medicine, gene sequencing, forensic identification, and environmental monitoring, the rapid, sensitive, and simple trace analysis of pathogenic proteins and specific DNA sequences is becoming increasingly important. DNA-based electrochemical biosensors have garnered widespread attention due to their advantages such as being lightweight, inexpensive, low-power, highly sensitive, and easily miniaturized. DNA electrochemical biosensors, utilizing the high sensitivity of electrochemical detection and combining it with various regenerative and signal amplification strategies, can achieve sensitive detection of trace targets.

[0003] In DNA electrochemical biosensors, DNA is typically bound to modified electrodes via chemical bonds, van der Waals forces, and other means. Currently, materials used for modifying electrodes include quantum dots, magnetic nanoparticles, noble metal nanoparticles, hydrogels, and proteins. Benefiting from the unique optical properties, excellent biocompatibility, and strong coordination of gold-sulfur bonds (Au-S bonds), modifying electrodes with gold nanomaterials and then self-assembling thiol-single-stranded DNA on their surface is the most widely used method.

[0004] Rapid assembly of single-stranded DNA (ssDNA) probes at metallographic interfaces enables simple, rapid, and stable assembly of single-stranded DNA probes at sensing interfaces, which can significantly promote the practical application of DNA electrochemical biosensors in clinical testing and on-site diagnosis. However, most current electrochemical biosensors based on gold nanomaterials for single-stranded DNA often prioritize novel materials and detection limits, neglecting the industrial application direction of the sensors. For example, electrodes are modified by introducing two-dimensional materials to prepare reduced graphene oxide-gold nanocomposites, gold-palladium-graphene quantum dot composite nanomaterials, and Ti3C2-gold-palladium nanocomposite dispersions. While the large specific surface area and high conductivity of two-dimensional materials do lower the detection limit and improve sensor performance, the preparation of these composite materials usually requires multiple reagents and multi-step experimental operations, making the preparation of biosensors more cumbersome, violating the principle of simplicity and ease of use, and hindering the promotion and application of biosensing technology.

[0005] Therefore, it is necessary to provide a simple preparation method to prepare high-performance biosensors. Summary of the Invention

[0006] The present invention aims to at least solve one of the technical problems existing in the prior art. To this end, the present invention proposes a method for fabricating a biosensor, which is simple to operate and facilitates the mass production and application of biosensors.

[0007] The present invention also proposes a biosensor.

[0008] The present invention also proposes a nucleic acid detection method for a biosensor prepared according to the above method.

[0009] According to a first aspect of the present invention, a method for fabricating a biosensor is provided, the biosensor comprising an electrode portion, the electrode portion comprising a counter electrode, a working electrode, and a reference electrode; the fabrication method comprising the following steps:

[0010] S1: Using a gold source solution as the electrolyte, the electrode portion is placed in the electrolyte for electrochemical deposition, thereby depositing gold nanoparticles on the surface of the working electrode to form a gold nanoparticle-modified working electrode; the deposition voltage of the electrochemical deposition is 0.4 to 0.6 V;

[0011] S2: A thiol-modified redox mediator-single-stranded DNA solution is dropped onto the surface of the working electrode modified with gold nanoparticles prepared in step S1, and the biosensor is obtained after incubation.

[0012] According to a preferred embodiment of the present invention, at least the following beneficial effects are achieved:

[0013] This invention utilizes electrochemical deposition to directly deposit gold nanoparticles onto the surface of a working electrode in a single step. Compared to existing gold nanocomposites, this method is simpler and more efficient, facilitating the mass production and application of biosensors. The prepared biosensor utilizes gold-sulfur bonds (Au-S bonds) formed between the gold nanoparticles and thiol groups, ensuring stable adsorption of single-stranded DNA onto the gold nanoparticle surface and guaranteeing excellent sensing performance. Simultaneously, the stable deposition of gold nanoparticles on the working electrode surface maintains the overall stability of the biosensor. Furthermore, electrochemical deposition under the aforementioned conditions produces spherical gold nanoparticles with uniform morphology and size, further ensuring excellent sensor performance. The dropwise addition method in step S2 reduces costs and maintains uniformity between electrodes, allowing for controllable concentration and volume of the thiol-modified redox mediator-single-stranded DNA solution.

[0014] In some embodiments of the present invention, the electrochemical deposition in step S1 is performed using either chronoamperometry or chronopotentialometry.

[0015] In some preferred embodiments of the present invention, the electrochemical deposition in step S1 is performed using the chronoamperometry method.

[0016] In some embodiments of the present invention, the deposition time of the electrochemical deposition is 200 to 400 s.

[0017] In some preferred embodiments of the present invention, the deposition time of the electrochemical deposition is 360 s.

[0018] In some preferred embodiments of the present invention, the deposition voltage of the electrochemical deposition is 0.5V.

[0019] In some preferred embodiments of the present invention, the electrochemical deposition voltage is 0.5V and the deposition time is 360s.

[0020] Electrochemical deposition under the above conditions can produce spherical gold nanoparticles with uniform morphology and size, thereby ensuring the excellent performance of the prepared biosensor.

[0021] In some embodiments of the present invention, the gold source solution includes at least one of chloroauric acid solution or chloroaurate solution.

[0022] In some preferred embodiments of the present invention, the gold source solution is selected from the chloroauric acid solution.

[0023] In some preferred embodiments of the present invention, the concentration of the chloroauric acid solution is 1–10 mM, for example, 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, or 10 mM. Specifically, the concentration of the chloroauric acid solution can be above 2 mM, above 3 mM, above 4 mM, and / or below 9 mM, below 8 mM, below 7 mM, or below 6 mM. Further, the concentration of the chloroauric acid solution is 2–9 mM, 3–8 mM, 4–7 mM, or 4–6 mM.

[0024] In some more preferred embodiments of the present invention, the concentration of the chloroauric acid solution is 5 mM.

[0025] In some preferred embodiments of the present invention, the pH of the chloroauric acid solution is 3 to 7, for example, pH 3, 4, 5, 6, or 7. Specifically, the pH of the chloroauric acid solution can be above 3 or 4, and / or below 7 or 6. Further, the pH of the chloroauric acid solution is between 4 and 6.

[0026] In some more preferred embodiments of the present invention, the pH of the chloroauric acid solution is 5.

[0027] In some preferred embodiments of the present invention, the concentration of the chloroauric acid solution is 1–10 mM, the pH is 3–7, and the electrochemical deposition conditions include: deposition voltage of 0.4–0.6 V and deposition time of 200–400 s. Under different acidic or alkaline conditions, the reduction potential and activity of chloroauric acid vary considerably. Therefore, it is preferable to use the above-mentioned concentration and pH of the electrochemical deposition solution and the electrochemical deposition conditions to obtain gold nanoparticles with better morphology and size on the working electrode, thereby improving the signal strength and stability of the biosensor.

[0028] In some embodiments of the present invention, the working electrode, the reference electrode, and the counter electrode of the electrode section are three independent electrodes.

[0029] In other embodiments of the present invention, the working electrode, the reference electrode, and the counter electrode of the electrode section are printed together on a substrate to form a three-electrode screen-printed electrode.

[0030] The three-electrode screen-printed electrode integrates the three electrodes together, making it more compact and portable.

[0031] In some preferred embodiments of the present invention, the electrode section selects the working electrode, the reference electrode, and the counter electrode as three independent electrodes.

[0032] In some preferred embodiments of the present invention, the electrode section uses a gold electrode as the working electrode, Ag / AgCl as the reference electrode, and a platinum wire as the counter electrode.

[0033] In some embodiments of the present invention, after the electrochemical deposition is completed, step S1 involves immersing the working electrode in water to clean it, completely removing the gold source solution adsorbed on the surface of the working electrode, and then drying it at room temperature to prepare the gold nanoparticle-modified working electrode.

[0034] Specifically, thiol-modified redox mediator-single-stranded DNA refers to single-stranded DNA with a redox mediator attached to one end (3' or 5') and a thiol group attached to the other end; that is, thiol-modified single-stranded DNA.

[0035] In some embodiments of the present invention, a reducing agent is mixed with a thiolized redox mediator-single-stranded DNA solution to prepare the thiol-modified redox mediator-single-stranded DNA solution.

[0036] Specifically, thiolated redox mediator-single-stranded DNA refers to a single-stranded DNA with a redox mediator attached to one end of the 3' and 5' ends and a thiol attached to the other end. However, thiols are easily oxidized to form disulfide bonds (SS bonds), so a reducing agent is added to reduce the disulfide bonds to thiol groups.

[0037] In some embodiments of the present invention, the reducing agent includes at least one of tricarboxyethylphosphine, dithiothreitol, or β-mercaptoethanol.

[0038] In some preferred embodiments of the present invention, the reducing agent is selected from the tricarboxyethylphosphine.

[0039] Redox mediators are electron carriers capable of reversible oxidation and reduction, enabling them to act as electron carriers in multiple redox reactions. They accelerate the transfer of electrons from primary electron donors to final electron acceptors, thereby increasing the rate of biological redox reactions by one to several orders of magnitude. Therefore, redox mediators can be used as electrochemical signal indicators.

[0040] In some embodiments of the present invention, the redox mediator includes any one of methylene blue, ferrocene, brilliant cresol blue, or acridinium derivatives.

[0041] In some preferred embodiments of the present invention, the redox mediator includes any one of methylene blue or ferrocene derivatives.

[0042] In some preferred embodiments of the present invention, the redox mediator is selected from methylene blue.

[0043] In some embodiments of the present invention, the concentration of the thiol-modified redox mediator-single-stranded DNA solution is 1–3 μM.

[0044] In some preferred embodiments of the present invention, the concentration of the thiol-modified redox mediator-single-stranded DNA solution is 1 μM.

[0045] In some embodiments of the present invention, the volume of the thiol-modified redox mediator-single-stranded DNA solution added to the surface of the gold nanoparticle-modified working electrode in step S2 is 6 to 10 μL. The specific volume to be added depends on the actual size of the gold nanoparticle-modified working electrode.

[0046] In some preferred embodiments of the present invention, the volume of the thiol-modified redox mediator-single-stranded DNA solution dropped onto the surface of the gold nanoparticle-modified working electrode in step S2 is 10 μL.

[0047] In some preferred embodiments of the present invention, the concentration of the thiol-modified redox mediator-single-stranded DNA solution is 1–3 μM, and the volume of the solution dropped onto the surface of the gold nanoparticle-modified working electrode is 6–10 μL.

[0048] In some preferred embodiments of the present invention, the incubation conditions in step S2 include: temperature 36-38°C, humidity 95-100%, and incubation time 3-5 hours.

[0049] Maintaining the temperature at 36–38°C can improve the adsorption rate of single-stranded DNA on the gold nanoparticle-modified working electrode to a certain extent. While maintaining the final signal unchanged, the incubation time can be shortened to as low as 3 hours, thus shortening the preparation time of the biosensor.

[0050] Maintaining humidity above 95% is to ensure that single-stranded DNA is in an optimal environment, preventing the surface of the gold nanoparticle-modified working electrode from drying out and affecting the adsorption of single-stranded DNA.

[0051] In some preferred embodiments of the present invention, the incubation conditions in step S2 include: temperature 37°C, humidity 100%, and incubation time 4 hours.

[0052] In some more preferred embodiments of the present invention, the incubation conditions in step S2 include a temperature of 37°C, a humidity of 100%, an incubation time of 4 hours, and protection from light.

[0053] When methylene blue is chosen as the redox mediator, incubation should be carried out in a dark environment because methylene blue is easily decomposed under light.

[0054] In some embodiments of the present invention, after the incubation is completed in step S2, the working electrode modified with gold nanoparticles adsorbed with single-stranded DNA is washed with Tris-HCl buffer, and then the working electrode modified with gold nanoparticles adsorbed with single-stranded DNA is placed in 6-mercaptohexanol solution to passivate the surface of the working electrode modified with gold nanoparticles adsorbed with single-stranded DNA and to arrange the single-stranded DNA in a monolayer. Finally, it is washed with Tris-HCl buffer to obtain the biosensor.

[0055] In some embodiments of the present invention, the concentration of the 6-mercaptohexanol is 0.5–2 mM and the volume is 100–300 μL.

[0056] In some preferred embodiments of the present invention, the concentration of 6-mercaptohexanol is 1 mM and the volume is 200 μL.

[0057] According to the second aspect of the invention, a biosensor prepared according to the above method is proposed.

[0058] According to a third aspect of the present invention, a method for detecting a target nucleic acid using a biosensor prepared according to the method is provided, comprising the following steps: contacting the biosensor with a nucleic acid sample to be tested, detecting the electrochemical signal of a redox mediator using an electrochemical method, and then detecting the target nucleic acid.

[0059] In some embodiments of the present invention, the electrochemical method is selected as square wave voltammetry.

[0060] In some embodiments of the present invention, the biosensor can also be used in conjunction with a CRISPR system to detect nucleic acids.

[0061] In some embodiments of the present invention, the CRISPR system includes a Cas protein and crRNA.

[0062] In some embodiments of the present invention, the Cas protein includes either Cas12a or Cas13a.

[0063] In some embodiments of the present invention, the sequence of the crRNA is complementary to the sequence of the target DNA in the nucleic acid sample to be tested.

[0064] Specifically, the nucleic acid sample to be tested is mixed with the CRISPR system and dropped onto the surface of the biosensor electrode. The electrochemical signal of the redox mediator is detected using an electrochemical method. When the target DNA is absent in the nucleic acid sample, crRNA cannot bind to its complementary target DNA and will not activate the trans-cleavage activity of the Cas protein. In this case, the single-stranded DNA adsorbed on the surface of the biosensor electrode will not be cleaved, and the electrochemical signal of the redox mediator can be detected and remains unchanged. When the target DNA is present in the nucleic acid sample, crRNA will bind complementary to the target DNA, activating the trans-cleavage activity of the Cas protein. The Cas protein non-specifically cleaves the single-stranded DNA adsorbed on the surface of the biosensor electrode. At this time, the redox mediator-single-stranded DNA becomes free, and the electrochemical signal of the redox mediator on the biosensor weakens. Attached Figure Description

[0065] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0066] Figure 1 The images are scanning electron microscope (SEM) images of the working electrode surface modified with gold nanoparticles prepared in Example 1 of this invention; A is a microscopic image under low magnification, with a scale bar of 500 nm; B is a microscopic image under high magnification, with a scale bar of 200 nm.

[0067] Figure 2 This is a scanning electron microscope image of the working electrode surface modified with gold nanoparticles prepared in Comparative Example 2 of the present invention; the scale bar is 500 nm.

[0068] Figure 3 The diagram shows the redox peak current detection of methylene blue in the biosensors prepared in Example 1 and Comparative Example 1 of this invention.

[0069] Figure 4 The diagram shows the redox peak current detection of methylene blue in the biosensors prepared in Example 1 and Comparative Example 2 of this invention.

[0070] Figure 5 This is a schematic diagram showing the change of the redox peak current signal of methylene blue in the biosensor 1 prepared in Example 1 of the present invention over a week.

[0071] Figure 6 The flowchart and the redox peak current detection diagram of methylene blue are shown in Embodiment 3 of the present invention, which describe the detection of the SARS-CoV-2 delta S gene using biosensor 1 in combination with the CRISPR system. The upper part is the flowchart, and the lower part is the redox peak current detection diagram of methylene blue. Detailed Implementation

[0072] The embodiments of the present invention are described in detail below. The embodiments described with reference to the accompanying drawings are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0073] In the description of this invention, unless otherwise explicitly defined, terms such as "preparation" and "incubation" should be interpreted broadly, and those skilled in the art can reasonably determine the specific meaning of the above terms in this invention in conjunction with the specific content of the technical solution.

[0074] In the description of this invention, references to terms such as "one embodiment," "some embodiments," etc., indicate that a specific structure, material, or feature described in connection with that embodiment is included in at least one embodiment of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment. Furthermore, the specific structures, materials, or features described may be combined in any suitable manner in one or more embodiments.

[0075] Unless otherwise specified, the experimental methods used in the examples are conventional methods; unless otherwise specified, the materials and reagents used are commercially available.

[0076] Example 1

[0077] In this embodiment, biosensor 1 was prepared, and the specific process is as follows:

[0078] (1) Prepare a chloroauric acid solution with a concentration of 5 mM. Adjust the pH of the chloroauric acid solution to 5 using a 0.5 M potassium hydroxide solution as the electrolyte. Select three independent electrodes for the electrode section: working electrode (gold rod electrode with a diameter of 3 mm), reference electrode (Ag / AgCl electrode), and counter electrode (platinum wire). Place the cleaned working electrode, reference electrode, and counter electrode in the electrolyte. Perform electrochemical deposition using the chronoamperometry method, set the deposition voltage to 0.5 V, and deposit for 360 s.

[0079] After electrochemical deposition, the working electrode is removed, immersed in ultrapure water for 5 minutes to completely remove the chloroauric acid solution adsorbed on the surface of the working electrode, and then dried at room temperature to prepare a working electrode modified with gold nanoparticles.

[0080] (2) Mix 10 mM tricarboxyethylphosphine solution with 100 μM thiolized methylene blue (MB)-single-stranded DNA solution. After 2 h, a thiol-modified methylene blue-single-stranded DNA solution is obtained. The thiol group is used to adsorb onto the surface of the working electrode (gold rod electrode) to form a stable Au-S bond. Methylene blue is a redox mediator used to generate an electrochemical signal. Then, a Tris mixed solution (including 10 mM Tris-HCl, 2 mM disodium ethylenediaminetetraacetate, 10 mM magnesium chloride, and 0.1 M sodium chloride) is added to dilute the concentration of the thiol-modified methylene blue-single-stranded DNA solution to 1 μM.

[0081] 10 μL of a 1 μM solution of thiol-modified methylene blue-single-stranded DNA was dropped onto the surface of a gold nanoparticle-modified working electrode and incubated for 4 h at 37 °C and 100% humidity in the dark. After incubation, the electrode was thoroughly rinsed with 10 mM Tris-HCl buffer (pH = 7.4), and then immersed in 200 μL of a 1 mM 6-mercaptohexanol solution for 1 h to passivate the surface of the electrode and allow the single-stranded DNA to form a monolayer on the electrode surface. Finally, the electrode was thoroughly rinsed with 10 mM Tris-HCl buffer (pH = 7.4) to obtain biosensor 1.

[0082] Example 2

[0083] In this embodiment, biosensor 2 was prepared, and the specific process is as follows:

[0084] (1) Prepare an 8 mM chloroauric acid solution and adjust the pH of the chloroauric acid solution to 6 using a 0.5 M potassium hydroxide solution as the electrolyte. Select a three-electrode screen-printed electrode. The three electrodes are printed on a glass substrate. The three electrodes include a working electrode (gold electrode), a reference electrode (Ag / AgCl electrode), and a counter electrode (platinum wire). Place the cleaned three-electrode screen-printed electrode in the electrolyte. Perform electrochemical deposition using the chronoamperometry method, set the deposition voltage to 0.6 V, and deposit for 400 s.

[0085] After electrochemical deposition, the three-electrode screen-printed electrode is removed, immersed in ultrapure water for 5 minutes to completely remove the chloroauric acid solution adsorbed on the surface of the working electrode, and then dried at room temperature to prepare the working electrode modified with gold nanoparticles.

[0086] (2) Mix 10 mM dithiothreitol solution with 100 μM thiolized methylene blue-single-stranded DNA solution. After 2 h, thiol-modified ferrocene-single-stranded DNA solution is obtained. The thiol group is used to adsorb onto the surface of the working electrode (gold electrode) to form a stable Au-S bond. Ferrocene is a redox mediator used to generate an electrochemical signal. Then, Tris mixed solution (including 10 mM Tris-HCl, 2 mM disodium ethylenediaminetetraacetate, 10 mM magnesium chloride, and 0.1 M sodium chloride) is added to dilute the concentration of thiol-modified ferrocene-single-stranded DNA solution to 1 μM.

[0087] 8 μL of a 1 μM thiol-modified ferrocene-single-stranded DNA solution was dropped onto the surface of a gold nanoparticle-modified working electrode and incubated at 37 °C and 100% humidity for 3 h. After incubation, the electrode was thoroughly rinsed with 10 mM Tris-HCl buffer (pH = 7.4), and then the three-electrode screen-printed electrode was immersed in 300 μL of 1.5 mM 6-mercaptohexanol solution for 1 h to passivate the surface of the gold nanoparticle-modified working electrode with adsorbed single-stranded DNA and to arrange the single-stranded DNA in a monolayer on the electrode surface. Finally, the electrode was thoroughly rinsed with 10 mM Tris-HCl buffer (pH = 7.4) to obtain biosensor 2.

[0088] Example 3

[0089] In this embodiment, the biosensor 1 prepared in Example 1 was used in conjunction with a CRISPR system to detect whether the nucleic acid sample to be tested contained SARS-CoV-2 deltaS virus. The detection procedure is as follows: Figure 6 As shown, the specific process is as follows:

[0090] Identified a DNA sequence identical to the SARS-CoV-2 delta S gene (SEQ ID NO: 1). NO:1:TGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGCATTACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACCAAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAAAACTTCAAAATGTGGTCAACCAAAATGCACAAG CTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTTCAAGTGTTTTAAATGATATCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGG CAGACTTCAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCTACT), based on which a crRNA sequence complementary to the SARS-CoV-2 delta S gene sequence (SEQ ID NO:3: UAAUUUCUACUAAGUGUAGAUAAGUUUUCCAAGUGCACUUG), and designed a single-stranded DNA sequence (SH-SEQ ID NO:2: CTCAACTTATTATTACGAAC-MB); the Cas12a protein was assembled with the above crRNA into a CRISPR system;

[0091] The redox peak current of methylene blue (MB) in biosensor 1 was detected and recorded using square wave voltammetry. Then, the CRISPR system was mixed with the nucleic acid sample to be tested and added to the surface of the biosensor electrode of biosensor 1. The mixture was incubated at room temperature for 2 hours, and the redox peak current of methylene blue was detected using square wave voltammetry at this time. The square wave voltammetry used a 10 mM Tris-HCl solution containing 0.1 M sodium chloride as the electrolyte, and the scan range was (-0.4)–(-0.1) V vs. Ag / AgCl.

[0092] Testing revealed that, compared to detecting methylene blue alone, the redox peak current of biosensor 1 was significantly weakened after the sensor came into contact with the CRISPR system and the nucleic acid sample to be tested. This indicates that SARS-CoV-2 deltaS virus can be detected in the nucleic acid sample. This is because the crRNA binds complementary to the gene sequence of SARS-CoV-2 deltaS virus in the nucleic acid sample, activating the trans-cleavage activity of the Cas12a protein. The Cas12a protein non-specifically cleaves the single-stranded DNA adsorbed on the surface of the biosensor electrode of biosensor 1. At this point, the methylene blue-single-stranded DNA becomes free, thus significantly weakening the redox peak current signal of methylene blue.

[0093] Comparative Example 1

[0094] In this comparative example, biosensor a was prepared. The difference between this and Example 1 is that in Comparative Example 1, the sensor directly immobilized single-stranded DNA onto a gold electrode, without depositing gold nanoparticles on the electrode. The specific process is as follows:

[0095] Three independent electrodes were selected for the electrode section: a working electrode (a gold rod electrode with a diameter of 3 mm), a reference electrode (Ag / AgCl electrode), and a counter electrode (platinum wire). A 10 mM tricarboxyethylphosphine solution was mixed with a 100 μM thiolized methylene blue-single-stranded DNA solution, and after 2 h, a thiol-modified methylene blue-single-stranded DNA solution was obtained. Then, a Tris mixed solution (including 10 mM Tris-HCl, 2 mM disodium ethylenediaminetetraacetate, 10 mM magnesium chloride, and 0.1 M sodium chloride) was added to dilute the concentration of the thiol-modified methylene blue-single-stranded DNA solution to 1 μM.

[0096] 10 μL of a 1 μM solution of thiol-modified methylene blue-single-stranded DNA was dropped onto the surface of the working electrode and incubated for 4 h in the dark at 37 °C and 100% humidity. After incubation, the electrode was thoroughly rinsed with 10 mM Tris-HCl buffer (pH = 7.4), and then the electrode with adsorbed single-stranded DNA was immersed in 200 μL of 1 mM 6-mercaptohexanol solution for 1 h to passivate the surface of the electrode with adsorbed single-stranded DNA and to arrange the single-stranded DNA in a monolayer on the electrode surface. Finally, the electrode was thoroughly rinsed with 10 mM Tris-HCl buffer (pH = 7.4) to obtain biosensor a.

[0097] Comparative Example 2

[0098] In this comparative example, biosensor b was prepared. The difference between this comparative example and Example 1 is that the voltage for electrochemical deposition in Comparative Example 1 was 0.1V, while the rest of the process was the same as in Example 1.

[0099] Test case

[0100] This experimental example tested the performance of the biosensors prepared in Example 1 and Comparative Example 1. Wherein:

[0101] 1. Characterization of the surfaces of the working electrodes modified with gold nanoparticles for biosensor 1 and biosensor b

[0102] The gold nanoparticle-modified working electrode prepared in Example 1 and the gold nanoparticle-modified working electrode prepared in Comparative Example 2 were observed under a scanning electron microscope. The results of Example 1 are as follows: Figure 1 As shown, the results of Comparative Example 2 are as follows: Figure 2 As shown. Figure 1 The results show that a layer of gold nanoparticles with uniform morphology and size was uniformly deposited on the surface of the working electrode. This ensures the excellent performance of the biosensor subsequently fabricated. Figure 2 The results show that the gold nanoparticles deposited on the electrode surface are uneven, with obvious gaps in the electrode coating. The black areas indicate excessive aggregation of the gold nanoparticles, which is detrimental to increasing the active area. This demonstrates that the gold nanoparticles prepared by electrochemical deposition within the voltage range of 0.4–0.6 V of this invention are uniform.

[0103] 2. Test the sensing performance of biosensor 1, biosensor a, and biosensor b.

[0104] The redox peak current of methylene blue in biosensor 1 prepared in Example 1 and biosensor a prepared in Comparative Example 1 was detected using square wave voltammetry. The electrolyte for square wave voltammetry was a 10 mM Tris-HCl solution containing 0.1 M sodium chloride. The scan range was (-0.4)–(-0.1) V vs. Ag / AgCl, the potential increment was 4 mV, the frequency was 25 Hz, and the frequency modulation amplitude was 25 mV. The results are as follows: Figure 3 As shown. Figure 3 The results show that, compared with biosensor a (which directly immobilizes single-stranded DNA on a gold electrode), the redox peak current of methylene blue in biosensor 1 (which immobilizes single-stranded DNA on gold nanoparticles) is significantly increased, reaching 12 μA, indicating that biosensor 1 has better sensing performance.

[0105] As above, the redox peak current of methylene blue in biosensor 1 prepared in Example 1 and biosensor b prepared in Comparative Example 2 was detected using square wave voltammetry. The results are as follows: Figure 4 As shown. Figure 4The results show that, compared to biosensor b (deposition voltage 0.1V), the redox peak current of methylene blue in biosensor 1 (deposition voltage 0.5V) is significantly increased, indicating that the deposition voltage of the present invention can be used to prepare more uniform gold nanoparticles on the working electrode surface, thereby enabling the biosensor to have better sensing performance.

[0106] 3. Testing the stability of biosensor 1

[0107] The redox peak current of methylene blue in the biosensor 1 prepared in Example 1 was detected long-term using square wave voltammetry. The electrolyte for square wave voltammetry was a 10 mM Tris-HCl solution containing 0.1 M potassium chloride. The scan range was (-0.4)–(-0.1) V vs. Ag / AgCl. The results are as follows: Figure 5 As shown. Figure 5 The results show that the reduction in the redox peak current of methylene blue in biosensor 1 is less than 10% within one week, and more than 90% of the current signal can be maintained, indicating that the biosensor prepared by the present invention has good stability.

[0108] The above demonstrates that the method for preparing biosensors according to the present invention is simple, the prepared sensor signal is stable, and the current intensity can reach the microampere level, which is beneficial to the mass production and application of biosensors.

[0109] The embodiments of the present invention have been described in detail above. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A method for preparing a biosensor, characterized by, The biosensor comprises an electrode part, which comprises a counter electrode, a working electrode and a reference electrode; and the preparation method comprises the following steps: S1: gold nanoparticles are deposited on the surface of the working electrode by electrochemical deposition of the electrode part in a gold source solution as an electrolyte, the deposition voltage of the electrochemical deposition is 0.4-0.6 V, the gold source solution is a chloroauric acid solution, the concentration of the chloroauric acid solution is 1-10 mM, and the pH is 3-7; after the electrochemical deposition, the working electrode is cleaned by immersion in water to completely remove the gold source solution adsorbed on the surface of the working electrode, and then dried at room temperature to obtain a gold nanoparticle modified working electrode; S2: a thiol-modified redox mediator-single-stranded DNA solution is prepared by mixing a reducing agent and a thiolated redox mediator-single-stranded DNA solution, the reducing agent comprises at least one of tricarboxyethyl phosphine, dithiothreitol or β-mercaptoethanol, the redox mediator comprises any one of methylene blue, ferrocene, brilliant cresyl blue or acridone derivative, and the concentration of the thiol-modified redox mediator-single-stranded DNA solution is 1-3 μM; the thiol-modified redox mediator-single-stranded DNA solution is added dropwise on the surface of the gold nanoparticle modified working electrode prepared in step S1, and then incubated under the conditions of a temperature of 36-38 ℃, a humidity of 95-100% and an incubation time of 3-5 h; after the incubation, the gold nanoparticle modified working electrode adsorbed with single-stranded DNA is cleaned with Tris-HCl buffer, and then placed in a 6-mercaptohexanol solution to passivate the surface of the gold nanoparticle modified working electrode adsorbed with single-stranded DNA and arrange the single-stranded DNA monolayer, and finally cleaned with Tris-HCl buffer to obtain the biosensor.

2. The method of claim 1, wherein, The electrode part uses a gold electrode as the working electrode, Ag / AgCl as the reference electrode and a platinum wire as the counter electrode.

3. The method of claim 1, wherein, The electrochemical deposition in step S1 is performed by any one of chronocoulometry or chronopotentiometry.

4. A biosensor prepared by the method according to any one of claims 1-3.

5. A method for detecting a target nucleic acid of a biosensor prepared according to any one of claims 1 to 3, characterized by, The method comprises the following steps: contacting the biosensor with a nucleic acid sample to be detected, and detecting the electrochemical signal of the redox mediator by electrochemistry to further detect the target nucleic acid.

Images