A multi-center / dna core-shell type nanocomposite based on gold nanoparticle adhesive mediator and application thereof
By using gold nanoparticle binder-mediated multicenter/DNA core-shell nanocomposite (Apt-ADMC) assembly technology, the problems of enzymatic degradation and low delivery efficiency of DNA nanostructures in nuclear-targeted drug delivery have been solved, enabling tumor-targeted drug delivery with high drug loading and long circulation time, while avoiding systemic toxicity.
Patent Information
- Application Number
- CN202210883124.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-26
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2042-07-26
AI Technical Summary
Existing DNA nanostructures are difficult to pass through cell nuclear pores effectively and avoid enzymatic degradation within cells, resulting in low drug delivery efficiency and the inability to achieve targeted drug delivery to the cell nucleus. Furthermore, traditional gold nanoparticle binders have limited applications in constructing hierarchical composite nanostructures.
Using 5 nm diameter AuNPs as binders, multicenter/DNA core-shell nanocomposites (Apt-ADMC) were assembled with aptamer-functionalized DNA tetrahedral beads through gold thiol chemical modification. This composite can circulate stably in the blood and break down into small particles in the cytoplasm to enter the cell nucleus and release chemotherapy drugs.
It achieves high drug loading and long circulation time of chemotherapy drugs, significantly improves drug accumulation at the tumor site, achieves almost 100% tumor inhibition effect, and avoids toxicity to healthy tissues. It also has excellent organelle targeting and enzyme degradation resistance.
Smart Images

Figure CN116327969B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of nanomaterials, and particularly relates to a multi-center / DNA core-shell type nanocomposite based on gold nanoparticle adhesive mediation and application thereof. BACKGROUND
[0002] It is well known that chemotherapeutic drugs are widely used in cancer treatment. However, the non-specific distribution of drugs can lead to poor treatment effect and cardiotoxicity, etc. Therefore, in order to selectively transport large doses of anticancer drugs into cancer cells, active targeted drug delivery has gained extensive research interest, which is usually based on the help of cancer cell targeting ligands such as antibodies, aptamers, peptides and specific small recognition molecules.
[0003] DNA nanotechnology as an emerging field provides simple and powerful technical support for the self-assembly of one-dimensional, two-dimensional and three-dimensional nanostructures. As a promising drug delivery candidate nanomaterial, DNA nanostructure has a series of excellent properties, including: significant programmability, high drug loading capacity, excellent biocompatibility, and structural stability. Most of the efforts previously made in the field of drug delivery based on DNA assembly at the cellular level have focused on positioning the nanostructure in the endosome-lysosome compartment, cytoplasm or membrane receptor-mediated cell surface binding. The main reason is that DNA nanocarriers with targeting function need to be modified with different functional molecules to have hierarchical targeting ability, and often need to have a small size to pass through organelle pores (e.g., nuclear pores). However, small-sized DNA nanostructures have low delivery efficiency due to their easy degradation and rapid kidney clearance during circulation. Even if the nanostructure of appropriate size is accidentally internalized into the diseased cell and decomposed into small particles inside the cell, due to the failure to successfully escape from the lysosome, the degradation of organelle targeting elements and even the entire nanoassembly in the complex cellular environment, they are difficult to reach the organelle. It is generally believed that the drugs released from the carrier into the cytoplasm can diffuse to some organelles to some extent driven by the concentration gradient, but the effectiveness and therapeutic effect of the drugs are affected due to the resistance of the dense cytosol compartment. Despite this, so far, there is no reliable theoretical model to design antinuclease organelle targeting elements or sufficiently small DNA nanocarriers to pass through the nuclear pore but not be degraded by enzymes before reaching the intended target. There are still technical challenges in developing DNA nanostructures as organelle-targeted drug delivery systems.
[0004] The nucleus is the ultimate destination of a large number of chemotherapeutic drugs such as doxorubicin (Dox). In addition, direct delivery of anticancer drugs to the nucleus can greatly avoid the efflux transporter-mediated drug resistance and improve the therapeutic effect. Therefore, despite the major technical challenges associated with multiple biological barriers in vivo, there is an urgent need to develop drug nanocarriers for transporting therapeutic agents to the nucleus.
[0005] The surface of gold nanomaterials is easily modified with various functional oligonucleotides through gold thiol chemistry. Due to good biocompatibility, ideal ability to protect surface DNA chains from enzymatic degradation, and easy preparation and functionalization, AuNPs are increasingly popular in nanomedicine, especially in cell imaging, photothermal therapy and drug delivery. In addition, small diameter AuNPs can be used to transport drug-loaded double-stranded DNA through nuclear pores and reach genomic DNA by constructing nanotrucks. However, due to the high dependence of drug carriers on nanotrucks, the payload capacity of nanotrucks is limited. Interestingly, in terms of structural function, in the process of constructing various hierarchical composite nanostructures, DNA assemblies only serve as an adhesive framework with spatially addressable binding sites to organize different nanomaterials to obtain the expected collective optical, electromagnetic or biological properties. So far, few people have used gold nanoparticles as an adhesive tape to assemble hierarchical structures to expand the application of DNA nanostructures in nanomedicine. Due to the misunderstanding of the design idea of DNA nanoscale composite structure organization, there are still technical bottlenecks in developing a DNA nanostructure-based nuclear-targeted drug delivery system.
[0006] In this application, AuNPs with a diameter of 5 nm are used as an adhesive tape to fold a string of aptamer-functionalized DNA tetrahedron into a large spherical DNA nanostructure. The aptamer-functionalized composite nanomaterial (Apt-ADMC) is first proved to be a size-switchable nuclear-targeted drug delivery system. ADMC is an abbreviation of multi-center (M) nanocomposite (C) composed of AuNPs (A) and periodic threaded DNA tetrahedron (D). After systemic administration to tumor-bearing animal models, the Apt-ADMC loaded with chemotherapeutic drugs enters cancer cells through the aptamer located at the vertex of the DNA tetrahedron. In addition, the internalized Apt-ADMC drug can "intelligently" respond to endogenous nucleases and disassemble the entire structure into single small spherical AuNPs surrounded by a dense array of tetrahedral layers, which can pass through nuclear pores, diffuse into the nucleus and release drugs. Due to at least 10-fold increase in drug payload capacity and significantly enhanced resistance to enzymatic degradation, the Apt-ADMC drug has a significantly prolonged systemic circulation time and has sufficient time to search for and enter cancer cells, resulting in sufficient accumulation of chemotherapeutic drugs at the tumor site and achieving almost 100% tumor inhibition effect without any detectable toxicity to normal organs and tissues. SUMMARY
[0007] The present application aims at the above-mentioned problems, and provides a multi-center / DNA core-shell type nanocomposite based on gold nanoparticle adhesive agent mediation and used for in vivo tumor cell nuclear targeted staging drug delivery.
[0008] To achieve the above-mentioned purpose, the present application adopts the following technical solutions:
[0009] A multi-center / DNA core-shell type nanocomposite based on gold nanoparticle adhesive agent mediation, comprising small size gold nanoparticles (AuNPs), a thiolated linking probe (CDS), a sequence (cCDS) partially complementary to the thiolated linking probe, and a palindromic aptamer-functionalized tetrahedral string bead (Apt-Nano-Tetra);
[0010] The nanogold is AuNPs with a diameter of 5 nm prepared by the sodium citrate reduction method;
[0011] The thiolated linking probe CDS is 5'-TTCAGACCTCCGTTAACAATTTTTTTTTTTTGCTGCTGCTGCTGCTTTTTT-SH-3';
[0012] The sequence cCDS partially complementary to the thiolated linking probe is 5'-GCAGCAGCAGCAGCA-3';
[0013] The palindrome-mediated aptamer functionalized tetrahedral string of beads is composed of the following 5 DNA strands:
[0014] T a : 5'-ATTGTTAACGGAGGTCTGAATTTTTGCTGTGATGCACCTAGTATGATACCGCCGAGAGTGTATTGGACCTCGCAT-3';
[0015] T b : 5'-GTAAGGATTCAGACTTTCTAGGTGCATCACAGCTCCAGCTTGCTACACTGTTTTTGAGATCGATCTC-3';
[0016] T c : 5'-ACTAGGAGAGGGTTGATCAGTGTAGCAAGCTGGTATGCGAGGTCCAATACTTTTTTGTTCGTATTCCTATTCGTC-3';
[0017] T d : 5'-AAGTCTGAATCCTTACTTCAACCCTCTCCTAGTTCTCTCGGCGGTATCATTTTTTGAGATCGATCTC-3';
[0018] E-sgc8: 5'-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTTTGACGAATAGGAATACGAAC-3'.
[0019] The above method for constructing the multi-center / DNA core-shell type nanocomposite based on gold nanoparticle adhesive mediation includes the following steps:
[0020] 1) Prepare AuNPs with a diameter of 5 nm by the sodium citrate reduction method;
[0021] 2) Add 0.5 μL of 10 mM tris(2-carboxyethyl)phosphine to 40 μL of 100 μM CDS and incubate at room temperature for 1 hour to reduce the thiol group;
[0022] 3) The reduced solution was slowly added to 1 mL of AuNPs (67 nM) under gentle shaking and left to react in the dark for 16 h. After the addition of 10.4 μL of 500 mM Tris-acetate buffer (pH 8.2), 300 μL of 1 M NaCl solution was slowly added and then incubated in the dark for 24 h under gentle shaking, purified by centrifugation (10000 rpm, 10 min) through an ultrafiltration tube (MWCO = 10 kD), the pellet was washed 3 times with Tris buffer (25 mM Tris, 100 mM NaCl, pH 8.2) and then dispersed in 1.34 mL of 1 x TAE / Mg 2+ buffer. The resulting solution, called AuNP-CDS (final concentration, 50 nM), was stored at 4°C before use;
[0023] 4) Preparation of Apt-Nano-Tetra: equal amounts (4 μL, 10 μM) of T a , T b , T c , T d and E-sgc8 were mixed and heated at 90°C for 5 min and then slowly cooled to room temperature. The resulting product, Apt-Nano-Tetra, had a final concentration of 2 μM and was stored at 4°C;
[0024] 5) Apt-ADMC: 20 μL of 50 nM AuNP-CDS were incubated with 4 μL of 10 μM cCDS at 37°C for 1 h. The resulting product (AuNP-CDS / cCDS) was called AuNP-dsDNA. Then, 20 μL of Apt-Nano-Tetra (2 μM) were added and mixed well, and then incubated in the dark for 4 h. After centrifugation (10000 rpm, 10 min), the supernatant was discarded and the pellet was dispersed in 20 μL of 1 x TAE / Mg 2+ buffer. Apt-ADMC was obtained with a final apparent concentration of 10 nM.
[0025] 6) Drug loading: Doxorubicin (Dox) was added to the mixture obtained in step 5 and incubated at 37°C overnight to obtain Dox-Apt-ADMC.
[0026] 1 x TAE / Mg 2+ buffer was 40 mM Tris, 20 mM boric acid, 2 mM EDTA, 12.5 mM MgCl2, pH = 7.6.
[0027] In the above palindrome-mediated aptamer functionalization tetrahedral string beads, five DNA chains T a : T b : T c : T d : The molar ratio of E-sgc8 is 1:1:1:1:1. And the 3 ends of Tb and Td chains contain palindrome sequences that can connect the tetrahedrons into strings.
[0028] The above gold nanoparticle adhesive-mediated multi-center / DNA core-shell type nanocomposite is applied to the preparation of an in-vivo tumor cell nucleus targeting staging drug delivery system.
[0029] The inventive principle of the present application is as follows:
[0030] Apt-ADMC is made of multiple adhesive AuNP tapes (AuNP-dsDNA) and periodic thread aptamer combined DNA tetrahedral string beads (Apt-Nano-Tetra). As shown in Figure Figure 1 a, first, AuNP is modified with CDS by a simple gold thiol chemical method, and then hybridized with cCDS to form AuNP-dsDNA. Apt-Nano-Tetra is assembled by five DNA chains in a one-step annealing process. The basic tetrahedral unit of Apt-Nano-Tetra is composed of T a , T b , T c and T dFour strands are involved. Unlike traditional designs, the four vertices of the current DNA tetrahedron each have four sticky ends to ensure a high assembly efficiency of Apt-Nano-Tetra and a high binding affinity of aptamer to target cells. Specifically, the two palindromic sticky ends at two vertices of the triangular base of the tetrahedron can self-hybridize with the adjacent tetrahedron with the same palindromic sequence, making it possible to efficiently assemble linear nano-tetrahedron. The sticky end at the other vertex of the triangular base is used to bind the target cell targeting aptamer. The sticky end at the upward vertex is designed to hybridize with the CDS strand fixed on the surface of AuNP. Therefore, the incubation of Apt-Nano-Tetra with AuNP nanotape can form Apt-ADMC, in which multiple AuNP centers cooperatively fold Apt-Nao-Tetra lines into a compact structure. In addition to the Dox loading site designed according to the literature method, the main drug delivery carrier is the tetrahedral unit. In order to facilitate understanding of the structure and function, Apt-ADMC is circumscribed by a circumscribed sphere, the outer surface of which has specially designed aptamers folded into hairpin structures and resistant to endogenous nucleases. The current study uses sgc8 as an aptamer model, which can selectively recognize cell membrane protein tyrosine kinase 7 (PTK7) positive cancer cells. Human T-cell acute lymphoblastic leukemia (CCRF-CEM) cells overexpressing PTK7 were used as target cells, while human B-cell Burkitt lymphoma cells (Ramos) with low PTK7 expression were used as negative control cells. Because the tetrahedral unit is an ideal anticancer drug carrier with high drug loading capacity, Dox can be densely loaded into Apt-ADMC through a simple co-incubation step (Fig. 1b, Dox-Apt-ADMC).
[0031] Nucleus-targeted drug delivery by Apt-ADMC is shown in Figure 1c. Specifically, after systemic administration of Dox-Apt-ADMC to tumor-bearing mice, it has the unique advantage of being stable in circulation for a long time due to its resistance to nuclease degradation, and retains the binding properties inherent to aptamer unaffected. The additional protection of rigid DNA tetrahedron and hairpin-shaped aptamer and DNA self-assembly layer shell based on AuNP prevents endonuclease attack. Therefore, Dox-Apt-ADMC has many opportunities to find tumor sites and effectively accumulate in cancer tissues. After being trapped in the cytoplasm for a long enough time, the palindrome-mediated ligation part (double-stranded DNA fragments with cuts) is preferentially degraded, and Dox-Apt-ADMC is broken down into several small and separate Dox-loaded nuclear shell particles (SDP), each containing only one AuNP core surrounded by a few linearly connected Tetra units. Then, SDP particles enter the nucleus, continuously release chemotherapeutic drugs, inhibit topoisomerase activity by intercalating into genomic DNA, inhibit cancer cell proliferation, and cause apoptosis. Due to the structural stability in the blood circulation, Apt-ADMC is expected to deliver anticancer drugs to the nucleus while avoiding off-target toxicity to healthy tissues.
[0032] The advantages of the present application are:
[0033] The present application discloses a kind of adhesion metal nano particle mediated multicenter / DNA core-shell type nanocomposite for in vivo tumor cell nucleus targeted drug delivery.The drug delivery system has the following advantages: (i) ideal preferential tumor accumulation.Due to enhanced stability in blood circulation, Apt-ADMC intravenous administration is preferentially accumulated in tumor tissue and exhibits very long tumor retention time, promoting fluorescence imaging and treatment.(ii) easy from in vivo excretion.Residual Apt-ADMC is mainly distributed in liver, kidney, and therefore is easily cleared from the body by reticuloendothelial system, substantially avoiding systemic toxicity caused by off-target effects.(iii) transport therapeutic agents to appropriate target points.Because Apt-ADMC is decomposed into single small size particles surrounded by short linear Apt-Nano-Tetra in cytoplasm, and can enter the nucleus through nuclear pores, Dox molecules targeting genomic DNA can be delivered to the nucleus and exert their inherent therapeutic effects.(iv) high drug loading capacity.By hybridization between sticky ends, tetrahedral units are concatenated into linear drug delivery carriers, which can load and transport a large amount of chemotherapeutic drugs.These features make Apt-ADMC a promising drug delivery tool for high-precision cancer treatment in vivo without systemic toxicity.More importantly, for Apt-ADMC, loose DNA nanoassemblies are folded into compact nanostructures using non-nucleic acid materials as molecular tools, suitable for long circulation and active aggregation at tumor sites, and can be disassembled into small size nanoparticles that can enter the nucleus and release drugs in situ with high efficiency.This concept provides valuable insights into designing complex nano-scale structures with powerful functions through DNA nanotechnology, combining the unique features of building blocks including nucleic acids and non-nucleic acids, and ultimately realizing biomedical applications. BRIEF DESCRIPTION OF DRAWINGS
[0034] Figure 1 : Schematic diagram of step-by-step assembly of Apt-ADMC and in vivo drug delivery.a: synthesis of DNA-functionalized AuNP (AuNP-CDS / cCDS), and folding of periodic thread aptamer-anchored DNA tetrahedron (Apt-Nano-Tetra) into Apt-ADMC by using AuNP-DNA as tape, as well as enlarged view of local structure to illustrate different functional domains;b: loading of chemotherapeutic drug Dox into Apt-ADMC;c: nucleus-targeted cancer treatment by systemic administration.
[0035] Figure 2 : Atomic force microscopy (AFM) characterization of ADMC morphology.a: schematic diagram of ADMC;b: AFM image;c: enlarged AFM image;d: corresponding 3D AFM image.
[0036] Figure 3 a and Figure 3 b: Specific tumor cell recognition ability of Apt-ADMC. Confocal fluorescence images of CEM cells treated with Cy5-labeled Apt-ADMC, Nano-Tetra, Apt-Nano-Tetra, ADMC, RS-ADMC or Apt-ADMC, respectively (a), scale bar, 25 μm, Cy5 fluorescence was modified at the 5' end of the Tb chain for the emission of fluorescence signals; b is the fluorescence intensity recorded from a.
[0037] Figure 3 c and Figure 3 d: Specific tumor cell recognition ability of Apt-ADMC. Confocal fluorescence images of Ramos cells treated with Cy5-labeled Apt-ADMC, Nano-Tetra, Apt-Nano-Tetra, ADMC, RS-ADMC or Apt-ADMC, respectively (c), scale bar, 25 μm, Cy5 fluorescence was modified at the 5' end of the Tb chain for the emission of fluorescence signals; d is the fluorescence intensity recorded from c.
[0038] Figure 4 : Drug loading ability analysis and drug release behavior analysis of Apt-ADMC. a Fluorescence spectra of 3 μΜ Dox in the presence of different concentrations of Apt-ADMC. b: Drug release behavior of Dox-Apt-ADMC in PBS buffer (pH 7.4, containing 20 U / mL DNase I), PBS buffer (pH 7.4) or PBS buffer (pH 5.0). In addition, the drug release of free Dox was measured in PBS buffer (pH 7.4). The measured data are represented as mean ± standard deviation (n = 3).
[0039] Figure 5 : In vivo tumor targeting ability of Apt-ADMC. In vivo fluorescence imaging of tumor-bearing mice intravenously injected with Cy5-labeled Apt-ADMC, ADMC and Apt-AuNP at different time points. The circle represents the tumor site.
[0040] Figure 6a : Schematic diagram of systemic administration of Dox-Apt-ADMC.
[0041] Figure 6b : Changes in tumor volume of mice during treatment with saline, free Dox, Dox-ADMC and Dox-Apt-ADMC. Black arrows indicate the administration time points. The measured data are represented as mean ± standard deviation (n = 3). **P = 0.0074, ****P < 0.0001.
[0042] Figure 6c Representative pictures of tumors collected at day 18 of treatment.
[0043] Figure 6d Body weight changes of tumor-bearing mice in different treatment groups over 18 days.
[0044] Figure 6e Histological analysis of tumor tissue sections collected at day 18 of treatment, stained by H&E and imaged on an optical microscope. DETAILED DESCRIPTION
[0045] In order to make the content of the present application more convenient to understand, the technical solutions of the present application are further described below in combination with specific embodiments. However, the following examples are only examples of the present application and do not represent the scope of the protection of the present application. The scope of the protection of the present application is subject to the claims.
[0046] Example 1 A gold nanoparticle adhesin-mediated multi-centric / DNA core-shell nanocomplex for hierarchical assembly for in vivo tumor cell nucleus-targeting staging drug delivery, comprising the following steps:
[0047] 1) Preparation of 5 nm diameter AuNPs by sodium citrate reduction method;
[0048] 2) 0.5 μL of 10 mM tris(2-carboxyethyl)phosphine was added to 40 μL of 100 μM CDS and incubated for 1 hour at room temperature to reduce thiols. The reduced solution was slowly added to 1 mL of AuNPs (67 nM) under gentle shaking and incubated for 16 h in the dark. After the addition of 10.4 μL of 500 mM Tris-acetate buffer (pH 8.2), 300 μL of 1 M NaCl solution was slowly added, followed by incubation for 24 hours in the dark with gentle shaking. Purification was performed by centrifugation (10000 rpm, 10 minutes) through an ultrafiltration tube (MWCO = 10 kD). The precipitate was washed 3 times with Tris buffer (25 mM Tris, 100 mM NaCl, pH 8.2) and then dispersed in 1.34 mL of 1xTAE / Mg 2+ buffer. The resulting solution, called AuNP-CDS, had a final concentration of 50 nM and was stored at 4°C before use.
[0049] 3) Apt-Nano-Tetra preparation: Equal amounts (4 μL, 10 μM) of T a , T b , T c , T dMix and heat at 90°C for 5 min, then slowly cool to room temperature. The final concentration of the resulting product, Apt-Nano-Tetra, is 2 μΜ, and is stored at 4°C.
[0050] 4) Apt-ADMC preparation: Take 20 μΐ, aliquot of 50 nM AuNP-CDS and 4 μΐ, of 10 μΜ cCDS, incubate at 37°C for 1 h, the resulting product (AuNP-CDS / cCDS) is called AuNP-dsDNA. Then, add 20 μΐ, of Apt-Nano-Tetra (2 μΜ) and mix well, then incubate in the dark for 4 h. Centrifuge (10000 rpm, 10 min), discard the supernatant, and disperse the precipitate in 20 μΐ, of 1 x TAE / Mg 2+ buffer to get Apt-ADMC, with a final apparent concentration of 10 nM.
[0051] 5) Drug loading: Add the chemotherapeutic drug doxorubicin (Dox) to the resulting Apt-ADMC, incubate at 37°C overnight to get Dox-Apt-ADMC.
[0052] The thiolated linker probe CDS is: 5'- TTCAGACCTCCGTTAACAATTTTTTTTTTTTGCTGCTGCTGCTGCTTTTTT-SH-3';
[0053] The sequence cCDS partially complementary to the thiolated linker probe is: 5'- GCAGCAGCAGCAGCA-3';
[0054] The palindromic mediated aptamer functionalized tetrahedral string of beads is composed of the following 5 DNA strands:
[0055] T a : 5'- ATTGTTAACGGAGGTCTGAATTTTTGCTGTGATGCACCTAGTATGATACCGCCGAGAGTGTATTGGACCTCGCAT-3';
[0056] T b : 5'- GTAAGGATTCAGACTTTCTAGGTGCATCACAGCTCCAGCTTGCTACACTGTTTTTGAGATCGATCTC-3';
[0057] T c5'-AAGTCTGAATCCTTACTTCAACCCTCTCCTAGTTCTCTCGGCGGTATCATTTTTTGAGATCGATCTC-3';
[0058] T d 5'-AAGTCTGAATCCTTACTTCAACCCTCTCCTAGTTCTCTCGGCGGTATCATTTTTTGAGATCGATCTC-3';
[0059] E-sgc8: 5'-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTTTGACGAATAGGAATACGAAC-3'.
[0060] Example 2 Characterization of hierarchical assembly of gold nanoparticle adhesives mediated multi-center / DNA core-shell nanocomplexes.
[0061] The gold nanoparticle adhesives mediated multi-center / DNA core-shell nanocomplexes (ADMC) constructed using the method of Example 1 were analyzed for morphology by AFM.
[0062] The specific steps of AFM characterization are as follows:
[0063] The ADMC sample was diluted 20 times with 1x TAE / Mg 2+ buffer. Then, 10 μΐ of the diluted sample was dropped on a flat and smooth mica surface for adsorption for 20 minutes. After washing with ultrapure water for 3 times and drying with nitrogen, AFM measurement was performed.
[0064] Figure 2 a is a schematic diagram of the structure of ADMC. The tetrahedral structural units of Nano-Tetra are distributed radially around AuNPs. In ADMC, one linear Nano-Tetra can connect multiple AuNPs. Similarly, one AuNP can bond different Nano-Tetra lines and fold them into a dense configuration.
[0065] Figure 2 b is the AFM image of the nanostructure of ADMC.
[0066] Figure 2 c in the Figure 2Figure 6b. Magnified view of the area indicated by the dashed box in Figure 6a. It can be noted that although the number of AuNPs varies from aggregate to aggregate, each AuNP and even the entire aggregate is surrounded by a thick DNA corona, indicating the formation of a densely distributed layer of Nano-Tetra assemblies and an adhesive effect AuNP tape. The average number of AuNPs in one ADMC was estimated to be 5 (n = 20).
[0067] Figure 2 Figure 6d. Shows a 3D AFM model further showing the sharp contrast between the convex and concave geometric patterns within the ADMC.
[0068] Example 3 Analysis of the specific tumor cell recognition ability of Apt-ADMC
[0069] Apt-ADMC drug delivery system was constructed using the method of Example 1, and imaged using laser confocal microscopy by incubating with different cells. The specific steps are as follows:
[0070] In order to provide a fluorescent signal, the T b Cy5 fluorescence at the 5' end of the strand. CEM cells (5 x 10 5 Ramos cells (5 x 10 5 Cells were transferred to centrifuge tubes respectively, and Cy5-labeled Nano-Tetra (final concentration, 108.8 nM), Apt-Nano-Tetra (final concentration, 108.8 nM), ADMC (final concentration, 0.8 nM), RS-ADMC (final concentration, 0.8 nM) and Apt-ADMC (final concentration, 0.8 nM) were incubated with CEM cells and Ramos cells respectively at 37°C for 2 hours. After washing twice with washing buffer (4.5 g / L glucose, 5.5 mM MgCl2·6H2O, 2.67 mM KCl, 1.47 mM KH2PO4, 137.93 mM NaCl, 8.06 mM Na2HPO4, 0.9 mM CaCl2, pH = 7.4), the cells were incubated in a Hoechst 33342 solution (10 μg / mL) at 37°C for 15 minutes. Then, the cells were washed twice and resuspended in 20 μL binding buffer (obtained by adding yeast tRNA (final concentration, 0.1 mg / mL) and BSA (final concentration, 1 mg / mL) to the washing buffer). Subsequent confocal microscope imaging was performed. Hoechst 33342 was excited at 405 nm, while Cy5 was excited at 638 nm.
[0071] Control samples Nano-Tetra and ADMC were prepared using the same experimental procedures as Apt-Nano-Tetra and Apt-ADMC, respectively, except that the aptamer sequence E-sgc8 was replaced by the corresponding volume of buffer. Control samples RS-ADMC were prepared using the same experimental procedures as Apt-ADMC, respectively, except that the aptamer sequence E-sgc8 was replaced by the corresponding random sequence RS. The RS corresponding sequence is as follows:
[0072] 5'-AACACCGTGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTTTTTTGACGAATAGGAATACGAAC-3'.
[0073] Figure 3 Analysis of specific tumor cell recognition ability of Apt-ADMC.
[0074] Figure 3 The confocal images of target CEM cells and Ramos control cells incubated with Nano-Tetra, Apt-Nano-Tetra, ADMC, RS-ADMC or Apt-ADMC, respectively, are shown in a. It can be noted that Nano-Tetra shows very weak fluorescence in CEM cells. The fluorescence signal of CEM cells treated with Apt-Nano-Tetra is significantly enhanced due to the specific binding of aptamer to target cells, indicating that the aptamer indeed helps the internalization of DNA nanomaterials. Even without aptamer, cells incubated with ADMC show a moderate fluorescence signal, because DNA functionalized AuNPs can enter mammalian cells without transfection reagents. At the same time, incubation in Apt-ADMC makes CEM cells emit a higher fluorescence signal, indicating effective internalization. It can be seen that the binding affinity of the collective aptamer on the surface of AuNPs to multiple receptors on the cell membrane is significantly enhanced in a multivalent manner. In contrast, treatment of target cells with RS-ADMC cannot increase the fluorescence signal, which indicates that the intracellularization of Apt-ADMC depends on the cell targeting specificity of the surface-limited aptamer.
[0075] Figure 3 b is Figure 3 a is the fluorescence intensity quantitative analysis chart corresponding to the images.
[0076] Figure 3 In c, using negative cells Ramos cells as a control, it was found that there was no significant difference in fluorescence between each group, and they all showed weak fluorescence signals, which indicated that Apt-ADMC could not effectively enter negative cells, confirming the cell targeting specificity based on the PTK7 / aptamer interaction.
[0077] Figure 3 d is Figure 3 c Quantitative analysis of fluorescence intensity of corresponding images.
[0078] Example 4 Drug loading capacity analysis and drug release behavior investigation of Apt-ADMC.
[0079] Using the method of Example 1, the Apt-ADMC drug delivery system was constructed, the Dox concentration was fixed, and then incubated with different concentrations of Apt-ADMC, and then the fluorescence intensity was measured using a fluorescence spectrometer. After determining the optimal drug loading ratio of Apt-ADMC, the drug-loaded Dox-Apt-ADMC was placed in different environments for drug release study. The specific steps are as follows:
[0080] Drug loading: 3 μL of 0.2 mM Dox was mixed with 0 μL, 2 μL, 4 μL, 8 μL, 12 μL, 16 μL, 20 μL, or 24 μL of 10 nM Apt-ADMC, respectively. The resulting solution was supplemented to 200 μL with 1×TAE / Mg 2+ buffer and incubated at 37°C overnight. Dox fluorescence spectra from 500 to 700 nm were collected on a Hitachi F-7000 fluorescence spectrometer (Hitachi Ltd., Japan).
[0081] Drug release: Dox-Apt-ADMC (53.2 μL, 10 nM) was diluted to 100 μL with 1×TAE / Mg 2+ buffer and then placed in a dialysis bag (MWCO = 3.5 KDa). The dialysis bag outer liquid was 3 mL PBS buffer (pH 7.4, containing 20 U / mL DNase I), 3 mL PBS buffer (pH 7.4) or 3 mL PBS buffer (pH 5.0), respectively, and dialysis was carried out in the dark. At the designated time points (0 h, 0.5 h, 1 h, 2 h, 4 h, 8 h, 12 h, 24 h, 36 h, or 48 h), 200 μL of dialysate was removed and detected on a Hitachi F-7000 fluorescence spectrometer. In addition, the fluorescence of 100 μL of 20 μM free Dox was measured in 3 mL PBS buffer (pH 7.4). The final equivalent concentrations of the four solutions were consistent.
[0082] Figure 4a is the drug loading capacity analysis result of Apt-ADMC. To evaluate the content of Dox loaded into the nanocarrier, the fluorescence intensity of 3 mM Dox was measured in the presence of different concentrations of Apt-ADMC from 0 to 1.2 nM. The Dox fluorescence gradually decreased with the increase of nanomaterial concentration. When the concentration of Apt-ADMC increased to 0.8 nM, the Dox fluorescence almost reached the minimum value, and no fluorescence reduction was detected at higher concentrations of nanocarrier. Therefore, the binding ratio of Apt-ADMC to Dox is 1:3750. The drug loading capacity (3750) of Apt-ADMC is tens of times (75-85) of the DNA nanocarrier in the literature (see references 1: X. Liu, L. Wu, L. Wang, W. Jiang, Talanta 2018, 179, 356-363; 2: Z. Xia, P. Wang, X. Liu, T. Liu, Y. Yan, J. Yan, J. Zhong, G. Sun, D. He, Biochemistry 2016, 55, 1326-1331; 3: G. Zhu, J. Zheng, E. Song, M. Donovan, K. Zhang, C. Liu, W. Tan, Proceedings of the national academy of sciences 2013, 110, 7998-8003) and should be attributed to the fact that the Nano-Tetra-based carrier is a collection of multiple tetrahedrons.
[0083] Figure 4b Drug release behavior analysis of Dox-Apt-ADMC. Compared with the rapid diffusion of free Dox, the drug release of Dox-Apt-ADMC in neutral buffer (pH 7.4) is very slow. The amount of Dox released is less than 10% after 48 hours of incubation. To explore whether the Dox release of Dox-Apt-ADMC occurs under certain conditions, the in vitro drug release efficiency was evaluated in an acidic environment or a solution containing nucleases. It can be noted that even after 48 hours of incubation in an acidic solution (pH 5.0), the Dox release efficiency is less than 20%, indicating that more than 80% of Dox remains in the Apt-ADMC carrier. In contrast, in the presence of high concentrations (20 U / mL) of DNase I, Dox fluorescence rapidly increases with increasing incubation time and almost reaches a plateau value at 8 h. The data show that Dox-Apt-ADMC has excellent stability in physiological solution and even in an acidic environment, thereby avoiding accidental leakage of the drug during transport, making it possible for the drug to enter the nucleus through the acidic cellular environment. In addition, when incubated in a digestive organelle (e.g., the nucleus) for a sufficient period of time, it is expected that the encapsulated Dox will be released from the Apt-ADMC.
[0084] Example 5 Analysis of the in vivo tumor targeting ability of Apt-ADMC
[0085] Apt-ADMC drug delivery system was constructed using the method of Example 1, and the biodistribution was evaluated using a small animal imaging instrument after intravenous injection of Cy5-labeled Apt-ADMC (10 nM), ADMC (10 nM), and Apt-AuNP (50 nM) into tumor-bearing mice.
[0086] The specific steps are as follows:
[0087] CEM cells (1.0 x 10 7 cells per mouse) were subcutaneously inoculated into BALB / c male nude mice (about 20 g, 4-6 weeks old) to establish a tumor model. When the tumor volume reached about 400 mm 3 When the tumor volume reached about 400 mm
[0088] The control sample ADMC was prepared using the same experimental procedure as Apt-ADMC, except that the aptamer sequence E-sgc8 was replaced with a buffer of the appropriate volume.
[0089] Preparation steps of the control sample Apt-AuNP: Cy5-T e Mix 4 μL (10 μM) of MgCl₂ and 4 μL (10 μM) of E-sgc₈ and anneal at 90 °C for 5 min, then slowly cool to room temperature. Add the resulting solution to 20 μL of 50 nM AuNP-CDS and mix thoroughly, then incubate at 37 °C for 1 h. After centrifugation (10,000 rpm, 10 min), discard the supernatant. Disperse the precipitate in 20 μL of 1×TAE / MgCl₂. 2+ In the buffer solution, Apt-AuNP (final concentration: 50 nM) is obtained.
[0090] The sequence used is as follows:
[0091] Cy5-T e :5'-ATTGTTAACGGAGGTCTGAATTTTTTGTTCGTATTCCTATTCGTC-Cy5-3'.
[0092] like Figure 5 As shown, for the Apt-ADMC carrier, the Cy5 fluorescence signal at the tumor site gradually increased over time, indicating effective tumor accumulation of Apt-ADMC. Based on local fluorescence emission intensity, the highest fluorescence signal appeared at 4 h post-administration, and the fluorescence intensity did not decrease significantly after 8 h. Conversely, for ADMC without a targeting ligand, although tumor accumulation was observed, the fluorescence signal was relatively low throughout the 8-h latency period. A possible reason is that although non-targeting nanocarriers can accumulate at the tumor site through enhanced permeability and retention (EPR) effects, the vast majority are cleared by the reticuloendothelial system. For Apt-AuNP, a weak fluorescence signal was detected at the tumor site, and the fluorescence intensity almost disappeared at 8 h, indicating a much lower tumor accumulation efficiency. This should be attributed to its small size and rapid renal clearance in vivo. The experimental results indicate that Apt-ADMC has significant tumor-targeting recognition ability and effective tumor accumulation.
[0093] Example 6: Dox-Apt-ADMC's ability to inhibit tumor growth in vivo.
[0094] A Dox-Apt-ADMC drug delivery system was constructed using the method described in Example 1. Different therapeutic agents were injected intravenously into tumor-bearing mice. Changes in mouse body weight and tumor volume during treatment were then observed. Finally, the tumor tissue was stained after treatment to analyze its tumor-therapeutic capacity. The specific steps are as follows:
[0095] Targeted cancer therapy: When the tumor volume reached about 100 mm 3 When the tumor volume reached about 100 mm
[0096] Tissue staining: All mice were sacrificed after 18 days of treatment. Tumors were collected, photographed, and subjected to histological studies. After 24 h of fixation with 4% paraformaldehyde, tumors were embedded in paraffin, sectioned at 5 μm, and stained with hematoxylin for 20 min. After two washes with ultrapure water, sections were placed in a HC-ethanol solution (1 :99) for 30 s and then washed with ultrapure water for 10 min. Subsequently, sections were stained with 0.5% eosin for 2 min. After sequential washes with absolute ethanol and 95% ethanol, sections were fixed with neutral resin mountant and imaged under an optical microscope for histological analysis.
[0097] Figure 6a A schematic representation of intravenous injection of the therapeutic agent is shown.
[0098] Figure 6b Compared to the saline group, the inhibitory effect on tumor growth was: free Dox < Dox-ADMC < Dox-Apt-ADMC. That is, the tumor volume treated with free Dox decreased slightly, which was mainly due to the lack of targeting activity of Dox throughout the body, with only a limited amount of Dox entering the cancer tissue. Dox-ADMC showed moderate tumor inhibition efficiency, which was due to the lack of targeting moieties, although DNA-functionalized gold nanoparticles could enter mammalian cells without the help of transfection reagents, the accumulation of anticancer therapeutic drugs at the tumor site was insufficient. While Dox-Apt-ADMC almost completely inhibited the growth of tumors and no significant increase in tumor volume was observed during the entire treatment period. It can be seen that because of the active targeting ability of Dox-Apt-ADMC and the stability of nuclease-based degradation resistance in the circulatory system, they can reach the target cancer tissue with higher efficiency.
[0099] Figure 6c Representative ex vivo images of the corresponding tumors further verified the chemotherapeutic activity.
[0100] Figure 6dThe systemic toxicity of Dox-Apt-ADMC was evaluated by analyzing the body weight changes of mice during the 18-day treatment period. The body weight slightly decreased after treatment with free Dox, because the uncontrolled diffusion-based off-target effect of free Dox not only reduces the therapeutic effect, but also causes toxic side effects. Compared with the saline group, Dox-Apt-ADMC treatment did not cause detectable weight loss, indicating no systemic toxicity to mice.
[0101] Figure 6e The tumor tissues were analyzed histologically by H&E staining. Compared with other experimental groups, Dox-Apt-ADMC induced a significant increase in intercellular space, indicating more effective apoptosis. The experimental results show the enhanced tumor treatment effect of Dox-Apt-ADMC.
[0102] The above description is only the preferred embodiment of the present application, and any equivalent changes and modifications made within the scope of the patent application of the present application shall be covered by the scope of the present application.
Claims
1. A multi-centric / DNA core-shell type nanoparticle based on gold nanoparticle adhesives mediated, characterized by: The multi-center / DNA core-shell type nanocomposite comprises small-size gold nanoparticles AuNP, thiolated connecting probe CDS, and thiolated connecting probe partially complementary sequence cCDS, and palindrome-mediated aptamer functionalized tetrahedral string bead Apt-Nano-Tetra; The small-size gold nanoparticles AuNP are prepared by a sodium citrate reduction method, and have a diameter of 5 nm; The thiolated connecting probe CDS is 5'-TTCAGACCTCCGTTAACAATTTTTTTTTTTTGCTGCTGCTGCTGCTTTTTT-SH-3'; The thiolated connecting probe partially complementary sequence cCDS is 5'-GCAGCAGCAGCAGCA-3'; The palindrome-mediated aptamer functionalized tetrahedral string bead Apt-Nano-Tetra is composed of the following five DNA chains: Ta: 5'-ATTGTTAACGGAGGTCTGAATTTTTGCTGTGATGCACCTAGTATGATACCGCCGAGAGTGTATTGGACCTCGCAT-3'; Tb: 5'-GTAAGGATTCAGACTTTCTAGGTGCATCACAGCTCCAGCTTGCTACACTGTTTTTGAGATCGATCTC-3'; Tc: 5'-ACTAGGAGAGGGTTGATCAGTGTAGCAAGCTGGTATGCGAGGTCCAATACTTTTTTGTTCGTATTCCTATTCGTC-3'; Td: 5'-AAGTCTGAATCCTTACTTCAACCCTCTCCTAGTTCTCTCGGCGGTATCATTTTTTGAGATCGATCTC-3'; E-sgc8: 5'-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTTTGACGAATAGGAATACGAAC-3'.
2. A method for constructing a multi-centric / DNA core-shell type nanoparticle based on gold nanoparticle adhesives according to claim 1, characterized by: The following steps are included: 1) Small-size gold nanoparticles AuNP with a diameter of 5 nm are prepared by a sodium citrate reduction method; 2) 0.5 μL of 10 mM tris(2-carboxyethyl)phosphine is added to 40 μL of 100 μM thiolated connecting probe CDS, and the thiol group is reduced by incubation at room temperature for 1 hour; 3) The solution of step 2) reduction treatment was slowly added to 1 mL, 67 nM of small size gold nanoparticles AuNPs under gentle shaking and reacted in the dark for 16 h; after the addition of 10.4 μL, 500 mM, pH 8.2 Tris-acetate buffer, 300 μL of 1 M NaCl solution was slowly added and then incubated in the dark for 24 hours under gentle shaking, purified by centrifugation at 10000 rpm for 10 minutes through MWCO = 10 kD ultrafiltration tubes, the precipitate was washed 3 times with Tris buffer and then dispersed in 1.34 mL of 1 x TAE / Mg 2+ buffer, the resulting solution was called AuNP-CDS with a final concentration of 50 nM and stored at 4°C before use; 4) Preparation of Apt-Nano-Tetra: equal amounts of 4 μL, 10 μM of Ta, Tb, Tc, Td and E-sgc8 are mixed and heated at 90°C for 5 minutes, and then slowly cooled to room temperature, and the final concentration of the obtained product Apt-Nano-Tetra is 2 μM, and is stored at 4°C; 5) Preparation of Apt-ADMC: 20 μL, 50 nM AuNP-CDS was incubated with 4 μL, 10 μM cCDS at 37 °C for 1 h, the resulting product was called AuNP-dsDNA, then, 20 μL, 2 μM Apt-Nano-Tetra was added and mixed well, then incubated in the dark for 4 h, centrifuged at 10000 rpm for 10 minutes, after the supernatant was discarded, the precipitate was dispersed in 20 μL of 1 x TAE / Mg 2+ buffer solution, to obtain Apt-ADMC with a final concentration of 10 nM; 6) Drug loading: the chemotherapeutic drug doxorubicin Dox is added to the mixture obtained in step 5), and is incubated at 37°C overnight to obtain Dox-Apt-ADMC.
3. The method of construction of claim 2, wherein: The palindromic-mediated aptamer functionalized tetrahedral string beads, the molar ratio of five DNA chains Ta:Tb:Tc:Td:E-sgc8 is 1:1:1:1:1, and the 3' end of Tb and Td chains both contain palindromic sequences which can connect the tetrahedrons into strings.
4. The method of construction of claim 2, wherein: Tris buffer is a mixed solution of 25 mM Tris and 100 mM NaCl, pH 8.2; 1 x TAE / Mg 2+ Buffer is a mixed solution of 40 mM Tris, 20 mM boric acid, 2 mM EDTA and 12.5 mM MgCl2, pH = 7.
6.
5. Use of the gold nanoparticle-based adhesin-mediated multi-centric / DNA core-shell type nanocomplex according to claim 1 in the preparation of an in vivo tumor cell-targeted drug delivery system, characterized by: The tumor cells are cell membrane protein tyrosine kinase 7 positive cancer cells.
Citation Information
Patent Citations
Novel efficient intelligent targeted drug delivery system
CN110559445A
Nucleic acid nano device with cancer cell and mitochondria dual targeting
CN114053425A