A novel sweet protein mutant and its application

Abstract

The present invention relates to the fields of genetic engineering and protein modification technology, and more particularly to a novel sweet protein mutant and its application. Based on the wild-type monellin sweet protein with the amino acid sequence of SEQ ID NO: 1, the present invention provides mutants containing a single I8A point mutation, a single E50Q point mutation, a double I8A / N35G point mutation, a double I8A / E50Q point mutation, a triple I8A / N35G / Y79W point mutation, and a five-point I8A / N35G / E50Q / Y79W / R88P point mutation. The mutants have a sweetness that is 25%-200% higher than that of the wild-type, while maintaining a substantially equivalent protein content. These mutants can be widely used as sweeteners in food, feed, and other fields.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering and protein engineering, and in particular to a novel sweet protein mutant and its application. Background Art

[0002] Sweeteners have a significant impact on global food production, with production increasing from 8 million tons in 1900 to 70 million tons in 1970. As people's health demands become increasingly stringent, they desire sweeteners with minimal or even no added sugar, a good taste, and reasonable prices. Before the 1950s and 1960s, the majority of sweeteners used in the food industry were sucrose and saccharin, a petrochemical product. After the 1950s and 1960s, sweeteners such as cyclamate, dipeptide sweeteners, thaumatin, acesulfame potassium, and alitame appeared in the United States, Europe, and Japan.

[0003] As the food industry continues to innovate and transform, many innovative companies are searching for new ingredients to address global nutritional challenges. Amai Proteins, a UK-based startup founded in late 2016, is expanding its sweetener production to impact the global sweetener market. Dr. Ilan Samish, CEO and founder of Amai Proteins, stated, "Excessive sugar intake is one of the greatest challenges to human health today. The application of sweeteners in food and beverages can significantly help address this issue. These proteins, unlike sugar, taste like sugar, but do not produce any blood sugar response when digested, making them true zero-calorie sweeteners with significant health benefits. Since the 1960s, eight sweeteners have been discovered from tropical plants: somatin, monellin, caprine, brazzein, pentadin, neoculin, curculin, and a miraculin known as miraculin. Their high sweetness or flavor-modifying properties have garnered significant interest."

[0004] Monellin was first discovered by Morris and Cagan from tropical plants in West Africa. Dioscoreophyllum cumminsii Isolated and purified from the red berries of Diels, naturally extracted monellin comprises five proteins with similar composition and structure, designated monellin I-IV. The most prominent of these is monellin IV, which is 3,000 times sweeter than an equivalent mass of sucrose. Its sweetness develops slowly, fades slowly, and lasts for a long time, resulting in a lingering taste. It consists of two peptide chains connected by non-covalent bonds, each containing 45 and 50 amino acids. Separating the A and B peptide chains of the monellin molecule loses its sweetness, demonstrating that the intact natural structure is essential for its sweetness. Temperature and pH significantly affect its sweetness: Aqueous solutions lose their sweetness when heated to 55-60°C; sweetness is also lost when the pH is below 2 or above 9 at room temperature.

[0005] Because natural monellin is sensitive to heat and acid treatment, which easily causes protein denaturation, the commercial production of monellin has been slow. With the rapid development of biotechnology, it is now possible to connect the two ends of the two peptide chains of monellin to form a stable single-chain protein with the same sweetness as natural monellin, which would greatly promote the commercialization of monellin. At the same time, genetic engineering techniques can also be used to make changes based on the gene, improving stability while increasing sweetness. The present invention utilizes molecular biotechnology to address these problems. By cultivating monellin sweet protein in yeast, the amino acid sequence is modified and some of it is altered at the DNA level, making the sweet protein more stable and increasing sweetness. This results in a cheaper product that is more suitable for the mass food market, which is sufficient to have a significant impact on the sweetener market. Summary of the Invention

[0006] The present invention aims to provide a novel sweet protein mutant. Through protein engineering techniques, the present invention screens for mutation sites that significantly enhance the sweetness of monellin sweet protein and achieves efficient expression in Pichia pastoris, facilitating its widespread application.

[0007] One aspect of the present invention relates to a monellin protein, the amino acid sequence of which is SEQ ID NO: 1.

[0008] One aspect of the present invention relates to a monellin mutant, wherein the amino acid at position 8 of the monellin protein having the amino acid sequence of SEQ ID NO: 1 is changed from Ile to Ala, or the amino acid at position 50 is changed from Glu to Gln.

[0009] The amino acid sequence of the mutant is SEQ ID NO: 3 or SEQ ID NO: 4.

[0010] One aspect of the present invention relates to a monellin mutant, wherein the amino acid at position 35 of the monellin protein having the amino acid sequence of SEQ ID NO: 3 is changed from Asn to Gly, or the amino acid at position 50 is changed from Glu to Gln.

[0011] The amino acid sequence of the mutant is SEQ ID NO: 5 or SEQ ID NO: 6.

[0012] One aspect of the present invention relates to a monellin mutant, wherein the amino acid sequence of the monellin mutant is SEQ ID NO: 5, in which the 79th amino acid is changed from Tyr to Trp.

[0013] The amino acid sequence of the mutant is SEQ ID NO: 7.

[0014] One aspect of the present invention relates to a monellin mutant, wherein the amino acid sequence of the monellin protein is SEQ ID NO: 7, wherein the 50th amino acid is changed from Glu to Gln, and the 88th amino acid is changed from Arg to Pro.

[0015] The amino acid sequence of the mutant is SEQ ID NO: 8.

[0016] The present invention also relates to a nucleotide sequence encoding the above monellin mutant.

[0017] The present invention also relates to a recombinant expression plasmid carrying a nucleotide sequence encoding the monellin mutant.

[0018] The present invention also relates to a host cell comprising the above-mentioned recombinant expression plasmid.

[0019] The host cell is Pichia pastoris ( Pichia pastoris ).

[0020] The above recombinant expression plasmid was transferred into Pichia pastoris host cells for recombinant expression, and the sweetness of the obtained monellin mutant was significantly improved.

[0021] The present invention also relates to the application of the monellin mutant in the field of food or feed production.

[0022] Compared to wild-type monellin Mon1, the mutants provided herein, each containing a single point mutation of I8A, a single point mutation of E50Q, a double point mutation of I8A / N35G, a double point mutation of I8A / E50Q, a triple point mutation of I8A / N35G / Y79W, and a five-point mutation of I8A / N35G / E50Q / Y79W / R88P, have a sweetness increase of 25%-200%, while maintaining essentially the same protein content, achieving unexpected technical benefits. The monellin mutants provided herein have a high sweetness and can be widely used as sweeteners in food, feed production, and other fields. Implementation Method

[0023] The present invention has used the conventional techniques and methods that genetic engineering and molecular biology field use, for example the method of putting down in writing in MOLECULAR CLONING:A LABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENTPROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003).These general references provide definition and method well known to those skilled in the art.But those skilled in the art can, on the basis of the technical scheme put down in writing in the present invention, adopt other conventional methods, experimental scheme and reagent of this area, and are not limited to the limitation of specific embodiments of the present invention.

[0024] The PCR enzyme and ligase used in the examples of the present invention were purchased from Takara, the restriction endonuclease was purchased from Fermentas, the plasmid extraction kit and gel purification recovery kit were purchased from Omega, and the GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.

[0025] The Escherichia coli DH5α, vector pPIC9k, Pichia pastoris GS115, pPICZA, Amp, G418, and Zeocin used in the examples of the present invention were purchased from Invitrogen.

[0026] The sweetness detection method described in the embodiment of the present invention is as follows:

[0027] The sweetness of sweet proteins is determined using a blind taste test. The control group for the blind test uses a 10% sucrose aqueous solution. The sweet protein samples to be tested are prepared at different concentration gradients and randomly numbered. A 10-person evaluation panel then tastes the samples and determines which of the different concentration gradients have the same or similar sweetness as the 10% sucrose aqueous solution, thereby calculating the sweetness of the samples.

[0028] The formula is: relative sucrose sweetness multiple = 10 × dilution multiple.

[0029] Preparation of different concentration gradient samples of sweet protein: first weigh 1.0g of sweet protein sample and dilute it to 100ml with distilled water to make a 1.0% sample solution; then measure the 1.0% sample solution and further dilute it with distilled water to make test solutions with different dilution multiples such as 2x, 4x, 6x, 8x, 10x, 20x, 50x, 100x, 200x, and 300x.

[0030] The protein content detection method described in the embodiment of the present invention is as follows:

[0031] 1. Reagents

[0032] (1) Coomassie Brilliant Blue G-250 staining solution: Dissolve 100 mg of Coomassie Brilliant Blue G-250 in 50 ml of 95% ethanol, add 100 ml of 85% phosphoric acid, and dilute with water to 1 liter. It can be used at room temperature for 1 month.

[0033] (2) Standard protein solution: Use bovine serum albumin, determine the protein content in advance by the micro-Kjeldahl method, and prepare a 1 mg / ml protein standard solution based on its purity;

[0034] (3) Preparation of standard stock solution: Accurately weigh 0.05 g of crystallized bovine serum albumin on an analytical balance, dissolve it in a small beaker with a small amount of distilled water, and transfer it to a 50 ml volumetric flask. Rinse the residual liquid in the beaker several times with a small amount of distilled water, pour the rinse solution into the volumetric flask, and finally adjust the volume to the mark with distilled water. The standard stock solution is prepared with a bovine serum albumin concentration of 1000 μg / ml.

[0035] 2. Drawing of the standard curve.

[0036] (1) Take 6 test tubes, number them, add reagents according to the table below, and mix well.

[0037] pipe number 1 2 3 4 5 6 Sample (ml) 0 0.1 0.2 0.3 0.4 0.5 Water (ml) 2.0 1.9 1.8 1.7 1.6 1.5 Protein content (mg / ml) 0 0.05 0.1 0.15 0.2 0.25

[0038] Accurately pipette 2.5 ml of Coomassie Brilliant Blue solution into 6 clean test tubes. Accurately pipette 0.1 ml of the solution from each tube into the corresponding numbered test tubes. Vortex mix thoroughly. After standing at room temperature for 5 minutes, zero the tube No. 1 and measure the colorimetric value at 595 nm. Record the absorbance.

[0039] Draw a standard curve: Record the absorbance readings for tubes 1-6, plotting the standard curve with protein content (μg) on ​​the horizontal axis and absorbance on the vertical axis. Note: Due to the strong staining ability of Coomassie Brilliant Blue, the cuvette must be cleaned thoroughly. Do not use a quartz cuvette for measurement.

[0040] 3. Sample determination

[0041] Sample preparation:

[0042] (1) Liquid sample: dilute the sample to be tested to a protein content of 0.1-0.3 mg / ml and control the absorbance value after removing the blank (after subtracting the blank) to be between 0.2-0.4;

[0043] (2) Solid samples: Accurately weigh 1.0000 g of sample into a 100 ml Erlenmeyer flask, add 20 ml of deionized water using a pipette, stir magnetically for 10 min, centrifuge at 4000 rpm for 10 min, and take the supernatant for further dilution to determine the protein content. The dilution method is the same as for liquid samples.

[0044] Sample testing:

[0045] Take a clean test tube, add 2.5 ml of Coomassie Brilliant Blue solution, then add the sample to be tested, vortex and shake, and place at room temperature for 5 minutes. Use the standard curve blank as a control, and use a 1 cm optical path micro-colorimetric cup to measure the absorbance at 595 nm. Calculate the protein content based on the standard curve.

[0046] 4. Calculation of protein content

[0047] Protein content = X * dilution factor * standard sample conversion factor.

[0048] X: protein content (mg / ml) calculated from the standard curve;

[0049] Standard sample conversion value: The standard sample is 47 mg / ml, and a coefficient is converted based on the actual measured value.

[0050] The present invention will be further described below in conjunction with specific implementation methods.

[0051] Example 1 Construction of recombinant plasmid

[0052] Applicants will come from Dioscoreophyllum cumminsii The monellin gene was named Mon1, its nucleotide sequence was SEQ ID NO: 1, and its encoded amino acid sequence was SEQ ID NO: 2.

[0053] The gene was synthesized by BGI Genomics Co., Ltd. and has a full length of 291bp.

[0054] Use restriction enzymes Eco RI and Not I was used to digest the Monellin Mon1 gene; at the same time, restriction enzyme Eco RI and Not Plasmid pPIC9K was digested with enzymes. The digestion products were purified using a gel purification kit and ligated using T4 DNA ligase. The ligated products were transformed into DH5α Escherichia coli and selected with ampicillin. To ensure accuracy, several clones were sequenced. Plasmids were purified from E. coli clones with positive sequencing results using a plasmid miniprep kit to obtain a recombinant plasmid, which was named pPIC9K-Mon1.

[0055] Example 2 Construction and screening of monellin mutants

[0056] In order to further improve the sweetness activity of monellin sweet protein Mon1, the applicant conducted a large number of mutation screening on the gene through directed evolution technology. PCR amplification primers were designed based on the Mon1 gene sequence, and the upstream and downstream primers were introduced respectively. Eco RI and Not I restriction enzyme cutting site (primer sequences are shown below), and PCR amplification was performed using the GeneMorph II Random Mutagenesis PCR Kit (Stratagene).

[0057] Primer 1 (F): gcgc gaattc ggagaatgggaaatcatcgatatcg;

[0058] Primer 1 (R): taaa gcggccgctcaaggaggaggaacaggtccgtta.

[0059] The PCR conditions were as follows: denaturation at 94°C for 5 min, followed by denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, and after 35 cycles, incubation at 72°C for 10 min.

[0060] PCR products were cleaved with restriction enzymes Eco RI and Not I was used for double enzyme digestion, and the enzyme digestion system is shown in Table 1.

[0061] Table 1 Eco RI and Not I double enzyme digestion system

[0062] Element Enzyme digestion system (100 μl) PCR products 40 μl 10×H buffer 10 μl 10×BSA 10 μl RI 5 μl I 5 μl <![CDATA[ddH2O]]> 30 μl

[0063] After enzyme digestion at 37℃ for 4 h, the enzyme-digested fragments were recovered by agarose gel electrophoresis. Eco RI was used for single enzyme digestion, and the enzyme digestion system is shown in Table 2.

[0064] Table 2 Eco RI single enzyme digestion system

[0065] Element Enzyme digestion system (100 μl) pPIC9K 20 μl 10×H buffer 10 μl RI 5 μl <![CDATA[ddH2O]]> 65 μl

[0066] After enzyme digestion at 37℃ for 4 h, the fragments were recovered by agarose gel electrophoresis. Not I was used for single enzyme digestion, and the enzyme digestion system was shown in Table 3.

[0067] Table 3 Not I single enzyme digestion system

[0068] Element Enzyme digestion system (100 μl) pPIC9K recovery fragment 20 μl 10×H buffer 10 μl 10×BSA 10 μl 10 μl 10×Triton 10 μl I 5 μl <![CDATA[ddH2O]]> 45 μl

[0069] After enzyme digestion at 37°C for 4 h, the fragments were recovered by agarose gel electrophoresis.

[0070] will pass Eco RI and Not The PCR fragment digested with enzyme I was ligated with the expression vector pPIC9K to construct the expression vector. The ligation system was as follows: 5 μl of the expression vector pPIC9K digested product, 3 μl of the gene digested product, 1 μl of 10×T4 ligase buffer, and 1 μl of T4 ligase.

[0071] Ligation was performed overnight at 22°C. The ligation product was transformed into E. coli DH5α and plated onto LB+Amp plates (0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, 1.5% agar powder) and incubated upside down at 37°C. Once transformants appeared, they were picked individually with a toothpick and transferred to a 96-well plate. 150 μl of LB+Amp medium (0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin) supplemented with 0.1 mM IPTG was added to each well. The cells were shaken at 37°C and 220 rpm for 6 h. The supernatant was discarded after centrifugation, and the cells were resuspended in buffer and repeatedly frozen and thawed to obtain E. coli cell lysate containing monellin. The cell lysate was then centrifuged, and the supernatant was collected. The sweet taste activity of monellin was assayed to calculate the specific activity of different mutants.

[0072] Experimental results showed that some mutations had no effect on the sweetness activity of Mon1, while others reduced its sweetness activity. Furthermore, while some mutations increased Mon1's sweetness, they significantly altered its enzymatic properties, failing to meet the requirements. Ultimately, the applicant identified mutations and combinations that significantly improved sweetness activity without affecting its original enzymatic properties: single-point mutations I8A and E50Q, dual-point mutations I8A / N35G and I8A / E50Q, triple-point mutations I8A / N35G / Y79W, and five-point mutations I8A / N35G / E50Q / Y79W / R88P.

[0073] Based on the wild-type monellin Mon1, the present invention provides mutants containing an I8A single point mutation, an E50Q single point mutation, an I8A / N35G double point mutation, an I8A / E50Q double point mutation, an I8A / N35G / Y79W triple point mutation, and an I8A / N35G / E50Q / Y79W / R88P five point mutation, respectively, and their amino acid sequences are SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8, respectively.

[0074] With reference to the above amino acid sequences, the coding nucleotide sequences of the above monellin mutants were synthesized by BGI.

[0075] The mutant was amplified by PCR using primer 1(F) and primer 1(R). The mutant gene had the same length as the Mon1 gene, with a total length of 291 bp.

[0076] Example 3 Expression of recombinant monellin in Pichia pastoris

[0077] 3.1 Construction of expression vector

[0078] The gene sequences of Monellin Mon1 and its mutants were optimized according to the codon preference of Pichia pastoris and synthesized by BGI, and the 5' and 3' ends of the synthetic sequence were added. Eco RI and Not I Two restriction enzyme cutting sites.

[0079] According to the method described in Example 1, the gene sequences of the synthesized monellin Mon1 and its mutants were respectively Eco RI and Not I was then ligated with the pPIC-9K vector, digested with the same enzymes, overnight at 16°C and transformed into E. coli DH5a. The plasmid was spread onto LB+Amp plates and incubated upside down at 37°C. After transformants appeared, colony PCR was performed to verify the presence of positive clones. Sequencing confirmed the correct recombinant expression plasmid.

[0080] 3.2 Construction of Pichia pastoris engineered strains

[0081] 3.2.1 Preparation of competent yeast

[0082] The Pichia pastoris GS115 strain was activated on a YPD plate (1% yeast extract, 2% peptone, 2% glucose, and 2% agar powder). After culturing at 30°C for 48 h, the activated GS115 single colony was inoculated into 6 mL of YPD liquid medium (1% yeast extract, 2% peptone, and 2% glucose). The culture was incubated at 30°C and 220 rpm for about 12 h. The bacterial liquid was then transferred to a conical flask containing 30 mL of YPD liquid medium and incubated at 30°C and 220 rpm for about 5 h. The bacterial density was detected by a UV spectrophotometer. When the OD600 value was in the range of 1.1–1.3, 4 mL of the bacterial cells were collected into sterile EP tubes and the supernatant was gently discarded. The remaining supernatant was absorbed with sterile filter paper and the bacterial cells were resuspended in 1 mL of pre-cooled sterile water and centrifuged at 4°C and 9000 rpm for 2 min. min, gently discard the supernatant, repeat the wash with 1 mL of sterile water, centrifuge at 4°C and 9000 rpm for 2 min, gently discard the supernatant, and resuspend the bacteria in 1 mL of pre-cooled sorbitol (1 mol / L); centrifuge at 4°C and 9000 rpm for 2 min, gently discard the supernatant, and gently resuspend the bacteria in 100-150 μL of pre-cooled sorbitol (1 mol / L).

[0083] 3.2.2 Transformation and screening

[0084] The recombinant expression plasmids constructed in 3.1 were respectively Sac I was linearized, and the linearized fragments were purified and recovered and transformed into Pichia pastoris GS115 by electroporation. -5The recombinant Pichia pastoris strains were screened on YPD plates containing 1% biotin, 1% glycerol, and 2% agarose, and then multi-copy transformants were screened on YPD plates containing different concentrations of geneticin (0.5 mg / mL-8 mg / mL).

[0085] The obtained transformants were transferred to BMGY medium (2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol) and cultured at 30°C with shaking at 250 rpm for 1 day; then transferred to BMMY medium (2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 The cells were cultured in a 30°C, 250 rpm shaking in a humidified atmosphere (0.5% biotin, 0.5% methanol) solution. 0.5% methanol was added daily for 4 days to induce expression. The cells were then centrifuged at 9000 rpm for 10 minutes to remove the fermentation supernatants containing Mon1 and its mutants. The supernatants were then assayed for sweetness and protein content. The results are shown in Table 4.

[0086] Table 4 Sweetness and protein content test results of monellin mutants

[0087] Monellin and its mutants Relative sweetness of sucrose Protein content Wild-type Mon1 400 1.98g / l I8A 500 2.1g / l E50Q 900 2.04g / l I8A / N35G 600 1.87g / l I8A / E50Q 1200 2.32g / l I8A / N35G / Y79W 800 1.89g / l I8A / N35G / E50Q / Y79W / R88P 1000 2.26g / l

[0088] As can be seen from the results in Table 4, compared with the wild-type monellin Mon1, the mutants provided by the present invention containing the I8A single point mutation, E50Q single point mutation, I8A / N35G double point mutation, I8A / E50Q double point mutation, I8A / N35G / Y79W triple point mutation, and I8A / N35G / E50Q / Y79W / R88P five point mutations, respectively, have a sweetness increase of 25%-200%, and the protein content is basically the same, achieving unexpected technical effects.

[0089] In summary, the sweet protein monellin mutant provided by the present invention has high sweetness and can be used as a sweetener in the fields of food, feed additives, etc., with broad application prospects.

Claims

1. A monellin mutant, characterized in that The amino acid sequence of the mutant is any one of SEQ ID NOs: 3-8.

2. A recombinant expression plasmid, characterized in that: The recombinant expression plasmid carries the nucleic acid encoding the monellin mutant according to claim 1.

3. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 2.

4. The host cell according to claim 3, wherein The host cell is Pichia pastoris.

5. Use of the monellin mutant according to claim 1 in food or feed production.