CYP716C52 protein catalyzing hydroxylation of maytansine at C2 position and encoding gene and application thereof

Abstract

The present application relates to a kind of cytochrome P450 oxidase CYP716C52 protein, and the CYP716C52 protein coding gene, the protein can catalyze hydroxylation of maytenic acid C2 position to generate triptolide acid C, in turn participate in triptolide biosynthesis.

Description

TECHNICAL FIELD

[0001] The present application first clones the Tripterygium cytochrome P450 synthase CYP716C52 gene and its encoding product by polymerase chain reaction, relates to CYP716C52 protein involved in celastrol biosynthesis and its encoding gene and application, and belongs to the field of medicinal plant genetic engineering. BACKGROUND

[0002] Tripterygium wilfordii Hook.f. of Celastraceae Tripterygium plant is a traditional medicinal plant, which can be used for treating rheumatoid arthritis, systemic lupus erythematosus and cancer and other diseases. Tripterygium contains many triterpenoids, among which celastrol is a representative fican-type triterpenoid, which was first extracted and separated from Tripterygium in 1936 (Tu S H. The predicament and countermeasure of Tripterygium wilfordii in treating rheumatoid arthritis. Chinese Journal of Integrated Traditional and Western Medicine. 2009, 29: 104-105.). Celastrol is one of the effective components of Tripterygium wilfordii polyglycoside tablets and Tripterygium tablets for treating rheumatic diseases. In addition, celastrol also has very significant pharmacological activities in anti-tumor, anti-obesity and anti-central nervous system diseases, which has important significance for the development of new drugs for treating cancer, inflammation and central nervous system diseases (Lu, Y., Liu, Y., Zhou, J., et al. Biosynthesis, total synthesis, structural modifications, bioactivity, and mechanism of action of the quinone-methide triterpenoid celastrol [J]. Medicinal research reviews, 2021, 41(2): 1022-1060.). The traditional extraction and separation method of celastrol from the original plant has many limitations and will cause great damage to wild medicinal resources, so the method of analyzing its biosynthetic pathway and using synthetic biology strategy to modify microorganisms to produce celastrol will become a very potential production method.

[0003] The upstream biosynthetic pathway of celastrol is consistent with other triterpenes, which is generated by isopentenyl pyrophosphate (IPP) and isomer dimethylallyl pyrophosphate (DMAPP) from cytoplasmic mevalonate (MVA) pathway and plastid 2-C-methyl-D-erythritol-4-phosphate (MEP) pathway, and then 2,3-oxidosqualene is generated by a series of enzyme catalysis. 2,3-oxidosqualene produces a variety of triterpene skeletons under the action of oxidosqualene cyclase (OSC), among which friedelane is the skeleton structure of celastrol biosynthesis (Zhou J., Hu T., Gao L., et al. Friedelane-type triterpene cyclase in celastrol biosynthesis from Tripterygium wilfordii and its application for triterpenes biosynthesis in yeast. New Phytol. 2019, 223(2): 722-735.). Subsequent post-modification of triterpene skeleton by cytochrome P450 (CYP450) and glycosyltransferase, etc. produces triterpenes with different structures. It is speculated that the downstream biosynthetic pathway of celastrol is mainly involved by CYP450 (Hansen NL, Miettinen K, Zhao Y, et al. Integrating pathway elucidation with yeast engineering to produce polpunonic acid the precursor of the anti-obesity agent celastrol. Microbial cell factories 2020; 19(1): 15.).CYP712K4 is the first reported CYP450 involved in the downstream biosynthesis pathway of celastrol, studies have shown that it has the function of catalyzing the continuous three-step oxidation of friedelin C-29 to generate maytansine acid (Bicalho KU, Santoni MM, Arendt P, et al. CYP712K4 Catalyzes the C-29 Oxidation of Friedelin in the Maytenus ilicifolia Quinone Methide Triterpenoid Biosynthesis Pathway. Plant Cell Physiol 2019; 60(11): 2510-22.), and then researchers identified CYP712K1, CYP712K2 and CYP712K3 with the same catalytic function (Hansen NL, Miettinen K, Zhao Y, et al. Integrating pathway elucidation with yeast engineering to produce polpunonic acid the precursor of the anti-obesity agent celastrol. Microb Cell Fact. 2020, 28; 19(1): 15.), so it is very important to screen CYP450 that can further catalyze maytansine acid to generate subsequent celastrol intermediates.

[0004] The present application clones a CYP716C52 gene from Tripterygium wilfordii, and the functional characterization results show that it has the function of catalyzing the hydroxylation of maytansine acid C2 of celastrol intermediate maytansine acid to generate celastrol C, and gene interference experiments further prove that CYP716C52 gene is involved in the biosynthesis of celastrol, and more active mutants (Q141S, L144I and I221L) are obtained through molecular docking and site-directed mutagenesis experiments. The gene is first obtained from Tripterygium wilfordii, and before the present application is published, there has been no any public or reported celastrol CYP450 gene and its amino acid sequence mentioned in the present application. SUMMARY

[0005] The present application provides an isolated protein involved in the biosynthesis of celastrol, which can catalyze the hydroxylation of maytansine acid C2 of maytansine acid to generate celastrol C.

[0006] In the present application, the isolated protein is a cytochrome P450 oxidase, hereinafter referred to as CYP716C52, and the protein has:

[0007] (1) the amino acid sequence represented by SEQ ID NO: 2; or

[0008] (2) a peptide with one or more amino acids substituted, deleted or added to the amino acid sequence represented by SEQ ID NO: 2 and having the same function.

[0009] CYP716C52 variants or polypeptides having substantial sequence identity are characterized by having one or more amino acid substitutions, deletions or insertions. These alterations are preferably minor in nature, i.e., conservative amino acid substitutions (see Table 1) and other substitutions that do not significantly affect the folding or activity of the polypeptide; small deletions, typically of one to about 30 amino acids; amino or carboxyl terminal extensions, such as an amino terminal methionine residue, a small linker peptide of no more than about 20-25 residues, or an affinity tag. The present application thus provides polypeptides comprising a sequence that is at least 70%, preferably at least 90%, more preferably 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 2.

[0010] Amino acid residues that comprise regions or domains that are critical to maintaining structural integrity can be identified. Particular residues within these regions can be identified that are more or less tolerant to alteration while maintaining the overall tertiary structure of the molecule. Methods of analyzing sequence structure include, but are not limited to, alignment of multiple sequences with high amino acid or nucleotide identity, secondary structure propensities, binary patterns, complementary packing, and buried polar interactions (Barton, Current Opin. Struct. Biol. 5:372-376, 1995; and Cordes et al., Current Opin. Struct. Biol. 6:3-10, 1996). Generally, when designing molecular modifications or identifying particular fragments, the activity of the modified molecule will be assessed while the structure is being determined.

[0011] In one particular embodiment, the isolated protein variant is a mutation of one or more amino acids in the amino acid sequence represented by SEQ ID NO: 2 as follows:

[0012] (1) mutating the Gln (Q) at position 141 to Ser (S), Glu (E), Asn (N), or Pro (P); and / or

[0013] (2) mutating the Leu (L) at position 144 to Val (V), Ser (S), He (I), or Thr (T); and / or

[0014] (3) the 221th Ile (I) is mutated to Phe (F), Val (V), Leu (L) or Gly (G).

[0015] In a more specific embodiment, the present application provides a variant, which is a site-directed mutation of CYP716C52 to the amino acid sequence shown in SEQ ID NO: 2, specifically CYP716C52 Q141S , or CYP716C52 L144I , or CYP716C52 I221L , three variants, have better activity.

[0016] The present application further provides a polynucleotide sequence encoding the cytochrome P450 oxidase CYP716C52.

[0017] The polynucleotide sequence is a gene related to the hydroxylation of maytansine C2 (hereinafter referred to as CYP716C52), which is one of the following nucleotide sequences:

[0018] 1) the nucleotide sequence of SEQ ID No. 1 in the sequence listing; or

[0019] 2) a DNA sequence having one or more base mutations with the nucleotide sequence defined in SEQ ID No. 1 in the sequence listing, and encoding the same functional protein; or

[0020] The present application further provides an expression vector comprising a polynucleotide encoding the CYP716C52 protein or its mutant of the present application, the expression vector further comprising a promoter and a terminator, wherein the promoter is operably linked to the polynucleotide, and the polynucleotide is operably linked to the transcription terminator.

[0021] In the present application, various vectors known in the art can be used, such as commercially available vectors, including plasmids, cosmids, etc. In the production of the triterpene synthase polypeptide of the present application, the nucleotide sequence of the triterpene synthase gene can be operably linked to an expression control sequence, thereby forming a triterpene synthase expression vector. The "operably linked" when referring to DNA segments means that the segments are arranged so that they function in concert, e.g., to produce a transcriptional or translational product. It is further contemplated that certain portions of a linear DNA sequence are able to influence the activity of other portions of the same linear DNA sequence, e.g., if a signal peptide DNA is expressed as a prerequisite and involved in the secretion of a polypeptide, then the signal peptide (secretion leader sequence) DNA is operably linked to the polypeptide DNA; if a promoter control sequence transcribes, then it is operably linked to the coding sequence; if a ribosome binding site is placed in a position so that it is translated, then it is operably linked to the coding sequence. Generally, "operably linked" means contiguous, and for secretion leaders, in reading frame.

[0022] It is another object of the present application to provide a host cell comprising the polynucleotide molecule encoding the CYP716C52 protein or variant thereof of the present application, or comprising the expression vector as described above. The host cell is selected from the group consisting of bacteria, prokaryotic cells (e.g. E. coli), fungal cells, yeast cells, insect cells, mammalian cells or plant cells, preferably, yeast cells or plant cells.

[0023] Particularly interesting yeasts include Saccharomyces cerevisiae, Pichia pastoris and Pichia methanolica. Methods for transforming S. cerevisiae cells with foreign DNA and preparing recombinant polypeptides therefrom are disclosed, for example, in Kawassaki, U.S. Patents 4,599,311, 4,931,373, 4,870,008, 5,037,743, 4,845,075, and the like. Transformant cells are selected by a phenotype determined by a selectable marker, usually drug resistance or ability to grow in the absence of a particular nutrient (e.g., leucine). A preferred vector system for S. cerevisiae can be, for example, the pYES2 expression vector. Suitable promoters and terminators for use in yeast include those from glycolytic genes (U.S. Patents 4,599,311, 4,615,974, and 4,977,092) and alcohol dehydrogenase. Transformation systems for other yeasts, including H. polymorpha, K. lactis, K. fragilis, P. pastoris, Pichia Methanolica, Pichia guillermondii, and Candida methylica are also known in the art.

[0024] The transformed or transfected host cells are cultured in a culture medium comprising nutrients and other components necessary for the growth of the selected host cells according to conventional methods. A variety of suitable media are known in the art, including known ingredients of media and complex media, and typically include carbon sources, nitrogen sources, essential amino acids, vitamins, and minerals. If desired, the culture medium can also contain components such as growth factors or serum. The growth medium is typically selected to contain the necessary nutrients to select for cells containing the exogenously added DNA, for example, by drug selection or by the lack of an essential nutrient that is complemented by a selectable marker carried by the expression vector or co-transfected into the host cell. Liquid cultures are provided with sufficient air by conventional means, such as shaking of Erlenmeyer flasks or sparging of fermentors.

[0025] The full-length sequence of the CYP716C52 polynucleotide of the present application, or fragments thereof, can be obtained by PCR amplification, recombinant methods, or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly the open reading frame sequences, and a commercially available cDNA library or a cDNA library prepared according to conventional methods known to those skilled in the art is used as a template for amplification. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then the fragments amplified in each amplification are spliced together in the correct order. Once the relevant sequence is obtained, the relevant sequence can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into cells, and then isolating the relevant sequence from the proliferated host cells by conventional methods. In addition, mutants can be introduced into the protein sequence of the present application by chemical synthesis. In addition to being produced by recombinant methods, fragments of the protein of the present application can be produced by direct synthesis of the peptide using solid-phase techniques (Stewart et al., Solid-Phase Peptide Synthesis, J. Am. Chem. Soc. 85:2149-2154, 1963). Protein synthesis in vitro can be done manually or automatically. For example, the peptide can be automatically synthesized using a Model 431A Peptide Synthesizer (Applied Biosystems, Foster City, CA). Each fragment of the protein of the present application can be chemically synthesized separately, and then chemically linked to produce a full-length molecule.

[0026] In the present application, the terms "CYP716C52 protein-encoding gene" and "CYP716C52 gene" are used interchangeably; the terms "CYP716C52", "cytochrome P450 oxidase CYP716C52", and "CYP716C52 protein" are used interchangeably. The terms "nucleotide molecule" and "nucleotide sequence" are used interchangeably.

[0027] The term "isolated" or "purified" polypeptide or protein refers to a polypeptide or protein that exists in a condition other than in vivo, for example, outside of blood or tissue. In preferred forms, the isolated polypeptide or protein is substantially free of other polypeptides or proteins, particularly other polypeptides or proteins of animal or plant origin. Preferably, the polypeptide is provided in a highly purified form, i.e., greater than 95% pure, more preferably greater than 99% pure; "isolated" or "purified" DNA refers to a DNA or fragment that has been removed from the sequences flanking it in the natural state, or that has been separated from the components with which the nucleic acid is naturally associated, and that has been separated from the proteins with which it is associated in the cell.

[0028] The CYP716C52 protein and CYP716C52 gene provided by the present application are first cloned and prepared from Tripterygium wilfordii, which catalyzes the hydroxylation of maytansine C2 to generate triptolide C. The results of CYP716C52 interference mediated by gene gun show that after the cloned gene CYP716C52 of the present application is transformed into Tripterygium wilfordii suspension cells by gene gun, the gene expression amount is obviously reduced, accompanied by the reduction of celadonic acid content in the cells, further proving that CYP716C52 is involved in the biosynthesis of celadonic acid. The CYP716C52 gene can be used for the research and industrialization of improving the content of celadonic acid by using transgenic technology, especially for the quality improvement of traditional Chinese medicine Tripterygium wilfordii, which can better promote the alleviation of the problem of shortage of Tripterygium wilfordii resources and can be used for Tripterygium wilfordii breeding.

[0029] In an embodiment of the present application, the application of the CYP716C52 protein or CYP716C52 gene described in the present application in catalyzing the hydroxylation of maytansine C2 to participate in the biosynthesis of celadonic acid is provided.

[0030] In an embodiment of the present application, a method for catalyzing the hydroxylation of maytansine C2 to generate triptolide C by using the CYP716C52 protein or CYP716C52 gene described in the present application is provided. The method comprises the following steps: (1) culturing Tripterygium wilfordii suspension cells; (2) extracting RNA from Tripterygium wilfordii suspension cells; (3) sequencing the transcriptome of Tripterygium wilfordii suspension cells; (4) obtaining the full-length cDNA of CYP716C52 gene; (5) constructing plasmids and strains; (6) culturing engineering bacteria; (7) extracting and separating the expression product of engineering bacteria.

[0031] The DNA sequence of SEQ ID No. 1 of the present application consists of 1455 bases, and the protein sequence of SEQ ID No. 2 in the coding sequence consists of 484 amino acid residues. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 . Deduced schematic diagram of celadonic acid biosynthesis pathway.

[0033] Figure 2 CYP716C52 catalyzed product UPLC / Q-TOF-MS detection result figure, wherein: (a) CYP716C52 function characterization chromatogram (extract 476.36 m / z); (b) product (peak 1) mass spectrum cracking rule.

[0034] Figure 3 COSY spectrum of triptolide C (solvent CD3OD). 1 HNMR spectrum (800MHz, solvent CD3OD).

[0035] Figure 4 C NMR spectrum of triptolide C (200MHz, solvent CD3OD). 13 C NMR spectrum of triptolide C (200MHz, solvent CD3OD).

[0036] Figure 5 COSY spectrum of triptolide C (solvent CD3OD).

[0037] Figure 6 HSQC spectrum of triptolide C (solvent CD3OD).

[0038] Figure 7 HMBC spectrum of triptolide C (solvent CD3OD).

[0039] Figure 8 NOESY spectrum of triptolide C (solvent CD3OD).

[0040] Figure 9 HNMR spectrum of triptolide C (800MHz, solvent C5D5N). 1 HNMR spectrum of triptolide C (800MHz, solvent C5D5N).

[0041] Figure 10 C NMR spectrum of triptolide C (200MHz, solvent C5D5N). 13 C NMR spectrum of triptolide C (200MHz, solvent C5D5N).

[0042] Figure 11 CYP716C52 gene RNAi result (n=3), wherein: (a) CYP716C52 gene RNAi vector schematic diagram; (b) RNAi vector into tripterygium suspension cell verification result; (c) RT-PCR detects the relative expression amount of CYP716C52 gene in tripterygium suspension cells of control group (CK) and RNAi experimental group; (d) the content of tripterine in tripterygium suspension cells of CK group and RNAi group (* represents P<0.05).

[0043] Figure 12 Relative yield comparison of wild type CYP716C52 (WT) and its mutant producing triptolide C (n=3, ** represents P<0.01). DETAILED DESCRIPTION

[0044] The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0045] The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0046] In the quantitative test in the following examples, three repeated experiments were set, and the average value was taken.

[0047] The Tripterygium wilfordii Hook.f. suspension cells in the following examples are disclosed in the literature “Zhao Y., Zhang Y., Su P., et al. Tripterygium wilfordii Genetic Transformation System for Woody Plant and Its Application to Product Natural Celastrol [J]. Front Plant Sci, 2017, 8: 2221.” and can be obtained from the public at the Laboratory of Molecular Pharmacognosy and Chinese Medicine Resources, Capital Medical University.

[0048] The pEASY-Blunt Simple Cloning Kit, -Basic Seamless Cloning and Assembly Kit, Top Green qPCR SuperMix and Fast Mutagenesis System kits are purchased from Beijing Zixingjin Biotechnology Co., Ltd.; Phusion High-Fidelity PCR MasterMix and restriction endonucleases NotI, SacI, SpeI, PacI, KpnI and EcoRI are purchased from New England Biolabs Co., Ltd. Super total RNA extraction kit is purchased from Promega Co., Ltd. RACE 5’ / 3’ Kit is purchased from Takara Co., Ltd.; Frozen-EZ Yeast Transformation II Kit TMThe Rapid Plasmid Mini-Prep Kit and FastQuant RT Kit were purchased from Zymo Research, Inc. (USA) and Tiangen Biotech Co., Ltd. (USA). The Plasmid Maxi Kit was purchased from OMEGABio-tek, Inc. (USA); and the Gene JET Gel Extraction Kit was purchased from Thermo Scientific, Inc. (USA). LR Clonase Enzyme Mix was purchased from Invitrogen, USA.

[0049] Example 1: Cloning of full-length cDNA of Tripterygium wilfordii CYP716C52

[0050] 1. Total RNA extraction from Tripterygium wilfordii suspension cells

[0051] use The Super Total RNA Extraction Kit extracts total RNA from Tripterygium wilfordii suspension cells.

[0052] 2. Obtaining the first strand of cDNA

[0053] use The RACE 5' / 3' Kit is used for the reverse inversion of first-strand cDNA.

[0054] 3. Primer design

[0055] Based on the Tripterygium wilfordii transcriptome data, gene sequences were screened, and primers CYP716C52-F and CYP716C52-R were designed as follows:

[0056] CYP716C52-F: ATGGCATTTTATCAAACACTTTCCG (SEQ ID NO: 3)

[0057] CYP716C52-R: TTAATTGGCTGAGTGAAGGCGG (SEQ ID NO: 4)

[0058] 4. PCR amplification and cloning vector ligation

[0059] The first strand cDNA obtained in step 2 was used as a template, CYP716C52-F and CYP716C52-R were used as primers, and Phusion High-Fidelity Master Mix was used for PCR amplification. The PCR reaction program was as follows: 98 ℃ for 30 s; 98 ℃ for 10 s, 56 ℃ for 15 s, 72 ℃ for 1 min, 35 cycles; 72 ℃ for 7 min; 4 ℃ hold. The PCR amplification product was subjected to 1.5% agarose gel electrophoresis, the correct size band was cut and recovered with Gene JET Gel Extraction Kit kit, then the recovered product was ligated to the cloning vector according to the operation method of pEASY-Blunt Simple Cloning Kit, and transformed into Trans1-T1 competent cells, plated, and the positive clones were sequenced and verified.

[0060] The sequencing results showed that the sequence of the PCR amplification product was as shown in sequence 1. The gene shown in sequence 1 was named CYP716C52, the ORF was 1455 bp, and the protein composed of 484 amino acid residues was encoded, the protein was named CYP716C52, and the amino acid sequence of the protein was sequence 2. The cloning vector was named pEASY-Blunt Zero::CYP716C52, and was stored in a refrigerator at-20 ℃.

[0061] Example 2, Function Research of Tripterygium CYP716C52 Gene

[0062] 1. Construction of eukaryotic expression vector

[0063] (1) Construction of pESC-Leu::(TwOSC1+TwCPR3) vector

[0064] The lignan synthase gene TwOSC1 from Tripterygium wilfordii Hook.f. was constructed into the pESC-Leu::TwCPR3 eukaryotic expression vector at the Multiple Cloning Site 1 (MCS1) by using the seamless splicing method (Zhou J., Hu T., Liu Y., et al. Cytochrome P450 catalyses the 29-carboxyl group formation of celastrol [J]. Phytochemistry, 190.).

[0065] The seamless splicing primers with homologous arms, TwOSC1-Leu-F and TwOSC1-Leu-R, were designed with pEASY-BluntZero::TwOSC1 as the plasmid template (Zhou J., Hu T., Gao L., et al. Friedelane-type triterpene cyclase in celastrol biosynthesis from Tripterygium wilfordii and its application for triterpenes biosynthesis in yeast. New Phytol. 2019, 223(2):722-735.), and PCR amplification was performed using high-fidelity enzyme Phusion High-Fidelity Master Mix, with the PCR program being: 98°C for 30 s; 98°C for 10 s, 56°C for 15 s, 72°C for 2 min, 35 cycles; 72°C for 7 min; 4°C hold. The PCR amplification product was subjected to 1.5% agarose gel electrophoresis, and the band with correct size was cut and recovered using the Gene JET Gel Extraction Kit, to obtain the target fragment with homologous arms.

[0066] TwOSC1-Leu-F: CCTCACTAAAGGGCGGCCGCATGTGGAAGCTCAAAGTTGC (SEQ ID NO: 5)

[0067] TwOSC1-Leu-R: GAATTGTTAATTAAGAGCTCTCAATAGCCTTTGGATGGTA (SEQ ID NO: 6)

[0068] The vector pESC-Leu::TwCPR3 was double-digested with restriction endonucleases NotI and SacI, and the digestion product was subjected to 1.5% agarose gel electrophoresis, and the band with correct size was cut and recovered using the Gene JET Gel Extraction Kit, to obtain the linearized plasmid.

[0069] According to the operation method of the The target fragment was ligated to the linearized vector according to the operation method of the -Basic Seamless Cloning and Assembly Kit, and transformed into Trans1-T1 competent cells, plated, and the positive clones were subjected to sequencing verification.

[0070] Sequencing identification showed that the recombinant plasmid pESC-Leu::(TwOSC1+TwCPR3) had no mutation in the sequenced nucleotide sequence.

[0071] (2) Construction of pESC-His::CYP712K1 vector

[0072] The maytansine synthase gene CYP712K1 was constructed into the MCS1 of the pESC-His eukaryotic expression vector using the seamless splicing method as above. The seamless splicing primers CYP712K1-His-F and CYP712K1-His-R with homologous arms were designed, and pYES2::CYP712K1 was used as the plasmid template (Zhou J., Hu T., Liu Y., et al. Cytochrome P450 catalyses the 29-carboxyl group formation of celastrol [J]. Phytochemistry, 190.). PCR amplification was performed using Phusion High-Fidelity Master Mix, and the PCR amplification product was subjected to 1.5% agarose gel electrophoresis. The correct size band was excised and recovered using the Gene JET Gel Extraction Kit, and the target fragment with homologous arms was obtained.

[0073] CYP712K1-His-F: AGGGCGGCCGCACTAGTATGGCCACCATCACTGACAT SEQ ID NO: 7)

[0074] CYP712K1-His-R: GAAGAATTGTTAATTAATTAACCGGCAAATGGATTGA SEQ ID NO: 8)

[0075] The vector pESC-His was double-digested with restriction endonucleases SpeI and PacI, and the digested product was subjected to 1.5% agarose gel electrophoresis. The correct size band was excised and recovered using the Gene JET Gel Extraction Kit, and the linearized plasmid was obtained.

[0076] According to the operation method of the The target fragment was ligated to the linearized vector according to the operation method of the -Basic Seamless Cloning and Assembly Kit, and transformed into Trans1-T1 competent cells. The plates were coated, and the positive clones were subjected to sequencing verification.

[0077] Sequencing identification showed that the recombinant plasmid pESC-His::CYP712K1 had no mutations in the sequenced nucleotide sequence.

[0078] (3) pYES2::CYP716C52 vector construction

[0079] CYP716C52 was constructed into pYES2 eukaryotic expression vector using the method of seamless cloning as above, the seamless cloning primers with homologous arms, CYP716C52-pYES2-F and CYP716C52-pYES2-R, were designed, pEASY-Blunt Zero::CYP716C52 was used as the template, and PCR amplification was performed using Phusion High-Fidelity Master Mix, with the following PCR program: 98°C for 30 s; 98°C for 10 s, 56°C for 15 s, 72°C for 1 min, 35 cycles; 72°C for 7 min; 4°C hold. The PCR amplification product was subjected to 1.5% agarose gel electrophoresis, the correct size band was cut and recovered using the Gene JET Gel Extraction Kit, and the target fragment with homologous arms was obtained.

[0080] CYP716C52-pYES2-F: TATTAAGCTTGGTACATGGCATTTTATCAAACACT (SEQ ID NO: 9)

[0081] CYP716C52-pYES2-R: GATGGATATCTGCAGTTAATTGGCTGAGTGAAGGC (SEQ ID NO: 10)

[0082] The vector pYES2 was double-digested with restriction endonucleases Kpnl and EcoRI, the digestion product was subjected to 1.5% agarose gel electrophoresis, the correct size band was cut and recovered using the Gene JET Gel Extraction Kit, and the linearized plasmid was obtained.

[0083] According to the method of the The target fragment was ligated to the linearized vector according to the method of the -Basic Seamless Cloning and Assembly Kit, and transformed into Trans1-T1 competent cells, plated, and the positive clones were sequenced and verified.

[0084] Sequencing identified that the recombinant plasmid pYES2::CYP716C52 had no mutations in the sequenced nucleotide sequence.

[0085] 2. Transformation of eukaryotic expression vector into lanosterol-deficient yeast strain

[0086] (1) According to the method of the Frozen-EZ Yeast Transformation II Kit TMThe kit operation steps are used to make the yeast (ATCC, cell line number: 4021900, -erg7, -ura) competent cells with lanosterol deficiency.

[0087] (2) The plasmids pESC-Leu::(TwOSC1+TwCPR3) and pESC-His::CYP712K1 are co-transformed into the yeast competent cells of step (1), and plated on Sc-Leu-His solid medium (containing 2% glucose) and incubated at 30°C for 2-3 days. Single colonies are picked and then the Frozen-EZ Yeast Transformation II Kit (Life Technologies) is used to transform the yeast competent cells with the two plasmids, and the cells are cultured under the same conditions as above. TM The kit operation steps are used to make the yeast (ATCC, cell line number: 4021900, -erg7, -ura) competent cells with lanosterol deficiency.

[0088] (3) The third plasmid pYES2::CYP716C52 is transformed into the yeast competent cells of step (2), and plated on Sc-Leu-His-Ura solid medium (containing 2% glucose) and incubated at 30°C for 2-3 days. In addition, the empty vector pYES2 is also transformed into the yeast competent cells of step (2) as a control group, and cultured under the same conditions.

[0089] 3. Strain fermentation and product detection

[0090] (1) Single colonies are picked from each plate into 3 mL Sc-Leu-His-Ura liquid medium (containing 2% glucose) and activated for about 24 h to turbidity. 1 mL of activated bacterial solution is expanded to 30 mL, and then shaken and cultured to OD 600 0.8-1.0, 4000xg centrifugation for 2 min, and the culture medium is discarded in a biological safety cabinet. An equal volume of YPL liquid medium is used for induction for 3 days (30°C, 200 rpm).

[0091] (2) centrifugal collection of bacterial cells (4000 x g, 2 min), resuspended with 20 mL distilled water, twice extracted with equal volume of ethyl acetate by ultrasonic, combined organic layer, removed solvent by rotary evaporator, twice dissolved with 1 mL ethyl acetate, dried by nitrogen, finally dissolved with 300 μL mass spectrometry methanol, high speed centrifugation to take supernatant sample into ultra performance liquid chromatography / ion mobility / tetrad-pole time-of-flight mass spectrometry (UPLC / Q-TOF-MS): using ACQUITY UPLC HSS T3 column (2.1 mm 100 mm, 1.8 μm, USA), mass spectrometry detection by Xevo G2-S QTOF MS (Waters Corp., Milford, MA, USA) system in positive ion mode, capillary voltage 1.0 kV, cone hole voltage 40 V, ion source temperature 120℃, solvent evaporation temperature 450℃, cone gas flow 50 L / h, desolvation gas flow rate 800 L / h, scan range set to 50-1500 m / z, scan time 0.2 s; liquid phase conditions: A is 0.1% formic acid-water, B is acetonitrile, liquid phase gradient see Table 1. After sample injection, data is processed by MassLynx software.

[0092] Table 1 UPLC / Q-TOF-MS liquid phase detection conditions

[0093]

[0094] Results are shown in Figure 2 Compared with the control group, CYP716C52 can catalyze the substrate maytansine to generate [M+H] + 473.36 (peak 1), the molecular weight is increased by 16 m / z compared with maytansine, so it is speculated that CYP716C52 can catalyze the substrate to be hydroxylated.

[0095] 4. Preparation of CYP716C52 product and nuclear magnetic identification

[0096] The chemical structure of the product is determined by enrichment, preparation and nuclear magnetic identification.

[0097] (1) Large-scale enrichment of product

[0098] The lanosterol-deficient yeast strain transformed with the three plasmids pESC-Leu::(TwOSC1+TwCPR3), pESC-His::CYP712K1 and pYES2::CYP716C52 is named LY1, and the strain is subjected to high-density fermentation in a 10-L bioreactor. The specific steps are as follows: a single colony is inoculated into 40 mL Sc-Leu-His-Ura liquid medium (containing 2% glucose) and activated for about 24 h, then expanded to 400 mL, and cultured for about 16 h.600 The secondary activated bacteria solution was inoculated into a bioreactor containing 3 L of Sc-Leu-His-Ura liquid medium (containing 2% glucose) at an initial OD 600 of 0.5, with a temperature setting of 30°C, dissolved oxygen (DO) setting of 30%, and pH setting of 5.5. In addition, the pH was associated with an alkali pump, and the dissolved oxygen (DO) was associated with the stirring speed and the aeration rate. The 6x Sc-Leu-His-Ura medium was fed at a constant flow rate of 0.1 mL min -1 for 48 h; starting from 48 h, the 40% galactose was induced at a constant flow rate of 0.1 mL min -1 for 96 h.

[0099] After the fermentation was completed, the bacteria and the medium were collected, and the ethyl acetate was used for multiple ultrasonic extractions. The fermentation extraction was repeated 6 times, and the product was enriched.

[0100] (2) Product preparation and separation and purification

[0101] The product enriched in (1) was dissolved in about 30 mL of mass spectrometry methanol, and the sample was coarsely separated by mass spectrometry guided preparative liquid chromatography (Agilent 1260 diode array detector, single quadrupole mass spectrometer detector). The chromatographic column was a SunFirePrep C18 OBD chromatographic column (19x150 mm, 5.0 μm, Waters), and the liquid phase conditions were A phase (pure water) and B (acetonitrile) according to the preparative liquid gradient in Table 2, with a sample injection of 200 uL each time, and the ultraviolet detection range was 190-400 nm, and the DAD signal was set to 201 nm. The mobile phase of the unit pump was 0.1% formic acid-water, with a flow rate of 1 mL min -1 , and the liquid phase: mass spectrometry split ratio was 100:1, and the mass spectrometry conditions: TIC scanning in positive ion mode, mass range was 100-500 m / z, and the SIM mode was set to detect the parent ion [MS + ] = 473 and the daughter ion [MS + ] = 455, and the fraction of 27.5-29.5 min was collected, combined, and rotary evaporated to remove the solvent, and then redissolved in 30 mL of mass spectrometry methanol to obtain the crude product.

[0102] Table 2 Liquid phase conditions for mass spectrometry guided preparative liquid chromatography detection

[0103]

[0104] The sample obtained from the above preliminary separation was injected into a mass spectrometry-guided preparative high-pressure liquid chromatograph (Waters, Model Mass 3100) with mobile phase A (0.05% ammonia water) and B (acetonitrile) and a C18 chromatographic column (30 x 100 mm, 5.0 μm, Gemini). The sample was injected at a flow rate of 1 mL, and the liquid chromatography gradient is shown in Table 3. The mass spectrometry conditions were as follows: negative ion mode, SIM mode, and detection of [MS] - = 471. According to the elution time, the fraction collected from 10.2 to 11.5 min was combined, and the solvent was removed by rotary evaporation. The product was obtained in a pure form of about 5 mg after removal of water by freeze drying. The product was detected by ELSD and mass spectrometry detectors, and the purity was 98%.

[0105] Table 3 Liquid chromatography conditions for mass spectrometry-guided preparative high-pressure liquid chromatography

[0106]

[0107]

[0108] (3) Product structure identified by nuclear magnetic resonance

[0109] About 2.0 mg of the purified product was weighed, dissolved in 200 μL of deuterated methanol, centrifuged at 15000 x g for 5 min, and the supernatant was transferred to a nuclear magnetic tube. The product was detected and analyzed by an 800-MHz nuclear magnetic resonance spectrometer system (Bruker, AVANCE III). 1 H-NMR and 13 C-NMR, and two-dimensional spectra: COSY spectrum, HSQC spectrum, HMBC spectrum, and NOESY spectrum. The nuclear magnetic resonance data of the product were analyzed by MestReNova software. 1 H-NMR, 13 C-NMR, and two-dimensional spectra are shown in Figures 3-8 The product was identified as wilforic acid C, and the structure is shown in Figure 3 , which is a hydroxylated product of maytansine at the C2 position. The nuclear magnetic resonance assignment information is shown in Table 4.

[0110] Table 4 Nuclear magnetic resonance signal assignment of the product (CD3OD)

[0111]

[0112] It was found in the literature that triptolide C is a triterpene isolated from the root bark of Tripterygium wilfordii (Kunhua L, Hongquan D, Kazuyoshi K, Takaishi Y. Terpenoids from Tripterygium wilfordii. Phytochemistry. 1997, 45: 791-796.). In order to compare with the nuclear magnetic data reported in the literature (solvent is deuterated pyridine), the solvent was changed to deuterated pyridine. The sample was injected into the 800 megahertz nuclear magnetic resonance spectrometer system for detection 1 H-NMR spectrum and 13 C-NMR spectrum, and the nuclear magnetic data was analyzed by MestReNova software. The results showed that the 1 H NMR spectrum Figure 9 ) and 13 CNMR spectrum data Figure 10 ) were consistent with the data reported in the literature, further confirming the results.

[0113] Example 3, Tripterygium CYP716C52 gene interference study

[0114] 1. Tripterygium suspension cell culture

[0115] Prepare MS solid medium: (MS 4.43g L -1 , 2,4-D 1.0mg L -1 , KT 0.1mg L -1 , sucrose: 30g L -1 , adjust pH to 5.8-6.0, then add agar 8g L -1 ), after high pressure sterilization, cool to about 60℃, take 3mL liquid medium into a small culture dish, after solidification, take 0.2g of Tripterygium suspension cells which have been subcultured for about 20 days and have good growth state in the laboratory, transfer to the MS solid medium, and cultivate in a constant temperature and humidity incubator at 25℃ in the dark for 7 days.

[0116] 2. Interference vector construction

[0117] Design and amplification of interference fragments: according to the sequence of CYP716C52 gene, local Blast comparison of Tripterygium genome, find out the specific fragment (300-500bp) of CYP716C52, design primers: RNAi-CYP716C52-F: CACCGCAAAAGCTTGTCAAAGTCTGG; RNAi-CYP716C52-R: CACTAATCGCAACAGCCGCC, the CYP716C52 specific fragment (429bp) was amplified with pEASY-Blunt Zero::CYP716C52 plasmid as template by high-fidelity enzyme. The PCR program was as follows: 98℃ 30s; 98℃ 10s, 56℃ 15s, 72℃ 1min, 35 cycles; 72℃ 7min; 4℃ hold. After the PCR amplification, 1.5% agarose gel electrophoresis was performed, and the correct size band was recovered by Gene JET Gel Extraction Kit.

[0118] BP reaction for connecting to the entry vector: the above purified interference fragment was connected to pENTR TM SD / D- vector, and the BP reaction system was prepared as follows: interference fragment 2μL, pENTR TM SD / D- vector 0.5μL, Salt solution 0.5μL. Incubate in PCR instrument at 22℃ for 2h. Transform all the PCR products into Trans1-T1 competent cells, and plate on LB+Kana solid plate. Incubate at 37℃, and send the positive clones for sequencing. After successful sequencing, extract the entry vector plasmid by using the rapid plasmid extraction kit.

[0119] LR reaction for connecting to the expression vector: use LR reaction to connect the interference expression vector pK7GWIWG2D, and the system is as follows: entry vector plasmid 300ng, pK7GWIWG2D 100-300ng, LR Clonase Enzyme Mix 1μL, TE Buffer 1μL. Incubate in PCR instrument at 25℃ for 4h. Transform all the PCR products into 50μL Trans1-T1 competent cells, and plate on LB+Spe solid plate. Incubate at 37℃, and send the positive clones for sequencing. After successful sequencing, extract the plasmid according to the Plasmid maxi Kit plasmid extraction reagent box instruction, and the plasmid concentration needs to be more than 1000ng / uL.

[0120] 3. Transformation of Tripterygium suspending cells by gene gun

[0121] The empty plasmid pK7GWIWG2D (PK7) and RNAi-CYP716C52 plasmid were transformed into the Tripterygium suspension cells by gene gun transformation system. The mixed system of each plasmid was prepared: 5mg of gold powder, 100μL of 2.5M CaCl2, 40μL of 0.1M spermidine, and 20μg of plasmid. The plasmid-embedded gold powder was bombarded into the suspension cells by gene gun under the condition of high-purity helium (more than 1000psi).

[0122] 4. Verification of successful plasmid transformation into Tripterygium suspension cells

[0123] The gene gun-mediated transformed suspension cells were placed in a constant temperature and humidity incubator at 25℃ for 7 days of dark culture, then sampled, the surface water was absorbed with filter paper, and then placed in a 2mL EP tube, frozen with liquid nitrogen, and stored at -80℃. A portion of the cells was used to extract total RNA using the Super Total RNA Extraction Kit (Promega), and then the first strand cDNA was synthesized by reverse transcription of RNA using the FastQuant RT Kit. The cDNA was used as a template to amplify the band using specific primers EGFP-F: TTACAGCTCGTCCTTCTTGTAC and EGFP-R: TTACAGCTCGTCCTTCTTGTAC, and the band size was detected by 1% agarose gel electrophoresis to determine whether the plasmid was successfully transformed into the cells.

[0124] 5. RT-PCR detection of gene expression

[0125] The first strand cDNA obtained above was diluted with sterile water to a concentration of 100ng / μL -1 for standby. The 96-well plate was spotted, and 20μL of the following system was added to each well: 2× Top Green qPCR SuperMix 10uL, 0.4uL of primers F / R each, 1uL of cDNA, 0.4uL of Rox Dye II, 7.8uL of PCR-grade water, three technical replicates, EFla as the internal reference gene, and detection was performed using the ABI QuantStudio5 real-time fluorescent quantitative PCR instrument. The RT-PCR degree was: 94℃ for 30s, 94℃ for 5s, 56℃ for 15s, 72℃ for 10s, 45 cycles; Dissociation Stage. The relative expression amount of the gene was analyzed by 2 -△△Ct method.

[0126] 6. Determination of chemical content of Tripterygium suspension cells

[0127] The remaining cells were ground into powder using a ball mill. After freeze-drying for 3 days, 20 mg of the sample was accurately weighed and soaked overnight in 800 μL of 80% (v / v) methanol. The sample was then extracted by sonication for 2 h, centrifuged at 12000 × g for 3 min, and the supernatant was filtered through a 0.22 μm microporous membrane. The filtrate was collected and analyzed using an Agilent 6490 triple quadrupole LC-MS system. A WatersAcquity UPLC HSS T3 column (2.1 × 100 mm, 1.8 μm) was used. The LC conditions are shown in Table 5: A is 0.1% formic acid-water, B is acetonitrile, and the flow rate is 0.3 mL / min. -1 The column temperature was 40℃, the injection volume was 5μL, and the content of triptolide was detected using MRM mode with a collision energy of 20eV. The quantitative ion pair was 451→215, and the qualitative ion pair was 451→201.

[0128] Table 5. Mobile phase gradient for the detection of triptolide using triple quadrupole liquid chromatography-mass spectrometry (LC-MS)

[0129]

[0130] The results are as follows Figure 11 As shown, the CYP716C52 gene interference vector constructed using Gateway technology was transformed into Tripterygium wilfordii suspension cells using a gene gun transformation system. PCR amplification yielded a 799 bp Egfp fragment, confirming successful transformation into the cells. RT-PCR analysis of the relative expression level of the CYP716C52 gene revealed a significant downregulation in the interference group (RNAi group) compared to the control group (CK group), with the expression level being 0.38 times lower (P<0.05). Furthermore, the triptolide content in the RNAi group was significantly lower than that in the CK group, being 0.45 times lower (P<0.05). These results demonstrate that CYP716C52 is involved in the biosynthesis of triptolide.

[0131] Example 4: Site-directed mutagenesis study of Tripterygium wilfordii CYP716C52 protein

[0132] 1. Construction of mutant plasmids

[0133] (1) Mutation primers were designed according to the Fast Mutagenesis System kit instructions. Site-directed mutagenesis was performed using pYES2::CYP716C52 plasmid as a template. The PCR reaction system was: 2× FastPfu PCR SuperMix 10.0 μL, primer F / R 0.5 μL, pYES2::CYP716C52 plasmid 1.0 μL, ddH2O 8.0 μL; PCR program: 94℃ 5 min; 94℃ 20 s, 55℃ 20 s, 72℃ 3.5 min, 25 cycles; 72℃ 10 min; 4℃ hold. After the reaction, 1 uL DMT enzyme was added to digest the product, and the reaction was performed at 37℃ for 1 h. 5 μL of the digested product was taken into 50 μL DMT competent cells, spread on LB+AMP solid plates, and positive clones were sent for sequencing after successful extraction of the plasmid.

[0134]

[0135] (2) Partial mutant plasmids were not successfully constructed using the above kit method, so the seamless assembly method was used for construction. The seamless assembly primer with a mutation site was designed, and mutant Q141S was taken as an example for illustration: PCR system 1 and system 2 were prepared, and high-fidelity enzyme was used for amplification. The PCR program was: 98℃ 30 s; 98℃ 10 s, 56℃ 15 s, 72℃ 1 min, 35 cycles; 72℃ 7 min; 4℃ hold. After amplification, the target fragments of system 1 and system 2 were recovered by gel cutting.

[0136]

[0137] PCR system 1:

[0138]

[0139] PCR system 2:

[0140]

[0141] The vector pYES2 was double-digested with restriction endonucleases KpnI and EcoRI, and the digested product was subjected to 1.5% agarose gel electrophoresis. The correct size band was cut and recovered by gel cutting to obtain a linearized plasmid. According to the operation method of -Basic Seamless Cloning and Assembly Kit instruction manual, PCR fragments 1 and 2 were ligated to the linearized vector.

[0142]

[0143] (Note: The molar ratio of fragment 1, fragment 2 and linearized vector is 1:1:1)

[0144] The connection system was placed in a PCR instrument, incubated at 50°C for 30 min, then transformed into Trans1-T1 competent cells, plated, and the positive clones were sequenced and verified. After the sequencing verification was correct, the plasmid was extracted.

[0145] 2. Fermentation of mutant strains and quantitative detection of products

[0146] The mutant plasmids were transformed into PA1 yeast competent cells, respectively. The specific operation steps are described in Frozen-EZ Yeast Transformation II Kit TM Kit instructions, and in addition, the original plasmid pYES2::CYP716C52 was introduced into the competent cells as a wild-type control by the same method.

[0147] Randomly pick single colonies from each plate into 3 mL of Sc-Leu-His-Ura liquid medium containing 2% glucose, set up 3 biological replicates, activate at 30°C, 200 rpm for about 24 h, and measure the OD 600 value, with an initial OD 600 = 0.1, into 30 mL of Sc-Leu-His-Ura liquid mixed sugar medium (0.2% glucose and 1.8% galactose), and cultivate at 30°C, 200 rpm for 4 days.

[0148] Directly add 30 mL of ethyl acetate to the fermentation system, ultrasonically extract for 30 min, repeat twice, combine the organic layers, rotary evaporate to remove the solvent, resuspend twice with 1 mL of ethyl acetate, then blow dry with nitrogen, finally dissolve in 300 μL of mass spectrometry methanol, high-speed centrifuge to take the supernatant for injection into the liquid chromatography-high resolution mass spectrometry (Q Exactive HF).

[0149] The Q Exactive HF injection conditions are as follows: A phase (0.1% formic acid-water), B phase (acetonitrile), using an ACQUITY UPLC VR HSS T3 chromatographic column (2.1mm 100mm, 1.8μm, USA) for separation, column temperature 40°C, liquid phase gradient as shown in Table 6. The detection was carried out using a targeted-SIM quantitative method under positive ion mode, with mass spectrometry detection conditions: scan time 0.2s, sheath gas flow rate 45, capillary temperature 320°C, electrospray current 0.4μA, and the detection results were analyzed using Xcalibur software.

[0150] Table 6 Q Exactive HF detection liquid conditions

[0151]

[0152] The results are as follows Figure 12As shown, after the glutamine (Q) at position 141 of CYP716C52 protein was respectively mutated into serine (S), glutamic acid (E), asparagine (N) and proline (P), the activity of mutant CYP716C52 Q141S The yield was increased to 2.98 times of the wild type, and the activities of the other three mutants were reduced to different degrees; after the leucine (L) at position 144 was respectively mutated into valine (V), serine (S), isoleucine (I) and threonine (T), the activity of CYP716C52 L144V mutant was lost, CYP716C52 L144I The yield of the mutant was increased to 1.53 times of the wild type, and the activities of the other two mutants were reduced; after the isoleucine (I) at position 221 was respectively mutated into phenylalanine (F), valine (V), leucine (L) and glycine (G), the activity of CYP716C52 I221F The activity of the mutant had no obvious change compared with the wild type, while the activities of CYP716C52 I221L The yield of the mutant was also increased, which was 2.22 times of the wild type, and the activities of the other two mutants were reduced. In summary, through protein mutation research, three mutants with better activity were obtained: CYP716C52 Q141S , CYP716C52 L144I and CYP716C52 I221L .

[0153] The above description is not a limitation of the present application, and the present application is not limited to the above examples. Changes, modifications, additions or substitutions made by those skilled in the art within the essential scope of the present application shall also belong to the protection scope of the present application, and the protection scope of the present application shall be subject to the claims.

Claims

1. An isolated protein, wherein the amino acid sequence of the protein is: (1) the amino acid sequence set forth in SEQ ID NO: 2; or (2) a polypeptide having the amino acid sequence set forth in SEQ ID NO: 2 with a substitution of one amino acid and having the same function, wherein the substitution is a mutation selected from any one of: (i) mutating Gln (Q) at position 141 to Ser (S), Glu (E), Asn (N) or Pro (P); or (ii) mutating Leu (L) at position 144 to Ser (S), lie (I) or Thr (T); or (iii) mutating lie (I) at position 221 to Phe (F), Val (V), Leu (L) or Gly (G).

2. A polynucleotide encoding the protein of claim 1.

3. The polynucleotide of claim 2, wherein the polynucleotide is at least one of: (1) the nucleotide molecule set forth in positions 1-1455 of SEQ ID NO: 1; or (2) a nucleotide sequence having one or more nucleotides substituted, deleted or added to the nucleotide molecule set forth in positions 1-1455 of SEQ ID NO: 1 and expressing the same protein.

4. An expression vector comprising a promoter, a polynucleotide of claim 2 or 3, and a transcription terminator, wherein the promoter is operably linked to the polynucleotide, and the polynucleotide is operably linked to the transcription terminator.

5. A recombinant host cell comprising a polynucleotide molecule of claim 2 or 3, or an expression vector of claim 4, wherein the cell is selected from the group consisting of a bacterial cell, a fungal cell, an insect cell, and a mammalian cell.

6. The cell of claim 5, wherein the fungal cell is a yeast cell.

7. Use of the protein of claim 1, or the polynucleotide of claim 2 or 3, or the expression vector of claim 4, or the cell of claim 5 or 6, in catalyzing hydroxylation at C2 of maytansine.

8. Use of the protein of claim 1, or the polynucleotide of claim 2 or 3, or the expression vector of claim 4, or the cell of claim 5 or 6, in synthesizing triptolide C and / or emodin.

9. Use of the protein of claim 1, or the polynucleotide of claim 2 or 3, or the expression vector of claim 4, or the cell of claim 5 or 6, in breeding of Tripterygium wilfordii. ​ ​ ​ ​ ​ ​ ​ ​

Images