A β-amyloid oligomer detection sensor and detection method
Through the method of combining cascade primer exchange reaction and blood glucose meter, the problem of insufficient sensitivity of AβO detection is solved, and high sensitivity detection of AβO is achieved. It is suitable for human serum and artificial cerebrospinal fluid samples, with good selectivity and precision.
Patent Information
- Application Number
- CN202210969290.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-12
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2042-08-12
AI Technical Summary
The existing β-amyloid oligomer (AβO) detection methods are insufficiently sensitive and difficult to provide effective monitoring in early AD diagnosis. The traditional method lacks response motivation, which affects the amplification ability.
Cascade primer exchange reaction (PER) is used to combine the glucose meter, and hairpin is activated by AβO aptamer strand to generate a large amount of long-chain DNA containing DNA-convertase binding sites. Glucose is detected through magnetic separation and convertase reaction to achieve signal amplification.
A high sensitivity detection of AβO is achieved, with a detection limit of 0.22pM, which is suitable for human serum and artificial cerebrospinal fluid samples, simplified experimental steps and has good selectivity and precision.
Smart Images

Figure CN116337557B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of bioanalysis, and relates to a β-amyloid oligomer detection sensor and a detection method. Background Art
[0002] The information disclosed in the background art of the present invention is only intended to increase the understanding of the overall background of the present invention, and is not necessarily regarded as an admission or an implication in any form that this information constitutes the prior art that has become well-known to those of ordinary skill in the art.
[0003] Alzheimer's disease (AD) is an irreversible neurodegenerative disease characterized by memory loss, cognitive decline, and behavioral disorders. Neuropathological studies have confirmed that the characteristic lesion of AD is the deposition of amyloid plaques in the brain. Initially, researchers believed that amyloid-β (Aβ) that constitutes the plaques was neurotoxic. However, cell culture and transgenic animal model experiments have shown that the aggregation of Aβ to form oligomers (AβO) is the most neurotoxic substance in human cerebrospinal fluid. It interacts with cell membranes and membrane receptors, damages intracellular signaling pathways, and leads to neuronal apoptosis and synaptic degeneration. Usually, AβO accumulates in the early stage of AD, 10 - 15 years earlier than the clinical onset, which is used as the first indicator for AD diagnosis. Therefore, effective monitoring of AβO is of great significance for predicting the progression of the early stage of AD and screening therapeutic drugs.
[0004] Currently, traditional methods including enzyme-linked immunosorbent assay (ELISA), immunoblotting (WB), and microarray assay have been used for AβO detection. In addition to these methods, various new methods have been developed to improve the detection sensitivity, such as assays based on catalytic hairpin assembly (CHA), assays based on hybridization chain reaction (HCR), and assays based on molecular machines. However, these methods are mainly driven by the change of entropy, which may lead to insufficient motivation for continuous reactions, thus limiting the amplification ability and affecting the sensitivity. Summary of the Invention
[0005] In order to further amplify the detection sensitivity, the present invention provides an AβO detection sensor and a detection method combining a signal amplification strategy based on a cascade primer exchange reaction with a blood glucose meter. The present invention uses an AβO aptamer strand to block the hairpin. When the target recognizes AβO, it activates the cascade primer exchange reaction (PER) to generate a large number of long-chain DNAs containing DNA-convertase binding sites. After magnetic separation, the convertase bound to the magnetic beads converts sucrose into glucose, which is detected by a blood glucose meter. The present invention has a high sensitivity, and the detection limit is 0.22 pM.
[0006] To achieve the above object, the present invention adopts the following technical solutions:
[0007] A β-amyloid oligomer detection sensor, comprising: a DNA-convertase conjugate, streptavidin-coated magnetic beads, biotinylated primers, H1, H2, aptamer strands, Bst DNA polymerase, dNTP, MgSO4 solution, NaCl solution;
[0008] Among them, the DNA-convertase conjugate is obtained by reacting TCEP-activated Thiol-DNA with convertase; TCEP-activated Thiol-DNA is obtained by activating Thiol-DNA with TCEP.
[0009] The sequence of H1 is:
[0010] AATAAGAGACCCGGTTTTCCGGGTCTCTTATTACCCGCCCCAAC-InvdT, as shown in SEQ ID NO.1.
[0011] The sequence of H2 is:
[0012] AATAAGAGACCCGGTTTTCCGGGTCTCTTATTTCTCTTATT-InvdT, as shown in SEQ ID NO.2.
[0013] The aptamer strand is GCCTGTGGTGTTGGGGCGGGTGCGTTT, as shown in SEQ ID NO.3.
[0014] The biotinylated primer is Biotin-AAAAAGGGGCGG, as shown in SEQ ID NO.4.
[0015] The sequence of Thiol-DNA is: SH C6-TCTCTTATTTCTCTTATT, as shown in SEQ ID NO.5.
[0016] A detection method for a β-amyloid oligomer detection sensor, comprising the following steps:
[0017] (1) Activate Thiol-DNA with TCEP; mix TCEP-activated Thiol-DNA with the purified convertase solution to obtain a DNA-convertase conjugate;
[0018] (2) React the biotinylated primer with streptavidin-coated magnetic beads to obtain primer-MBs;
[0019] (3) Mix H1 and the aptamer strand and heat to obtain the H1-aptamer strand. Heat H2 to form a stable hairpin structure. Mix the H1-aptamer strand, primer-MBs, H2, Bst DNA polymerase, dNTP, MgSO4 solution, NaCl solution, AβO, and water for reaction.
[0020] (4) Incubate the DNA-converting enzyme conjugate with the reaction mixture obtained in step (3). Then, separate the magnetic beads and add sucrose solution for reaction. Take the final solution and test it with a glucometer.
[0021] Furthermore, in step (1), dissolve Thiol-DNA in TE buffer. Take 20 μL of 0.1 mM ThiolDNA, mix it with 30 μL of 1 M sodium phosphate buffer and 2 μL of 30 mM TCEP, and then perform purification. Mix 5 mg / mL converting enzyme dissolved in buffer A with 1 mg of sulfo-SMCC. Place the solution on a shaker at room temperature for 1 hour. Purify it 8 times with Amicon-100K using buffer A. Mix the purified converting enzyme solution with TCEP-activated Thiol-DNA. Store the resulting solution in the dark at room temperature for 48 h. Purify the solution 8 times with Amicon-100K using buffer A. The buffer A contains 0.1 M NaCl, 0.1 M sodium phosphate; the pH is 7.3.
[0022] Furthermore, in step (2), pre-wash 2 μL of streptavidin-coated magnetic beads (MB) three times with 200 μL of PBS in a magnetic environment. Subsequently, add 20 μL of biotinylated primer to the MB solution at room temperature and react on a vertical rotator for 1 h. Wash the resulting primer-MBs three times with PBS. Then add 20 μL of PBS to redisperse the modified magnetic beads.
[0023] Furthermore, in step (3), first, mix H1 and the aptamer strand at a molar ratio of 1:1.2. Heat the mixed solution at 95 °C for 7 minutes, and then gradually cool it to room temperature. Similarly, heat H2 at 95 °C for 7 minutes, and then gradually cool it to room temperature to form a stable hairpin structure. Mix 4 μL of H1-aptamer strand, 4 μL of primer-MBs, 2 μL of H2, 1.5 μL of Bst DNA polymerase (8000 U / ml), 1.5 μL of dNTP (100 μM, N = A, T, G), 2 μL of 100 mM MgSO4, 1 μL of 1 M NaCl, the sample to be tested, and water to 20 μL. Then react at 37 °C for 4 h.
[0024] Furthermore, in step (4), the DNA-convertase conjugate was incubated with the reaction mixture obtained in step (4) at 37 °C for 1.5 h; MB was separated on a magnetic rack and 50 μL of 1 M sucrose solution was added; the mixed solution was reacted at 37 °C for 1.5 h; 10 μL of the final solution was taken and tested with a glucometer.
[0025] Use of the above sensor or detection method in detecting AβO.
[0026] The principle of the signal amplification strategy based on cascaded PER combined with a glucometer for portable and sensitive detection of AβO in the present invention is as Figure 1 shown. In this system, hairpin H1 contains a PER template sequence (b*), a primer binding sequence (a*), and base pairs of a blocking sequence G-C in the stem. Initially, a* is pre-locked by the aptamer strand. In the presence of the target AβO, the aptamer strand binds to AβO, thus exposing a* on H1. Subsequently, the primer modified on the magnetic bead hybridizes with a*. With the help of Bst DNA polymerase and dNTPs (N = A, T, G), the primer extends by replicating the b fragment of H1 until it stops at the blocking sequence. The b fragment on H1 displaces the replicated b fragment through branch migration, and the extended primer dissociates from H1 spontaneously due to its unstable binding to the hairpin, completing the first-stage PER. Then, the newly generated b fragment on the primer continues to bind to b* in H2 to initiate the second-stage PER, thus generating many ssDNAs containing the b fragment. These b fragments further bind to the DNA-convertase in the solution. After magnetic separation, a certain concentration of sucrose solution is added to the magnetic beads. The DNA-convertase converts sucrose into glucose. Finally, the glucose content is read by PGM.
[0027] The beneficial effects of the present invention are:
[0028] The strategy proposed by the present invention uses magnetic separation to collect target-dependent DNA-convertase from a complex sample matrix, which makes this method applicable to the detection of AβO in human serum and artificial cerebrospinal fluid samples.
[0029] Meanwhile, the application of the cascaded primer exchange reaction makes up for the deficiencies of other enzyme-assisted amplification strategies, and simplifies the experimental steps without the cooperation of multiple enzymes. Brief Description of the Drawings
[0030] The specification drawings forming a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments and descriptions thereof of the present invention are used to explain the present invention and do not constitute an improper limitation to the present invention.
[0031] Figure 1 It is a schematic diagram of a signal amplification strategy based on cascaded PER combined with a glucometer for portable and sensitive detection of AβO.
[0032] Figure 2 Feasibility analysis diagram of the signal amplification strategy for cascaded PER. (A) Gel electrophoresis diagram. Lane M: marker; Lane 1: H1 + aptamer; Lane 2: H1 + aptamer + primer AβO + Bst + dNTP; Lane 3: H1 + aptamer + primer + H2 + AβO + Bst + dNTP; Lane 4: H1 + aptamer + primer + H2 + Bst + dNTP.
[0033] Figure 3 Shows the change of the blood glucose meter signal with the concentration of AβO. The inset shows the linear relationship between the PGM signal and the logarithm of the AβO concentration.
[0034] Figure 4 Selectivity analysis diagram. Blood glucose meter signal responses to blank, thrombin, CEA, AβM, AβF, and AβO. Detailed implementation
[0035] It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.
[0036] Experimental reagents and instruments:
[0037] The experimental reagents and instruments used in the embodiments of the present invention are as follows:
[0038] 1. Experimental reagents: The DNA sequences and dNTP (N = A, T, G) used in this study were ordered from Sangon Biotech. Tween-20, Tris-HCl, sodium chloride (NaCl), magnesium sulfate (MgSO4), sodium dihydrogen phosphate (NaH2PO4), and disodium hydrogen phosphate (Na2HPO4) were purchased from Macklin Biochemical Co., Ltd. (Shanghai, China). Bst DNA polymerase (Bst) was purchased from New England Biolabs. Streptavidin-coated magnetic beads (diameter 1 μm) and sodium 4-(N-maleimidomethyl)cyclohexane-1-carboxylate 3-sulfonate were purchased from Aladdin Biochemical Co., Ltd. Thrombin, TCEP, 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP), sucrose, and invertase were purchased from Sigma Aldrich. Aβ1-42 monomers were purchased from Nanjing Genscript Co., Ltd. Carcinoembryonic antigen drug (CEA, >95.0%) was purchased from Shanghai Link Biotechnology Co., Ltd. (Shanghai, China). Human serum samples were provided by the Shandong University Hospital. The chemical reagents used in the experiment were of analytical purity grade and did not require further purification. All solutions were made with ultrapure water (>18.25 MΩcm-1 ) Preparation.
[0039] Table 1. DNA sequences used in this work
[0040]
[0041] Note: InvdT is used to prevent the 3'-end from extending under the action of polymerase.
[0042] 2. Experimental instruments: The ultraviolet-visible absorption spectrum was obtained by a UV-2910 ultraviolet spectrophotometer (Hitachi, Japan). The glucose concentration was recorded by Roche ACCU-CHEK. The non-denaturing gel imaging was obtained by a GelDocTM XR+ imaging tester (Bio-Rad, USA).
[0043] Example 1: A signal amplification strategy based on cascade PER combined with a blood glucose meter for portable and sensitive detection of AβO
[0044] The specific method is as follows:
[0045] The hairpin H1 and the aptamer were mixed at a molar ratio of 1:1.2. The mixed solution was heated at 95°C for 7 minutes and then gradually cooled to room temperature. Similarly, H2 was heated at 95°C for 7 minutes and then gradually cooled to room temperature to form a stable hairpin structure. Next, 4 μL of H1-aptamer, 4 μL of Primer-MBs, 2 μL of H2, 1.5 μL of Bst DNA polymerase (8000 U / ml), 1.5 μL of dNTP (100 μM, N = A, T, G), 2 μL of 100 mM MgSO4, 1 μL of 1 M NaCl, a series of different concentrations of AβO and water were mixed to 20 μL. Then the reactants were incubated at 37°C for 4 hours. Then the DNA-convertase conjugate was incubated with the above reaction mixture at 37°C for 1.5 h. The MB was separated on a magnetic stand and 50 μL of 1 M sucrose solution was added. The mixed solution was reacted at 37°C for 1.5 h. 10 μL of the final solution was taken for testing with a PGM.
[0046] Example 2: Feasibility study of the detection method of the present invention
[0047] To verify the feasibility of the signal amplification strategy based on cascade PER, we verified the feasibility of this strategy by non-denaturing gel electrophoresis. As Figure 2As shown in the figure, lane 1 is the conjugate of the aptamer strand and the hairpin. In lane 2, after adding the target AβO, primer, and polymerase, it can be found that the band corresponding to the conjugate of the aptamer strand and the hairpin disappears. The aptamer strand appears at the bottommost position, the hairpin H1 appears at the uppermost position, and the product in the middle is the result of the first primer extension. This result indicates that the first-stage PER is activated in the presence of AβO. Lane 3 shows that after adding the target, aptamer strand, primer, hairpins H1, H2, and polymerase, many bands with relatively large molecular weights can be found at the topmost position of the bands, indicating that in the presence of the target, a cascaded PER is successfully triggered, generating a large amount of long-chain DNA. In lane 4, when the target is not added, the bands of H1 and the aptamer strand appear at their corresponding positions, and the primer primer is not extended and appears at the bottommost position. The middle band is H2.
[0048] Experimental Case 3: Investigation of the sensitivity of the detection method of the present invention
[0049] Under the optimal experimental conditions, we measured the glucose meter signals of different concentrations of AβO to evaluate the analytical performance of the cascaded PER. As Figure 3 shown, from 0 pM to 1000 pM, the fluorescence intensity increases with the increase of the AβO concentration. The inset shows that in the range of 1 - 250 pM, there is a good linear correlation between the glucose meter signal and the logarithm of the AβO concentration, and the regression equation is Y = 4.13 lgC AβO + 6.02, the correlation coefficient is 0.995, and the detection limit is 0.22 pM. The high sensitivity of this method is mainly attributed to the signal amplification strategy of the cascaded PER.
[0050] Experimental Case 4: Investigation of the selectivity of the detection method of the present invention
[0051] Selectivity is an important index for evaluating a detection method. To investigate the selectivity of this method, we selected blank samples, thrombin, carcinoembryonic antigen (CEA), AβM, and AβF as interfering components and detected them under the same conditions. As Figure 4 shown, only when AβO is present, the glucose meter signal increases significantly, while the glucose meter signals of other interfering substances are similar to that of the blank sample. The results indicate that this method has good specificity for detecting AβO.
[0052] Experimental Case 5: Investigation of the precision and reproducibility of the detection method of the present invention
[0053] To evaluate the reliability of this strategy for detection, we investigated the precision and reproducibility. Three different concentrations of AβO, namely 1, 50, and 250 pM, were selected for detection and evaluated using the relative standard deviation (RSD). To study the precision, we used parallel samples as the target samples on the same day, and the RSDs were 4.4%, 5.4%, and 2.4% respectively. To study the reproducibility, we used samples from different batches as the target samples within 3 days, and the RSDs were 5.4%, 4.9%, and 4.5% respectively. The above results indicate that the signal amplification strategy of this cascaded PER has good precision and reproducibility and can reliably detect AβO.
[0054] Example of implementation 6: Investigation of the spiked recovery rate of the detection method of the present invention in complex biological samples
[0055] To investigate the feasibility of the detection method of the present invention in the detection of actual samples, we used human serum and artificial cerebrospinal fluid as complex biological samples to investigate the spiked recovery rate. Three different concentrations of AβO (1, 50, 250 pM) were added to 10% serum. The spiked recovery rates in human serum were 97%, 97%, and 101%, and the RSDs were 5.1%, 0.8%, and 6.0% respectively. The spiked recovery rates in artificial cerebrospinal fluid were 106%, 95%, and 97%, and the RSDs were 5.4%, 1.7%, and 5.5% respectively. This indicates that the signal amplification strategy of this cascaded PER has good anti-interference ability and can be used for the analysis and detection of complex biological samples.
[0056] The above are only the preferred embodiments of the present invention and are not used to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A β-amyloid oligomer detection sensor, characterized in that, The β-amyloid oligomer detection sensor includes: a DNA-convertase conjugate, streptavidin-coated magnetic beads, biotinylated primers, H1, H2, aptamer strands, Bst DNA polymerase, dNTP, MgSO4 solution, and NaCl solution; Among them, the DNA-convertase conjugate is obtained by reacting TCEP-activated Thiol-DNA with convertase; The sequence of H1 is: AATAAGAGACCCGGTTTTCCGGGTCTCTTATTACCCGCCCCAAC-InvdT, as shown in SEQ ID NO.1; The sequence of H2 is: AATAAGAGACCCGGTTTTCCGGGTCTCTTATTTCTCTTATT-InvdT, as shown in SEQ ID NO.2; The aptamer strand is GCCTGTGGTGTTGGGGCGGGTGCGTTT, as shown in SEQ ID NO.3; The biotinylated primer is Biotin-AAAAAGGGGCGG, as shown in SEQ ID NO.4; The sequence of Thiol-DNA is: SH C6-TCTCTTATTTCTCTTATT, as shown in SEQ ID NO.
5.
2. Use of the β-amyloid oligomer detection sensor according to claim 1 in the detection of β-amyloid oligomers for non-diagnostic and therapeutic purposes.
3. The application according to claim 2, characterized in that, It includes the following steps: (1) Activate Thiol-DNA with TCEP; mix the TCEP-activated Thiol-DNA with the purified convertase solution to obtain a DNA-convertase conjugate; (2) React the biotinylated primer with the streptavidin-coated magnetic beads to obtain P-MBs; (3) Mix H1 and the aptamer strand and heat to obtain H1-aptamer strand, and heat H2 to form a stable hairpin structure; (4) Mix H1-aptamer strand, P-MBs, H2, Bst DNA polymerase, dNTP, MgSO4 solution, NaCl solution, β-amyloid oligomers, and water for reaction; (5) Incubate the DNA-convertase conjugate with the reaction mixture obtained in step (4); then, separate the magnetic beads and add sucrose solution for reaction; take the final solution and test it with a glucometer.
4. The application according to claim 3, wherein, In the said step (2), dissolve Thiol-DNA in TE buffer, take 20 μL of 0.1 mM Thiol DNA, mix it with 30 μL of 1 M sodium phosphate buffer and 2 μL of 30 mM TCEP, and then purify it; mix 5 mg / mL convertase dissolved in buffer A with 1 mg of sulfo-SMCC; place the solution on a shaker at room temperature for 1 hour and then purify it; mix the purified convertase solution with TCEP-activated Thiol-DNA; Store the obtained solution in the dark at room temperature and then purify it.
5. The application according to claim 4, wherein The buffer A contains 0.1 M NaCl and 0.1 M sodium phosphate; the pH is 7.
3.
6. The application according to claim 3, wherein In step (3), pre-wash 2 μL of streptavidin-coated magnetic beads three times with 200 μL of PBS in a magnetic environment; subsequently, add 20 μL of biotinylated primer to the MB solution and react on a vertical rotator at room temperature for 1 h; wash the obtained P-MB three times with PBS; then add 20 μL of PBS to redisperse the modified magnetic beads.
7. The application according to claim 3, characterized in that, In step (4), first, mix H1 and the aptamer strand at a molar ratio of 1:1.2; heat the mixed solution at 95 °C for 7 minutes and then gradually cool it to room temperature; similarly, heat H2 at 95 °C for 7 minutes and then gradually cool it to room temperature to form a stable hairpin structure.
8. The application according to claim 7, wherein Mix 4 μL of H1-aptamer strand, 4 μL of primer-MBs, 2 μL of H2, 1.5 μL of Bst DNA polymerase (8000 U / ml), 1.5 μL of dNTP (100 μM, N = A, T, G), 2 μL of 100 mM MgSO4, 1 μL of 1 M NaCl, the sample to be detected, and water to 20 μL; then react at 37 °C for 4 h.
9. The application according to claim 3, wherein In step (5), incubate the DNA-converting enzyme conjugate with the reaction mixture obtained in step (4) at 37 °C for 1.5 h; separate the MB on a magnetic stand and add 50 μL of 1 M sucrose solution; react the mixed solution at 37 °C for 1.5 h; Take 10 μL of the final solution and test it with a blood glucose meter.
Citation Information
Patent Citations
Biomarkers for theranostics
CN103237901A
Automated immunoanalyzer system for performing diagnostic assays for autoimmune and infectious diseases
CN107548461A