An engineered strain for high-yield ergothioneine and a method for producing ergothioneine

Abstract

The application belongs to the technical field of biology, and provides an engineered strain for high-yield ergothioneine and a method for producing ergothioneine, wherein the engineered strain takes Escherichia coli as a chassis strain, and one or more of the following is overexpressed in the chassis strain: an ergothioneine synthesis gene cluster egtBDE, an encoding gene of an ergothioneine biosynthesis protein egt1, and an encoding gene of an ergothioneine biosynthesis protein egt2. The engineered strain of the application overcomes the problem that the existing ergothioneine-producing strain needs to knock out multiple times and overexpress multiple related pathway genes. With cysteine as a substrate, not only is the original five-step enzymatic reaction changed into a three-step enzymatic reaction, but also the utilization of cysteine is promoted. The strain constructed in the application has a yield that is more than 4 times that of a traditional pathway, and does not need to add exogenous amino acids such as histidine, cysteine and other precursor substances.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to an engineered strain for high-yield ergothioneine and a method for producing ergothioneine. BACKGROUND

[0002] Ergothioneine (ERG / EGT) is a special amino acid derived from histidine, which was discovered in 1909 from Claviceps purpurea. It is also known as 2-mercaptohistidine trimethyl inner salt because of the sulfur atom on its imidazole ring. It is stable in neutral and alkaline environments and exists in solution as a thiol-thione tautomer, with the thione form being the predominant form at physiological pH. As an important physiologically active substance, ergothioneine has multiple physiological functions such as free radical scavenging, antioxidant, DNA biosynthesis maintenance, and immune regulation. Therefore, it is also considered as a unique and multifunctional cell physiological protective agent and is widely used in food, medicine, and cosmetics. So far, ergothioneine has not been found to be synthesized in the human body and must be provided by diet. It is only synthesized by bacteria and fungi, including cyanobacteria, actinomycetes, and basidiomycete mushrooms. In nature, ergothioneine is produced through two different pathways: the bacterial pathway and the fungal pathway. In the bacterial pathway, such as in Mycobacterium, the biosynthetic pathway is completely revealed, and it is found that the biosynthesis is catalyzed by 5-step reactions, and these enzymes are encoded by the gene cluster egtABCDE. In the fungal biosynthetic pathway, two major synthesis enzyme genes are responsible for the synthesis of ergothioneine, namely egt1 and egt2. Currently, the research on the biosynthesis of ergothioneine is mostly about heterologous expression of key enzyme genes required for the synthesis of ergothioneine, and through genetic engineering means to strengthen the expression of key genes involved in the synthesis of ergothioneine, and then ferment to produce ergothioneine. For example, Osawa R (Heterologous and High Production of Ergothioneine in Escherichia coli, J. Agric. Food Chem. 2018, 66: 1191-1196) heterologously expressed the egt gene of Mycolicibacterium smegmatis in Escherichia coli, optimized the expression of related recombinant enzymes to improve the yield of ergothioneine, and through the exogenous addition of thiosulfate, the yield of ergothioneine reached 24 mg / L in shake flask fermentation; On this basis, Tanaka N (Gram-scale fermentative production of ergothioneine driven by overproduction of cysteine in Escherichia coli, Scientific Reports, 2019, 9: 1895) expressed multiple related synthesis genes, then carried out fermenter cultivation, and continuously supplemented with precursors such as cysteine and histidine, and the fermentation period was as long as 216 h, and finally 1.3 g / L of ergothioneine was obtained.and Ma Jian et al. (A genetically engineered strain for producing ergothioneine and application thereof, CN 112251392A, 2020) integrated the ergothioneine operon gene egtBCDE of Mycobacterium smegmatis and the C-S lyase encoding gene egtE of Ceriporiopsis subvermispora into the genome of the E. coli chassis strain. ncr , the gene egtB of the mutant sulfoxide synthase *msm Meanwhile, the precursor histidine-related genes were overexpressed. In a 5L fermenter, the strain was cultured for 52h, and cysteine and methionine precursor amino acids were exogenously fed. Finally, 2.9g / L of ergothioneine was produced. However, these methods involve modification of multiple genes, are relatively complex, have a long operation period, and require exogenous addition of precursor substances such as histidine, methionine, and other amino acids. SUMMARY

[0003] The present application aims to provide an engineered strain for high-yield production of ergothioneine and a method for producing ergothioneine. The engineered strain co-expresses two key enzymes in the ergothioneine synthesis pathway, improving the efficiency of the five-step enzymatic reaction in traditional prokaryotes. The yield of ergothioneine is more than 4 times that of the traditional pathway, and no exogenous amino acids such as histidine and cysteine are required.

[0004] To achieve the above-mentioned application purposes, the present application provides the following technical solutions:

[0005] The present application provides an engineered strain for high-yield production of ergothioneine. The engineered strain uses E. coli as a chassis strain and overexpresses one or more of the ergothioneine synthesis gene cluster egtBDE, the ergothioneine biosynthesis protein egt1 encoding gene, and the ergothioneine biosynthesis protein egt2 encoding gene in the chassis strain.

[0006] Preferably, the E. coli includes E. coli MG1655, E. coli DH5α, E. coli JM109, E. coli BW25113, or E. coli BL21(DE3).

[0007] Preferably, the chassis strain overexpresses the ergothioneine synthesis gene cluster egtBDE, overexpresses the ergothioneine biosynthesis protein egt1 and the ergothioneine biosynthesis protein egt2 encoding gene, overexpresses the ergothioneine synthesis gene cluster egtBDE and the ergothioneine biosynthesis protein egt1 encoding gene, overexpresses the ergothioneine synthesis gene cluster egtBDE and the ergothioneine biosynthesis protein egt2 encoding gene, or overexpresses the ergothioneine synthesis gene cluster egtBDE and the ergothioneine biosynthesis protein egt1 and egt2 encoding genes.

[0008] Preferably, the ergothioneine synthesis gene cluster egtBDE is composed of an egtB gene, an egtD gene and an egtE gene, the nucleotide sequence of the egtB gene is shown as SEQ ID NO. 1, the nucleotide sequence of the egtD gene is shown as SEQ ID NO. 2, and the nucleotide sequence of the egtE gene is shown as SEQ ID NO. 3.

[0009] Preferably, the nucleotide sequence of the ergothioneine biosynthesis protein egt1 coding gene is shown as SEQ ID NO. 5, and the nucleotide sequence of the ergothioneine biosynthesis protein egt2 coding gene is shown as SEQ ID NO. 6.

[0010] The application further provides a method for synthesizing ergothioneine, wherein the above-mentioned engineering strain is activated and cultured, inoculated into a seed culture medium for culture, then inoculated into a fermentation culture medium for fermentation culture to obtain ergothioneine.

[0011] Preferably, the temperature of the activation culture is 35-40 DEG C, and the time of the activation culture is 10-16 h.

[0012] Preferably, the temperature of the inoculation into the seed culture medium for culture is 25-37 DEG C, and the time of the inoculation into the seed culture medium for culture is 10-16 h.

[0013] Preferably, the inoculation amount when inoculated into the fermentation culture medium is 1-5 %, the temperature of the fermentation culture is 25-37 DEG C, and the time of the fermentation culture is 20-30 h.

[0014] Preferably, 0.1-0.5 mM IPTG is added into the fermentation culture medium after 3-5 h of the fermentation culture for subsequent culture.

[0015] Compared with the prior art, the application has the following beneficial effects:

[0016] 1. The application combines the ergothioneine synthesis gene egtBDE with the heterologous ergothioneine synthesis pathway enzymes egt1, egt2 and egt12 respectively to obtain engineering strains egtBDE-egt1, egtBDE-egt2 and egtBDE-egt12. The shake flask yields of the engineering strains egtBDE and egt12 are 39.83 mg / L and 42.91 mg / L respectively, and the ergothioneine yields of the combinations egtBDE-egt1, egtBDE-egt2 and egtBDE-egt12 in the 50 ml shake flasks are 48.81 mg / L, 41.57 mg / L and 77.54 mg / L respectively.

[0017] 2、The method of the application does not need to add additional histidine, cysteine, methionine and other expensive precursors, which significantly reduces the production cost.

[0018] 3、Compared with the efficiency of the traditional five-step enzymatic reaction of egtABCDE in prokaryotes, the ergot alkaloid production of the engineered strain egtBDE in a 50ml shake flask can reach 39.83mg / L, which is 2 times higher than that of the traditional pathway. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 The ergot alkaloid synthesis pathway of the application is shown in the figure;

[0020] Figure 2 The plasmid map of the recombinant plasmid pET28a-egtBDE is shown in the figure;

[0021] Figure 3 The plasmid map of the recombinant plasmid pET28a-egt12 is shown in the figure;

[0022] Figure 4 The plasmid map of the recombinant plasmid pET28a-egtBDE-egt1 is shown in the figure;

[0023] Figure 5 The plasmid map of the recombinant plasmid pET28a-egtBDE-egt2 is shown in the figure;

[0024] Figure 6 The plasmid map of the recombinant plasmid pCDFDuet-1-egtBDE is shown in the figure;

[0025] Figure 7 The plasmid map of the recombinant plasmid pCDFDuet-1-egt12-egtBDE is shown in the figure;

[0026] Figure 8 The ergot alkaloid production of the recombinant strain in a 50ml shake flask is shown in the figure, and egtBDE, egt12, egtBDE-egt1, egtBDE-egt2, egtBDE-egt12 represent E. coli egtBDE, E. coli egt12, E. coli egtBDE-egt1, E. coli egtBDE-egt2, and E. coli egtBDE-egt12, respectively. DETAILED DESCRIPTION

[0027] The application provides an engineered strain for high-yield ergot alkaloid, which uses E. coli as a chassis strain and overexpresses one or more of the ergot alkaloid synthesis gene cluster egtBDE, the ergot alkaloid biosynthesis protein egt1 coding gene, and the ergot alkaloid biosynthesis protein egt2 coding gene. Figure 1 .

[0028] In the present application, the E. coli includes E. coli MG1655, E. coli DH5α, E. coli JM109, E. coli BW25113 or E. coli BL21(DE3), which are purchased from Beijing Baoebow Biotechnology Co., Ltd.

[0029] In the present application, the ergothioneine synthesis gene cluster egtBDE is overexpressed in the chassis strain, the ergothioneine biosynthesis protein egt1 and the ergothioneine biosynthesis protein egt2 encoding genes are overexpressed, the ergothioneine synthesis gene cluster egtBDE and the ergothioneine biosynthesis protein egt1 encoding gene are overexpressed, the ergothioneine synthesis gene cluster egtBDE and the ergothioneine biosynthesis protein egt2 encoding gene are overexpressed, or the ergothioneine synthesis gene cluster egtBDE and the ergothioneine biosynthesis protein egt1 and egt2 encoding genes are overexpressed.

[0030] In the present application, the ergothioneine synthesis gene cluster egtBDE is composed of egtB gene, egtD gene and egtE gene, which is preferably synthesized by chemical synthesis.

[0031] In the present application, the egtB gene is derived from Methylobacterium pseudosasicola or Mycobacterium smegmatis, and the nucleotide sequence of the egtB gene is as follows:

[0032] egtB nucleotide sequence (SEQ ID NO. 1):

[0033]

[0034] In the present application, the source of the said egtD gene is Mycobacterium smegmatis, and the nucleotide sequence of the said egtD gene is as follows:

[0035] egtD nucleotide sequence (SEQ ID NO. 2):

[0036] agcaggatcatgaccctgagcctggccaattatctggccgcagatagcgccgccgaagccctgcgtcgtgatgttcgtgcaggtctgaccgcagcaccgaaaagcctgccgccgaaatggttttatgatgccgtgggcagtgatctgtttgatcagattacccgtctgccggaatattatccgacccgcaccgaagcccagattctgcgtacccgtagcgcagaaattattgccgccgcaggtgccgataccctggtggaactgggtagcggcaccagcgaaaaaacccgcatgctgctggatgcaatgcgtgatgcagaactgctgcgtcgttttattccgtttgatgtggatgcaggtgttctgcgcagtgccggcgcagccattggtgccgaatatccgggtattgaaattgatgcagtgtgcggtgattttgaagaacatctgggtaaaattccgcatgttggccgtcgtctggtggtgtttctgggcagtaccattggtaatctgaccccggccccgcgcgccgaatttctgagcaccctggcagataccctgcagccgggtgatagcctgctgctgggcaccgatctggttaaagataccggccgcctggtgcgcgcatatgatgatgcagccggtgtgaccgcagcatttaatcgtaatgtgctggccgttgttaatcgtgaactgagcgccgattttgatctggatgcatttgaacatgtggccaaatggaatagcgatgaagaacgcattgaaatgtggctgcgcgcacgtaccgcacagcatgtgcgtgttgcagcactggatctggaagttgattttgccgcaggcgaagaaatgctgaccgaagttagttgcaaatttcgcccggaaaatgttgttgcagaactggcagaagcaggcctgcgccagacccattggtggaccgatccggccggcgattttggcctgagcctggcggttcgtcatcatcatcatcatcac

[0037] In the present application, the source of the said egtE gene is Mycobacterium smegmatis, and the nucleotide sequence of the said egtE gene is as follows:

[0038] egtE nucleotide sequence (SEQ ID NO. 3):

[0039]

[0040] In the present application, the nucleotide sequence of the gene cluster egtBDE (SEQ ID NO. 4) is as follows:

[0041]

[0042] In the present application, the nucleotide sequence of the ergothioneine biosynthesis protein egt1 encoding gene, which is derived from Neurospora crasa, is as follows.

[0043] egt1 nucleotide sequence (SEQ ID NO. 5):

[0044]

[0045] In the present invention, the nucleotide sequence of the gene encoding the ergothioneine biosynthesis protein egt2 is shown below, and the egt2 gene is derived from Claviepspurpurea or Neurospora crasa.

[0046] egt2 nucleotide sequence (SEQ ID NO.6):

[0047]

[0048] In the present application, the nucleotide sequence of the gene cluster egt12 (SEQ ID NO. 7) is as follows:

[0049]

[0050] The application also provides a construction method of the high ergothioneine yield engineering strain, comprising the following steps:

[0051] (1) Construction of recombinant plasmid

[0052] Construction of recombinant plasmid pET28a-egtBDE: taking pET28a (purchased from Jiutian Gene Technology Co., Ltd. (Tianjin)) as a carrier, a gene cluster egtBDE is chemically synthesized according to egtB gene, egtD gene and egtE gene, and the recombinant plasmid pET28a-egtBDE is obtained by Jiutian Gene Technology Co., Ltd. (Tianjin). GenBank of egtB: CP033231.1, GeneID of egtD: 4537704, GeneID of egtE: 4531386.

[0053] Construction of recombinant plasmid pET28a-egt12: taking pET28a as a carrier, a gene cluster egt12 is chemically synthesized according to egt1 gene and egt2 gene, and the recombinant plasmid pET28a-egt12 is obtained by Jiutian Gene Technology Co., Ltd. (Tianjin). GeneID of egt1: 3872471, proteinID of egt2: CCE33140.1 (SEQ ID NO. 6).

[0054] Construction of recombinant plasmid pET28a-egtBDE-egt1: a linear fragment of the vector is obtained by enzyme digestion of plasmid pET28a, a gene cluster egtBDE is connected to the linear fragment of the vector by homologous recombination by one-step cloning to obtain a recombinant plasmid pET28a-egtBDE, the linearized pET28a-egtBDE is connected to the linearized pET28a-egtBDE vector by homologous recombination by one-step cloning to obtain a recombinant plasmid egtBDE-egt1.

[0055] Construction of recombinant plasmid pET28a-egtBDE-egt2: a linear fragment of the vector is obtained by enzyme digestion of plasmid pET28a, a gene cluster egtBDE is connected to the linear fragment of the vector by homologous recombination by one-step cloning to obtain a recombinant plasmid pET28a-egtBDE, the linearized pET28a-egtBDE is connected to the linearized pET28a-egtBDE vector by homologous recombination by one-step cloning to obtain a recombinant plasmid pET28a-egtBDE-egt2.

[0056] Construction of recombinant plasmid pCDFDuet-1-egt12-egtBDE: linearize the vector of plasmid pCDFDuet-1 (purchased from Changsha Kewen Biotechnology Co., Ltd.) to obtain a linear fragment of the vector, and then the gene cluster egtBDE is connected to the linear fragment of the vector by homologous recombination to obtain the recombinant plasmid pCDFDuet-1-egtBDE; linearize pCDFDuet-1-egtBDE, and then the gene cluster egt12 is connected to the linearized pCDFDuet-1-egtBDE vector by homologous recombination to obtain the recombinant plasmid pCDFDuet-1-egt12-egtBDE.

[0057] (2) Engineering strain

[0058] One of the above-mentioned recombinant plasmids pET28a-egtBDE, pET28a-egt12, pET28a-egtBDE-egt1, pET28a-egtBDE-egt2, and pCDFDuet-1-egt12-egtBDE which have been constructed and verified to be correct is transformed into the chassis strain to obtain an engineering strain with high ergothioneine production.

[0059] The application also provides a method for producing ergothioneine, in which the engineering strain is activated and cultured, inoculated into a seed culture medium for culture, and then inoculated into a fermentation culture medium for fermentation culture to obtain ergothioneine.

[0060] In the application, the temperature of the activation culture is 35-40 DEG C, preferably 36-39 DEG C, and further preferably 37-38 DEG C; and the time of the activation culture is 10-16 h, preferably 11-15 h, and further preferably 12-14 h.

[0061] In the application, the temperature of the inoculation into the seed culture medium for culture is 25-37 DEG C, preferably 26-35 DEG C, and further preferably 28-32 DEG C; and the time of the inoculation into the seed culture medium for culture is 10-16 h, preferably 11-15 h, and further preferably 12-14 h.

[0062] In the application, the inoculation amount when inoculated into the fermentation culture medium is 1-5%, preferably 1.5-4.5%, and further preferably 2-4%; the temperature of the fermentation culture is 25-37 DEG C, preferably 26-35 DEG C, and further preferably 28-32 DEG C; and the time of the fermentation culture is 20-30 h, preferably 22-28 h, and further preferably 24-26 h.

[0063] In the present application, 0.1-0.5 mM IPTG is added to the fermentation medium after 3-5 h of fermentation culture, and the IPTG concentration is preferably 0.15-0.45 mM, and further preferably 0.2-0.4 mM.

[0064] The technical solutions provided by the present application are described in detail below in conjunction with examples, but they should not be understood as limiting the scope of protection of the present application.

[0065] Construction and transformation of recombinant plasmid pET28a-egtBDE in Example 1

[0066] Construction of recombinant plasmid pET28a-egtBDE: Taking pET28a as the vector, the gene cluster egtBDE was chemically synthesized according to the egtB gene, egtD gene and egtE gene, which was completed by Jiutian Gene Technology (Tianjin) Co., Ltd., thereby obtaining the recombinant plasmid pET28a-egtBDE. GenBank of egtB: CP033231.1, GeneID of egtD: 4537704, GeneID of egtE: 4531386.

[0067] Transformation of recombinant plasmid pET28a-egtBDE: Take 2 μl (100 μg / ml) of recombinant plasmid pET28a-egtBDE and add it to a centrifuge tube containing E. coli DH5α or JM109 competent cells that have been melted in an ice bath, flick the tube wall, mix well, and ice bath for 30 min. 42℃ heat shock for 60 s, then immediately ice bath for 5 min (do not move during this process). Under sterile conditions, add 900 μL of LB medium to the centrifuge tube, mix well by blowing, and incubate at 37℃, 180 r / min for 45 min. Centrifuge the centrifuge tube at 10000 r / min for 1 min, remove 900 μL of supernatant, mix the remaining liquid by blowing with a pipette, and spread it on a LB solid plate containing 50 μg / mL kanamycin. Incubate the LB plate at 37℃ overnight until single colonies are clearly visible. Design primers egtBDE-F / egtBDE-R (see Table 1 for primer sequences), and pick positive transformants for colony PCR verification to obtain strains E. coli DH5α egtBDE or E. coli JM109 egtBDE. After inoculating the verified transformants into LB liquid medium and incubating overnight, extract the plasmid for sequencing and further verification. If the verification is correct, the recombinant plasmid pET28a-egtBDE is obtained. The plasmid map of recombinant plasmid pET28a-egtBDE is shown in Figure 2 , and the nucleotide sequence of recombinant plasmid pET28a-egtBDE is as follows.

[0068] pET28a-egtBDE (SEQ ID NO. 24):

[0069]

[0070] gcctgcttct cgccgaaacg ttggtggcgg gaccagtgac gaaggcttga gcgagggcgt gcaagattcc gaataccgca agcgacaggt cgat

[0071] catcgtcgcg ctccagcgaagcggtcctcg ccgaaaatga cccagagcgc tgccggcacc tgtcctacga gttgcatga taaagaagac agtcat

[0072] aagtgcggcg acgatagtca tgccccgcgc ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcga gatcccggtg cctaat

[0073] gagtgagcta acttacatta attgcgttgc gctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg

[0074] ggagaggcgg tttgcgtatt gggcgccagg gtggtttttc ttttcaccag tgagacgggc aacagctga ttgcccttca ccgcctggcc ctgagagagt

[0075] tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa atcctgtttg atggtggtta acggcggga tataacatga gctgtcttc ggtatcgtcg

[0076] tatcccacta ccgagatatc cgcaccaacg cgcagcccgg actcggtaat ggcgcgcatt gcgcccagcg ccatctgatc gttggcaac cagcatcg

[0077] cagtgggaac gatgccctca ttcagcattt gcatggtttg ttcgaaaacc ggacatggca ctccagtcgc cttcccgttc cgctatcggc tgaatttgat tg

[0078] cgagtgagatatttatgccagccagccagacgcagacgcgccgagacagaacttaatgggcccgctaacagcgcgatttgctggtgacccaatgcg

[0079] accagatgctccacgcccagtcgcgtaccgtcttcatgggagaaaataatactgttgatgggtgtctggtcagagacatcaagaaataacgccggaac

[0080] attagtgcaggcagcttccacagcaatggcatcctggtcatccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagattgtgcaccg

[0081] ccgctttacaggcttcgacgccgcttcgttctaccatcgacaccaccacgctggcacccagttgatcggcgcgagatttaatcgccgcgacaatttgcg

[0082] acggcgcgtgcagggccagactggaggtggcaacgccaatcagcaacgactgtttgcccgccagttgttgtgccacgcggttgggaatgtaattca

[0083] gctccgccatcgccgcttccactttttcccgcgttttcgcagaaacgtggctggcctggttcaccacgcgggaaacggtctgataagagacaccggca

[0084] tactctgcgacatcgtataacgttactggtttcacattcaccaccctgaattgactctcttccgggcgctatcatgccataccgcgaaaggttttgcgccatt

[0085] cgatggtgtccgggatctcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcaccgccgccgcaa

[0086] ggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaa

[0087] gtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccgg

[0088] cgtagaggatcgagatctcgatcccgcgaaattaatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactt

[0089] taagaaggagatataagcaggatccatggccgctaccgccgctctgcgtagcggtgatacccgtgcccagaccgccgcagcatttccgccgcctcc

[0090] ggtgaccgcccgtcctattgatcgtgccgcatggattgccgcatttcgctttgtgcgtagcgaaaccgaacgccgcgcagcaccgctgagcgcagaa

[0091] gatcagcaggtgcagagcatggcagatgcaagcccgaccaaatggcatcgtgcacatgttacctggttttttgaacagtttctgctgcgcgaacatctg

[0092] ccgggttatgcaatttatgatgaacgcctgcattatctgtttaatagttattatgtggccgcaggcccgcgtcagccgcgtattcagcgtggtatgattacc

[0093] cgtccgaccatggcagaagttaccgcctatcgcgcacatgtggatcgtgcagtggaaagtctgctgggccaggccgccgatggcgctttagaagca

[0094] gttctgccgattctggaaattggtctgtatcatgaacagcagcatcaggaactgctgctgaccgatattctgcatgcatttgcacagaatccgctgggtcc

[0095] ggtttatgatgcagaatggcgttttccggccgtggccggccagggtggtcaggcacctctggctcgcggcattgcatggattggtcatgaaggcgatg

[0096] gttttagctttgataatgaaagtccgcgtcatgaagcactgattctgccgggtcgcattgataaagcactggtgaccaatcgtgattggctgggctttatg

[0097] gaagcaggcggttatgccaaaccggaactgtggctgagcgatggctggtatgccggtcaggccgaaggttgggaagcaccgggttattggcgccg

[0098] tgatggtgaaggctgggccaccatgaccctgggtggtgttcgtccggttgaactggatgcaccggtgacccatattagttattatgaagcagatgcctat

[0099] gcccgctgggccggccgtaccttaccgacagaatttgaatgggaagtggccgcccgtgatggtgccctgccggatgcatttggtctggtgtggcagt

[0100] ggacccgtagcgcctatgttgcctatccgggttatcgtccgctgccgggcgcactgggtgaatataatggtaaatttatggtgagtcagttcgttctgcgt

[0101] ggtagtagtgtggcaaccccggaaggccatgcccgcctgccttatcgtaattttttttatccgcatcagcgttggcagtttaccggtctgcgcctggccg

[0102] atgtggcccatcatcatcatcatcactaattaagaaggagatataagcaggatcatgaccctgagcctggccaattatctggccgcagatagcgccgcc

[0103] gaagccctgcgtcgtgatgttcgtgcaggtctgaccgcagcaccgaaaagcctgccgccgaaatggttttatgatgccgtgggcagtgatctgtttgat

[0104] cagattacccgtctgccggaatattatccgacccgcaccgaagcccagattctgcgtacccgtagcgcagaaattattgccgccgcaggtgccgatac

[0105] cctggtggaactgggtagcggcaccagcgaaaaaacccgcatgctgctggatgcaatgcgtgatgcagaactgctgcgtcgttttattccgtttgatgt

[0106] ggatgcaggtgttctgcgcagtgccggcgcagccattggtgccgaatatccgggtattgaaattgatgcagtgtgcggtgattttgaagaacatctggg

[0107] taaaattccgcatgttggccgtcgtctggtggtgtttctgggcagtaccattggtaatctgaccccggccccgcgcgccgaatttctgagcaccctggca

[0108] gataccctgcagccgggtgatagcctgctgctgggcaccgatctggttaaagataccggccgcctggtgcgcgcatatgatgatgcagccggtgtga

[0109] ccgcagcatttaatcgtaatgtgctggccgttgttaatcgtgaactgagcgccgattttgatctggatgcatttgaacatgtggccaaatggaatagcgat

[0110] GAGAACAACGCGTATGAAATGTGGCTGCACGTACCGCACAGCATGTGC GTGTTCAGCCTCTGGATCTGGAAGTTGATTTCGCCGCAGGCAGAAGAAA

[0111] TGCTGACC GAAGTTAGTTGCAAATTCGCCC GGAAAATGTTGTTC AGA ACTGGCAGAAGCAGGCCTGC GCCAGACCCATTGGTGGACC GATCCGGC

[0112] CGGCATTTCGGCCTGAGCCTGGCGGTTTGTCTATCATCATCATCATCATCATCA TAAAGGC GAATGCTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGA GG

[0113] GGTTTTTTGGAAATTAATACGACTC ACTATAGGGGAATTGTGAGCGGAT AACAATTCCCATACTGCTGTTAAGAAGGAGATATACC GAAGGACGTGATGCT

[0114] GGCCCAGCAGTGGCGCGATGCACGCCCTAAAGTGGCAGGCCTGC ATCTGGATAGTGGTGCCTGCAGCCGCCAGAGCTTTGCCGTGATTGATGCCAC

[0115] CACCGCACATGCACGCCATGAAGCCGAAGTTGGCGGTTATGTTGCAGC AGAAGCAGCCACCCC GGCCCTGGATGCCGGTAGAGCAGCCGTTC CA

[0116] GTCTGATTGGTTTTGCAGCAAGTGATGTGGTTTATACCAGCGGTAGCAATCATGCCAT TGATCTGCTGCTGAGTAGTTGGCCGGGTAAACGTACCCTGGCA

[0117] TGCCTGCCGGGTGAATATGGTCCGAACTGAGTGCAATGGCCGCAAATGGTTTTC AGGTGC GCACCGCCGGTTGATGATGATGGTCGC GTGCTGGTT

[0118] GATGAAGCAAGTCATGAACCGAGCGCCCATCCGGTTGCACCGGTTCATCTGACC GCACCGGCCAGTCATCGTGGCATTGCCGAGCCGGCCGAGAAC

[0119] TGATCGGTTGAGCGCCATGATGCCGGTTATTCCGGTTGTGATTGATGCAGCACAGGCCCTGGGCC ATCTGGATCGTAATGTTGGTGCAGATGCAGTTTATAGT

[0120] AGTAGTCGCAAATGGCTGGCCGGTCCGCGCGGC GTTGGTGTTCTGGCTGTGCGCCCGGAAC TGGCCGAACGTCTGCAGCCGCGTATTCCGCCGAGC

[0121] GATTGGCCGATTCCGATGAGTGTGCTGGAAAACTGGAAC TGGGTGAACATAATGCCGCCGCACGC GTGGGTTTCTGGTGGCCGTGGCGAACATCT

[0122] GGCCGCAGGTCCGACC GCCGTGC GTGAACGTCTGGCAGAAGTTGGTCGTCTGAGCCGTCAGGTGCTGGCCGAAGTTGATGGTTGGCGCGTGGTTGA

[0123] ACCAGTTGATCAGCCGACCACAATTACCACCCTGGAAAGCACC GATGGTGCA GATCCGGCCAGCGTGC GCAGTTGGCTGATTGCCGAACGCAGTATT

[0124] GTGACCACC GCGTGTGAAC TGGCCC GCACCGTTTGAAATGC GCACCCC GGTGCTGC GCATTAGTCCGCGTGTGATGTGACC GTTGATGAAC TGG

[0125] ACAGTTTGCAGCCGCCCTGC GTGAAGCCCCGC ATCATCATCATCATCATCAT AAAAGCTTGC GGCCGCAC TCGAGCACCACCACCACCACCACC ACTGAGAT

[0126] GCTGCTGCTA ACAAGCCCGA AAGGAAGCTG AGTTGGCTGC TGCCACC GCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGA

[0127] GGGTTTTTTT GCTGAAAGGA GGAACTATAT CC GGA T

[0128] Construction and transformation of recombinant plasmid pET28a-egt12 of Example 2

[0129] Construction of recombinant plasmid pET28a-egt12: Taking pET28a as the vector, the gene cluster egt12 was chemically synthesized according to the egt1 gene and the egt2 gene, which was completed by Jiandian Gene Technology (Tianjin) Co., Ltd., thereby obtaining the recombinant plasmid pET28a-egt12. The GeneID of egt1 is 3872471, and the protein ID of egt2 is CCE33140.1 (SEQ ID NO. 6).

[0130] Transformation of recombinant plasmid pET28a-egt12: 2 μl (100 μg / ml) of the recombinant plasmid pET28a-egt12 was added to a centrifuge tube containing E. coli DH5α or JM109 competent cells that had been melted in an ice bath, and the tube wall was tapped to mix, and ice bathed for 30 min. 42°C heat shock for 60 s, and then immediately ice bathed for 5 min (this process should not be moved). Under sterile conditions, 900 μL of LB medium was added to the centrifuge tube, and after mixing by blowing, it was cultured at 37°C, 180 r / min for 45 min. The centrifuge tube was centrifuged at 10000 r / min for 1 min, 900 μL of supernatant was removed, and the remaining liquid was mixed by blowing with a pipette and plated on a LB solid plate containing 50 μg / mL kanamycin. The LB plate was cultured at 37°C overnight until single colonies were clearly visible. The primers egt12-F / egt12-R (see Table 1 for primer sequences) were designed, and positive transformants were picked for colony PCR verification, obtaining the strains E. coli DH5α egt12 or E. coli JM109 egt12. After the verified transformants were inoculated in LB liquid medium and cultured overnight, the plasmid was extracted and sequenced for further verification, and the correct verification was obtained as the recombinant plasmid pET28a-egt12. The plasmid map of the recombinant plasmid pET28a-egt12 is shown in Figure 3 , and the nucleotide sequence of the recombinant plasmid pET28a-egt12 is as follows.

[0131] pET28a-egt12 (SEQ ID NO. 25):

[0132]

[0133] taccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggg

[0134] gggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaag

[0135] ggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatag

[0136] tcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggccttttta

[0137] cggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgct

[0138] cgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtattt

[0139] cacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggctg

[0140] cgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagct

[0141] gcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcc

[0142] tgttcatccgcgtccagctcgttgagtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactg

[0143] atgcctccgtgtaagggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgccc

[0144] ggttactggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatac

[0145] agatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagactttacg

[0146] aaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtatcggtgattcattctg

[0147] ctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggggccgccatgccggcgataatg

[0148] gcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccgcaagcgacaggccgat

[0149] catcgtcgcg ctccagcga aagcggtcc tcgccgaaa atgacccag agcgctgcc ggcacctgtc ctacgagtt gcatgataa agaagacag tcat

[0150] aagtgcggcg acgatagtc atgccccgc gcgccaccg gaaggagct gactgggtt gaaggctct caagggcat cggtcgaga tcccggtgc ctaat

[0151] gagtgagcta acttacatta attgcgttg cgctcactg cccgctttc cagtcggga aacctgtcg tgccagctg attaatgaa tcggccaacg cgcgg

[0152] ggagaggcgg tttagcgtat tgggcgccag ggtggtttt tcttttcac cagtgagacg ggcaacagct gattgccct tcaccgcctg gccctgaga gagt

[0153] tgcagcaagc ggtccacgc tggtttgccc cagcaggcg aaaatcctg tttgatggtg gttaacggc gggatataa catgagctg tcttcggtat cgtcg

[0154] tatcccacta ccgagatat ccgcaccaa cgcgcagccc ggactcggta atggcgcgc attgcgcccc agcgccatc tgatcgttg caaccagca tcg

[0155] cagtgggaac gatgccctca ttcagcattt gcatggtttg ttcgaaaccg gacatggca ctccagtcg ccttcccgtt cgctatcgg ctgaatttg attg

[0156] cgagtgagat atttatgccg ccagccagc agacgcagac gcgccgagac agaacttaat ggcccgcta acagcgcga tttgctggt gacccaatg cg

[0157] GCGGCCGCTCTAGA TTAATCGAGCTGCAGAATTCGATATTAATAG GCGGCCGC

[0158] GCGGCCGCTCTAGA TTAATCGAGCTGCAGAATTCGATATTAATAG GCGGCCGC

[0159] GCGGCCGCTCTAGA TTAATCGAGCTGCAGAATTCGATATTAATAG GCGGCCGC

[0160] GCGGCCGCTCTAGA TTAATCGAGCTGCAGAATTCGATATTAATAG GCGGCCGC

[0161] GCGGCCGCTCTAGA TTAATCGAGCTGCAGAATTCGATATTAATAG GCGGCCGC

[0162] GCGGCCGCTCTAGA TTAATCGAGCTGCAGAATTCGATATTAATAG GCGGCCGC

[0163] GCGGCCGCTCTAGA TTAATCGAGCTGCAGAATTCGATATTAATAG GCGGCCGC

[0164] GCGGCCGCTCTAGA TTAATCGAGCTGCAGAATTCGATATTAATAG GCGGCCGC

[0165] gtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccgg

[0166] cgtagaggatcgagatctcgatcccggaaattaatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactt

[0167] taagaaggagatataagcaggatccatgccaagtgctgaatctatgacaccctcaagcgcattgggtcaattgaaggcgaccggtcaacatgtgctct

[0168] ccaagcttcaacagcagaccagcaacgccgatatcattgacatccgtcgtgttgcggttgaaatcaatctgaagaacggagatcaccagcatgtttcgtc

[0169] cgaaagatggtccgcgccaactgccgaccttgcttctgtacaatgaacgcggtctgcaactcttcgagaggatcacctacttggaagaatattacctca

[0170] cgaacgatgagattaaaattctgacgaaacacgctactgaaatggcatcctttatccgagcggcgcaatgatcatcgagttaggcagcggcaatctgc

[0171] gcaaggtgaacctgttgctggaagcgttggacaacgcgggtaaagcgatcgactactatgcattagacttgagccgtgaagagctggaacgtactttt

[0172] gctcaagttccatcctataaaacacgtaaaatgccacggcttactgggaacctacgacgacggccgtgattggctgaaggccccccgagaacaattaacaa

[0173] gcaaaaatgtatccttcacttgggctcatcgattggtaactttaaccgtagcgacgctgcaacctttttgaagggcttcaccgatgttctcggtccgaatga

[0174] taaaatgctgatcggcgtcgatgcgtgtaatgacccggcgcgtgtttaccatgcgtataatgacaaggtgggtataacccacgaatttattctgaatggtc

[0175] tgcgcaatgctaacgagatcattggggaaaccgctttcatcgagggtgattggcgtgttattggcgaatacgtgtacgatgaagagggtggccgtcatc

[0176] aggcgttttatgctccgacccgtgacaccatggttatgggtgaactgattcgtagccatgatcgtatccagattgaacagtccctgaagtattcgaaaga

[0177] agagtcagaacgactgtggagcaccgcaggcctggaacaggttagcgagtggacctacggcaacgagtacggtctccacctgctggcgaagagc

[0178] cgtatgagctttagcctgatcccgtcggtgtatgcgcgtagtgcattgcctactctggacgactgggaagctctgtgggcaacctgggatgtggtcacc

[0179] cgtcagatgctgccgcaggaggagctcttggaaaaaccgatcaaactgcgcaacgcctgcattttctacctgggtcacatcccgacgttcctggatatc

[0180] cagctgaccaaaaccaccaaacaggcgccctccgagccggcgcacttttgcaaaatcttcgagcgcggcatcgacccggatgttgataatccggag

[0181] CtGtGccAtGcGcAtAgCgAaAtCcCgAtGAtGgcCcCcGgTgGcAgAaAtCcTtAcCtAcCgAgAcAgTcCgTtCtCgTtGcGcGtCtGtAc

[0182] CtGtGccAtGcGcAtAgCgAaAtCcCgAtGAtGgcCcCcGgTgGcAgAaAtCcTtAcCtAcCgAgAcAgTcCgTtCtCgTtGcGcGtCtGtAc

[0183] CtGtGccAtGcGcAtAgCgAaAtCcCgAtGAtGgcCcCcGgTgGcAgAaAtCcTtAcCtAcCgAgAcAgTcCgTtCtCgTtGcGcGtCtGtAc

[0184] CtGtGccAtGcGcAtAgCgAaAtCcCgAtGAtGgcCcCcGgTgGcAgAaAtCcTtAcCtAcCgAgAcAgTcCgTtCtCgTtGcGcGtCtGtAc

[0185] CtGtGccAtGcGcAtAgCgAaAtCcCgAtGAtGgcCcCcGgTgGcAgAaAtCcTtAcCtAcCgAgAcAgTcCgTtCtCgTtGcGcGtCtGtAc

[0186] CtGtGccAtGcGcAtAgCgAaAtCcCgAtGAtGgcCcCcGgTgGcAgAaAtCcTtAcCtAcCgAgAcAgTcCgTtCtCgTtGcGcGtCtGtAc

[0187] CtGtGccAtGcGcAtAgCgAaAtCcCgAtGAtGgcCcCcGgTgGcAgAaAtCcTtAcCtAcCgAgAcAgTcCgTtCtCgTtGcGcGtCtGtAc

[0188] CtGtGccAtGcGcAtAgCgAaAtCcCgAtGAtGgcCcCcGgTgGcAgAaAtCcTtAcCtAcCgAgAcAgTcCgTtCtCgTtGcGcGtCtGtAc

[0189] GAGCGAAACCCCGGC G GAAAGCTCCTCCCCGTCTGATAGCAATACCACGCTGATTACTACTGAGGATCTGTTCTCCGACCTGGATG GTGC GAACGTT

[0190] GAGCGAAACCCCGGC G GAAAGCTCCTCCCCGTCTGATAGCAATACCACGCTGATTACTACTGAGGATCTGTTCTCCGACCTGGATG GTGC GAACGTT

[0191] GAGCGAAACCCCGGC G GAAAGCTCCTCCCCGTCTGATAGCAATACCACGCTGATTACTACTGAGGATCTGTTCTCCGACCTGGATG GTGC GAACGTT

[0192] GAGCGAAACCCCGGC G GAAAGCTCCTCCCCGTCTGATAGCAATACCACGCTGATTACTACTGAGGATCTGTTCTCCGACCTGGATG GTGC GAACGTT

[0193] GAGCGAAACCCCGGC G GAAAGCTCCTCCCCGTCTGATAGCAATACCACGCTGATTACTACTGAGGATCTGTTCTCCGACCTGGATG GTGC GAACGTT

[0194] GAGCGAAACCCCGGC G GAAAGCTCCTCCCCGTCTGATAGCAATACCACGCTGATTACTACTGAGGATCTGTTCTCCGACCTGGATG GTGC GAACGTT

[0195] GAGCGAAACCCCGGC G GAAAGCTCCTCCCCGTCTGATAGCAATACCACGCTGATTACTACTGAGGATCTGTTCTCCGACCTGGATG GTGC GAACGTT

[0196] GAGCGAAACCCCGGC G GAAAGCTCCTCCCCGTCTGATAGCAATACCACGCTGATTACTACTGAGGATCTGTTCTCCGACCTGGATG GTGC GAACGTT

[0197] ccagagacagaaggtcaactgggtccacgtaaagaacccgaacacaaacttgaggcggaaagcgaaccgctccaagaaactccgcagcgtgaag

[0198] tcctggcgtttggccgtgcttggaaatctgagttcctgttcgatccggcatggcgtaacctgaaccacggcagcttcggcacctacccgctttacatccg

[0199] tgacaagctgagagcttatcaggaccaggcagaagcgcgtccggatcattttatccgttacgaggaatcaaaattactgcatcgtagccgcgcggcg

[0200] gtggctaaaatcgtgaatgccccgttggacaccgtcgtgttcgtgggtaacgccaccgaaggcgtgaacaccgtgctgcgtaatctgagatgggata

[0201] gcctggagaagggtggtcaaaaagatgtcatcctgtcgttcagcacggtttatgaggcgtgtggcaacgcggcagactacatcgttgagtacttcgca

[0202] ggtaaagtggagcaccgtaccattgaactggagtacccggtcgaagacgctgatgttattgctgctttacgcggagcggctacccaggttgcccgcg

[0203] agggcaagcgcgcgcgtttggcaatgatggatgttgtgaccagccgtccgggcgttgtctttccgtgggaggctgcggttcgtgtttgccgtgagctg

[0204] ggcattttgtccctggtggacggtgcccagggtgttggtatggttcgtttggacctaaccgcagctgacccggacttctttgttagcaattgccataagtg

[0205] GCTGCTGGTACCAGCGGGGTGCGCTATGCTGTACACCCCAGCAAGAATC AATGTCTGCTCCGGACCGCGTTGGCCACCTCCCATGGTTATGTCCCAGC

[0206] CTAGTGCGGCGCCGGCGCCTCCGGGTTCGAAGAGCCGCTACGTTCGAA TTTTGAATTTGTCGGCACCA GGGATAATGGTCCGTATCTATGCGTAGCG

[0207] GATGCCATCGC GTGGCGTGAACGC GTGTGCGGT GGC GAAGAGAAC ATCTCCGCT ATCTGTGGGC ATTTGATAAAAAAGGC ATC GTATCGTGGCCCG

[0208] TGCAC TGGGTACGACC CACCTGGACAACGAAACC GAAACGCTGACGAAC TGCGCCATGGGTAACGTAGCTTTGCCGATGC GTGTGGACGACGAAG

[0209] ATGCCTCTACGGCGCTGGACGC GGC GCCGTCTGCAGCGATTGC GGC GCCAGACGTGTGTGGTGGCTCGTGAGAACGTGGCCTTGGTTGACAAGTGGAT

[0210] GC GTGAGCGTCTGTTTGATGATTACAAGACCTT CATGACCTT GTTCGT CATGCAGGATCGTTACTGGGTTCGTTTGTCCGC GCAGATTTATTTGGACGAGCAG

[0211] GATTATGAAGCTGC GGGTGATATCCTCAAGGCGCTGTGTGAACGCA TCAGACGCCGTGAGTATCTGGTTCCGCAACCGGTGGAGCATCATCATCATCAT

[0212] C ACTAAGCGGCCGC ACTCGAGCACCACCACCACCACCACCGGTATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACC GC

[0213] TGGGGCCTCTAAACGGGTCTTGA GGGGTTTTTTGCTGAAAGGAGGAAC TATATCCGGAT

[0214] Construction of recombinant plasmid pET28a-egtBDE-egt1 and transformation

[0215] Obtaining of egt1 fragment: enzyme cutting sites were introduced at both ends of egt1 gene, primer egt1-FF1 / egt1-RR1 (see Table 1 for primer sequence) was designed, egt1 amplification fragment was obtained by PCR technology, and the amplified egt1 fragment was purified and recovered by using gel recovery kit (Tianjin Zixi Biological Technology Co., Ltd.). PCR reaction system: 2 x phanta max buffer 10 μL, dNTP mixture (10 mM) 0.4 μL, pET28a-egt12 plasmid constructed as template, template 0.4 μL (20 ng / μl), egt1-FF1 primer (10 μM) 0.8 μL, egt1-RR1 primer (10 μM) 0.8 μL, DMSO 0.4 μL, phanta max x Super Fidelity DNA Polymerase 0.4 μL, and supplemented with ultrapure water to 20 μL. PCR reaction conditions: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 56 °C annealing for 15 s, 72 °C extension for 120 s, denaturation, annealing and extension for 30 cycles; 72 °C extension for 5 min; 4 °C to end the reaction.

[0216] Construction of recombinant plasmid pET28a-egtBDE-egt1: pET28a-egtBDE was digested with DNA restriction endonuclease at enzyme cutting sites NotI and XHOI, the enzyme digestion conditions were 37 °C for 30 min, and then the vector linear fragment was obtained by using purification and recovery kit (Tianjin Zixi Biological Technology Co., Ltd.). The amplified egt1 fragment and the double-digested pET28a-egtBDE vector linear fragment were connected by homologous recombination by using one-step cloning method, thereby obtaining the recombinant plasmid pET28a-egtBDE-egt1.

[0217] Transformation of recombinant plasmid pET28a-egtBDE-egt1: 2 μl (100 μg / ml) of recombinant plasmid pET28a-egtBDE-egt1 was added to centrifuge tubes containing E. coli DH5α or JM109 competent cells that had been thawed in an ice bath, the tube was flicked, mixed, and placed in an ice bath for 30 min. The tubes were heat shocked at 42°C for 60 s, and then immediately placed in an ice bath for 5 min (do not move during this process). 900 μL of LB medium was added to the centrifuge tubes under sterile conditions, mixed by flicking, and then incubated at 37°C with shaking at 180 r / min for 45 min. The centrifuge tubes were centrifuged at 10,000 r / min for 1 min, 900 μL of supernatant was removed, and the remaining liquid was mixed by flicking with a pipette and spread onto LB solid plates containing 50 μg / mL kanamycin. The LB plates were incubated at 37°C overnight until single colonies were clearly visible. Primers egt1-F / egt1-R (see Table 1 for primer sequences) were designed, and positive transformants were selected for colony PCR verification to obtain strains E. coli DH5α egtBDE-egt1 or E. coli JM109 egtBDE-egt1. The correct transformants were inoculated into LB liquid medium and incubated overnight, and the plasmids were extracted and sequenced for further verification. The correct verification obtained the recombinant plasmid pET28a-egtBDE-egt1. The plasmid map of recombinant plasmid pET28a-egtBDE-egt1 is shown in Figure 1, and the nucleotide sequence of recombinant plasmid pET28a-egtBDE-egt1 is as follows. Figure 4

[0218] pET28a-egtBDE-egt1 (SEQ ID NO. 26):

[0219] ​

[0220] ctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggggccgccatgccggcgataatg

[0221] gcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccgcaagcgacaggccgat

[0222] catcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcat

[0223] aagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggttgaaggctctcaagggcatcggtcgagatcccggtgcctaat

[0224] gagtgagctaacttacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcgg

[0225] ggagaggcggtttgcgtattgggcgccagggtggtttttcttttcaccagtgagacgggcaacagctgattgcccttcaccgcctggccctgagagagt

[0226] tgcagcaagcggtccacgctggtttgccccagcaggcgaaaatcctgtttgatggtggttaacggcgggatataacatgagctgtcttcggtatcgtcg

[0227] tatcccactaccgagatatccgcaccaacgcgcagcccggactcggtaatggcgcgcattgcgcccagcgccatctgatcgttggcaaccagcatcg

[0228] cagtgggaac gatgccctca ttcagcattt gcatggtttg ttgaaaacca ggacatggca ctccagtcgc cttcccgttc cgctatcggc tgaatttgat tg

[0229] cgagtgagat atttatgccagccagccagacgcagacgcgccgagacagaacttaatgggcccgctaacagcgcgatttgctggtgacccaatgcg

[0230] accagatgct ccacgcccag tcgcgtaccg tcttcatggg agaaaataat actgttgatg ggtgtctggt cagagacatc aagaaataac gccggaac

[0231] attagtgcag gcagcttcca cagcaatggc atcctggtc atccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagattgtgcaccg

[0232] ccgctttaca ggcttcgacg ccgcttcgtt ctaccatcgacaccaccacgctggcacccagttgatcggcgcgagatttaatcgccgcgacaatttgcg

[0233] acggcgcgtg cagggccaga ctggaggtgg caacgccaat cagcaacgac tgtttgcccg ccagttgttg tgccacgcgg ttgggaatgt aattca

[0234] gctccgccat cgccgcttcc actttttccc gcgttttcgc agaaacgtgg ctggcctggt tcaccacgcg ggaaacggtc tgataagaga ccaccggca

[0235] tactctgcgacatcgtataacgttactggtttcacattcaccaccctgaattgactctcttccgggcgctatcatgccataccgcgaaaggttttgcgccatt

[0236] cgatggtgtccgggatctcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcaccgccgccgcaa

[0237] ggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaa

[0238] gtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccgg

[0239] cgtagaggatcgagatctcgatcccggaaattaatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactt

[0240] taagaaggagatataagcaggatccatggccgctaccgccgctctgcgtagcggtgatacccgtgcccagaccgccgcagcatttccgccgcctcc

[0241] ggtgaccgcccgtcctattgatcgtgccgcatggattgccgcatttcgctttgtgcgtagcgaaaccgaacgccgcgcagcaccgctgagcgcagaa

[0242] gatcagcaggtgcagagcatggcagatgcaagcccgaccaaatggcatcgtgcacatgttacctggttttttgaacagtttctgctgcgcgaaacatctg

[0243] ccgggttatgcaatttatgatgaacgcctgcattatctgtttaatagttattatgtggccgcaggcccgcgtcagccgcgtattcagcgtggtatgattacc

[0244] cgtccgaccatggcagaagttaccgcctatcgcgcacatgtggatcgtgcagtggaaagtctgctgggccaggccgccgatggcgctttagaagca

[0245] gttctgccgattctggaaattggtctgtatcatgaacagcagcatcaggaactgctgctgaccgatattctgcatgcatttgcacagaatccgctgggtcc

[0246] ggtttatgatgcagaatggcgttttccggccgtggccggccagggtggtcaggcacctctggctcgcggcattgcatggattggtcatgaaggcgatg

[0247] gttttagctttgataatgaaagtccgcgtcatgaagcactgattctgccgggtcgcattgataaagcactggtgaccaatcgtgattggctgggctttatg

[0248] gaagcaggcggttatgccaaaccggaactgtggctgagcgatggctggtatgccggtcaggccgaaggttgggaagcaccgggttattggcgccg

[0249] tgatggtgaaggctgggccaccatgaccctgggtggtgttcgtccggttgaactggatgcaccggtgacccatattagttattatgaagcagatgcctat

[0250] gcccgctgggccggccgtaccttaccgacagaatttgaatgggaagtggccgcccgtgatggtgccctgccggatgcatttggtctggtgtggcagt

[0251] ggacccgtagcgcctatgttgcctatccgggttatcgtccgctgccgggcgcactgggtgaatataatggtaaatttatggtgagtcagttcgttctgcgt

[0252] ggtagtagtgtggcaaccccggaaggccatgcccgcctgccttatcgtaattttttttatccgcatcagcgttggcagtttaccggtctgcgcctggccg

[0253] atgtggcccatcatcatcatcatcactaattaagaaggagatataagcaggatcatgaccctgagcctggccaattatctggccgcagatagcgccgcc

[0254] gaagccctgcgtcgtgatgttcgtgcaggtctgaccgcagcaccgaaaagcctgccgccgaaatggttttatgatgccgtgggcagtgatctgtttgat

[0255] cagattacccgtctgccggaatattatccgacccgcaccgaagcccagattctgcgtacccgtagcgcagaaattattgccgccgcaggtgccgatac

[0256] cctggtggaactgggtagcggcaccagcgaaaaaacccgcatgctgctggatgcaatgcgtgatgcagaactgctgcgtcgttttattccgtttgatgt

[0257] ggatgcaggtgttctgcgcagtgccggcgcagccattggtgccgaatatccgggtattgaaattgatgcagtgtgcggtgattttgaagaacatctggg

[0258] taaaattccgcatgttggccgtcgtctggtggtgtttctgggcagtaccattggtaatctgaccccggccccgcgcgccgaatttctgagcaccctggca

[0259] gataccctgcagccgggtgatagcctgctgctgggcaccgatctggttaaagataccggccgcctggtgcgcgcatatgatgatgcagccggtgtga

[0260] ccgcagcatttaatcgtaatgtgctggccgttgttaatcgtgaactgagcgccgattttgatctggatgcatttgaacatgtggccaaatggaatagcgat

[0261] gaaacgcattgaaatgtggctgcgcgcacgtaccgcacagcatgtgcgtgttcagcactggatctggaagttgatttgccgcaggcgaagaaa

[0262] tgctgaccgaagttagttgcaaatttcgccccggaaaatgttgttgcagaactggcagaagcaggcctgcgccagacccattggtggaccgatccggc

[0263] cggcgattttggcctgagcctggcggttcgtcatcatcatcatcatcactaaggcgaatgctagcataaccccttggggcctctaaacgggtcttgagg

[0264] ggttttttggaaattaatacgactcactataggggaattgtgagcggataacaattcccatactgctgttaagaaggagatataccgaaggacgtgatgct

[0265] ggcccagcagtggcgcgatgcacgccctaaagtggcaggcctgcatctggatagtggtgcctgcagccgccagagctttgccgtgattgatgccac

[0266] caccgcacatgcacgccatgaagccgaagttggcggttatgttgcagcagaagcagccaccccggccctggatgccggtagagcagccgttgcca

[0267] gtctgattggttttgcagcaagtgatgtggtttataccagcggtagcaatcatgccattgatctgctgctgagtagttggccgggtaaacgtaccctggca

[0268] TGCCTGCCGGGTGATAATGGTCCGAACTCGAGTGCAATGGCCGCAAATGGTTTTCAGGTGC

[0269] GATGAAGCAAGT CATGAAC TGAGCGCCCATCCGGTTGC ACTGGTT CATCTGACC GC ACTGGCCAGT CATCGTGGC AT TGCCCAGCCGGCCGCAGAAC

[0270] TG GTT GAAGCCTGCCATAATGCCGGTATTCCGGTTGTGATTGATGCGGCACAGGCCCTGGGCC ATCTGGATTGTAATGTTGGTGCAGATGCAGTTTATAGT

[0271] AGTAGTCGCAAATGGCTGGCCGGTCCGCGCGGC GTTGGTGTTC TGGCTGTGC CCCGGAAC TGGCCGAACGTCTGCAGCCGC GTATTCCGCCGAGC

[0272] GATTGGCCGATTCCGATGAGTGTGCTGGAAAACTGGAAC TGGGTGAACATAATGCCGCCGCACGC GTGGGTTTTAGTGTGGCCGTTGGCGAACATCT

[0273] GGCCGCAGGTCCGACC GCCGTGC GTGAACGTCTGGCAGAAGTTGGTCGTCTGAGCCGTCAGGTGCTGGCCGAAGTTGATGGTTGGCGCGTGGTTGA

[0274] ACC GGT TGATC AGCC GACC GCAATTACC ACCCTGGAAAGCACC GATGGTG CAGATCCGGCCAGC GTGC GCAGTTGGCTGATTGCCGAACGC GGTATT

[0275] GTGACCACC G CATGTGAACTGGCCC GCACCGTTTTGAAATGC GCACCCCGGTGCTGC GCATTAGTCCG CATGTTGATGTGACC GTTGATGAAC TGG

[0276] acagtttgcagccgccctgcgtgaagccccgcatcatcatcatcatcactaaaagcttgcggccgcttaagaaggagatataagcaggatccatgcca

[0277] agtgctgaatctatgacaccctcaagcgcattgggtcaattgaaggcgaccggtcaacatgtgctctccaagcttcaacagcagaccagcaacgccg

[0278] atatcattgacatccgtcgtgttgcggttgaaatcaatctgaagacggagatcaccagcatgtttcgtccgaaagatggtccgcgccaactgccgacctt

[0279] gcttctgtacaatgaacgcggtctgcaactcttcgagaggatcacctacttggaagaatattacctcacgaacgatgagattaaaattctgacgaaacac

[0280] gctactgaaatggcatcctttattccgagcggcgcaatgatcatcgagttaggcagcggcaatctgcgcaaggtgaacctgttgctggaagcgttgga

[0281] caacgcgggtaaagcgatcgactactatgcattagacttgagccgtgaagagctggaacgtactttggctcaagttccatcctataaacacgtaaaatg

[0282] ccacggcttactgggaacctacgacgacggccgtgattggctgaaggcccccgagaacattaacaagcaaaaatgtatccttcacttgggctcatcga

[0283] ttggtaactttaaccgtagcgacgctgcaacctttttgaagggcttcaccgatgttctcggtccgaatgataaaatgctgatcggcgtcgatgcgtgtaat

[0284] GACCCGGCGC GTTTACCATG CGTATAATGA CAAGGTGGGT ATAACCCACG AATTTCCTCT GAAATGGTCT GCGCAATGCT AACGAGATCA TTGGGGAA

[0285] ACCCTTTCAT CGAGGGTGAT TGGCGTGTTA TTGGCGAATA CGTGTACGAT GAAGAGGGTG GCCGTTCATC AGCGTTTTTA TGCTCCGACC CGTGACACCC

[0286] ATGGTTATGG GTGAACCGTA TTCGTAGCCA TGATCGTATC CAGATTGAAC AGTCCCTGAA GTATTCGAAA GAAGAGTCAG AACGACTGTG GAGCACCGCA

[0287] GGCCTGGAAC AGGTTCGCGA GTGGACCTAC GGCAACGAGT ACGGTCTCCA CCTGCTGGCG AAGAGCCGTA TGAGCTTTAG CCTGATCCCG TCGGTGT

[0288] ATGCAGCGTA GTGCATCGCC TACTCTGGAC GACTGGGAAG CTCTGTGGGC AACCCTGGGA TGTGGTCACC CGTCAGATGC TGCCGCAAGG AGGAGCTCTT

[0289] GGAAGAACCG ATCAAACCGC GCAACGCCTG CATTTCCTAC CTGGGTCACA TCCCGACGTT CCTGGATATC CAGCTGACCA AAACCAACAA CAGGC

[0290] CCTCCGAGCC GCGCCTTTTG CAAAATCTTC GAGCGCGGCA TCGACCCGGA TGTGATAATC CGGAGCTGTG CCATGCATAG CGAAATCCCA GAT

[0291] GAAATGGCCT CCGGTGGAAG AAATCTTACC TACCAGGAAC AGTCCGTTCT CGTTTGCACG GTCTGTACGC GCATGGGATC GCCAATATCC CGCGAAT

[0292] gtgggccgcgcaatttgggtcggtttcgagcacgagttaatgcatattgagacgctgttatacatgatgctgcagagcgataaaaccttgattccgaccc

[0293] atattccgcgccctgacttcgacaagctcgcacgcaaggcggaatctgagcgcgtgccaaaccagtggtttaaaatcccggcgcaagagattacgat

[0294] cggtttggacgatccggaagacggctctgacatcaacaagcactatggttgggacaacgagaagccgccgcgcagagtgcaggttgcagcgtttca

[0295] ggcgcaaggtcgtccgattaccaatgaggaatacgcacaatatctactggaaaagaacattgacaagctgcctgcgtcctgggcccgtctggacaac

[0296] gaaaatatcagcaacggcaccaccaatagcgtctccggccatcattctaacagaacctcgaagcaacaactgccgtcctctttcttagaaaaaacggct

[0297] gttagaaccgtgtacggccttgtgccgctgaagcacgcgctggattggccggtttttgcaagctatgacgagctagcgggttgcgcagcgtacatggg

[0298] cggcagaattccgacctttgaggagacgcgttctatctacgcgtacgctgacgccctgaagaaaaaaaaagaggctgagcgtcagctgggccgtac

[0299] ggtgccggcggtgaacgcccacctgacgaacaacggtgttgagattaccccgccaagttcaccgtcgagcgaaaccccggcggaaagctcctccc

[0300] cgtctgatagcaataccacgctgattactactgaggatctgttctccgacctggatggtgcgaacgttggtttccacaattggcacccgatgccgatcac

[0301] cagcaaaggcaacaccctggtcggccagggtgaattggggggggtgtgggaatggaccagcagcgtactgcgtaaatgggagggcttcgagccg

[0302] atggaactgtacccgggttataccgccgacttcttcgatgagaagcacaacattgtgctgggtggtagctgggccacgcacccgcgcatcgcgggtc

[0303] gcaagagcttcgttaactggtatcagcgtaactatccgtatgcttgggttggcgcgcgtgtggttcgtgaccttcatcatcatcatcatcactaactcgagc

[0304] accaccaccaccaccactgagatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataacccc

[0305] ttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat

[0306] Construction of recombinant plasmid pET28a-egtBDE-egt2 and transformation

[0307] Obtaining of egt2 fragment: enzyme cutting sites were introduced at both ends of egt2 gene, primer egt2-FF2 / egt2-RR2 (see Table 1 for primer sequence) was designed, and egt2 amplification fragment was obtained by PCR technology, and the amplified egt2 fragment was purified and recovered by gel recovery kit (Tianjin ZOOM-Lab Biotechnology Co., Ltd.). PCR reaction system: 2 x phanta max buffer 10 μL, dNTP mixture (10 mM) 0.4 μL, constructed pET28a-egt12 plasmid as template, template 0.4 μL (20 ng / μl), egt2-FF2 primer (10 μM) 0.8 μL, egt2-RR2 primer (10 μM) 0.8 μL, DMSO 0.4 μL, phanta max x Super Fidelity DNA Polymerase 0.4 μL, and supplemented with ultrapure water to 20 μL. PCR reaction conditions: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 63 °C annealing for 15 s, 72 °C extension for 80 s, denaturation, annealing and extension for 30 cycles; 72 °C extension for 5 min; 4 °C to end the reaction.

[0308] Construction of recombinant plasmid pET28a-egtBDE-egt2: the plasmid pET28a-egtBDE was digested with DNA restriction endonuclease at enzyme cutting sites NotI and XHOI, the enzyme digestion conditions were 37 °C for 30 min, and then the vector linear fragment was obtained by using purification and recovery kit (Tianjin ZOOM-Lab Biotechnology Co., Ltd.). The amplified egt2 fragment and the double-digested pET28a-egtBDE vector linear fragment were connected by homologous recombination by one-step cloning method, thereby obtaining the recombinant plasmid egtBDE-egt2.

[0309] Transformation of recombinant plasmid pET28a-egtBDE-egt2: 2 μl (100 μg / ml) of recombinant plasmid pET28a-egtBDE-egt2 was added to centrifuge tubes containing E. coli DH5α or JM109 competent cells that had been thawed in an ice bath, the tube was flicked, mixed, and placed in an ice bath for 30 min. The tubes were heat shocked at 42°C for 60 s, and then immediately placed in an ice bath for 5 min (do not move during this process). Under sterile conditions, 900 μl of LB medium was added to the centrifuge tubes, mixed by flicking, and then incubated at 37°C with shaking at 180 r / min for 45 min. The centrifuge tubes were centrifuged at 10,000 r / min for 1 min, 900 μl of supernatant was removed, the remaining liquid was mixed by flicking with a pipette, and then spread onto LB solid plates containing 50 μg / ml kanamycin. The LB plates were incubated at 37°C overnight until single colonies were clearly visible. Primers egt2-F / egt2-R (see Table 1 for primer sequences) were designed, and positive transformants were selected for colony PCR verification to obtain strains E. coli DH5α egtBDE-egt2 or E. coli JM109 egtBDE-egt2. The correct transformants were inoculated into LB liquid medium and incubated overnight, and then plasmids were extracted and sequenced for further verification. The correct verification obtained the recombinant plasmid pET28a-egtBDE-egt2. The plasmid map of recombinant plasmid pET28a-egtBDE-egt2 is shown in Figure 5 The nucleotide sequence of recombinant plasmid pET28a-egtBDE-egt2 is as follows.

[0310] pET28a-egtBDE-egt2 (SEQ ID NO. 27):

[0311]

[0312] tgttcatccgcgtccagctcgttgagtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactg

[0313] atgcctccgtgtaagggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgccc

[0314] ggttactggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatac

[0315] agatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagactttacg

[0316] aaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtatcggtgattcattctg

[0317] ctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggggccgccatgccggcgataatg

[0318] gcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccgcaagcgacaggccgat

[0319] catcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcat

[0320] aagtgcggcg acgatagtca tgccccgcgc ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcgag atcccggtgc ctaat

[0321] gagtgagcta acttacatta attgcgttgc gctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg

[0322] ggagaggcgg tttgcgtatt gggcgccagg gtggtttttc ttttcaccag tgagacgggc aacagctga ttgcccttca ccgcctggcc ctgagagagt

[0323] tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa atcctgtttg atggtggtta acggcggga tataacatga gctgtcttcg gtatcgtcg

[0324] tatcccacta ccgagatatc cgcaccaacg cgcagcccgg actcggtaat ggcgcgcatt gcgcccagcg catctgatcg ttggcaacca gcatcg

[0325] cagtgggaac gatgccctca ttcagcattt gcatggtttg ttcgaaacca ggacatggca ctccagtcgc cttcccgttc cgctatcggc tgaatttgat tg

[0326] cgagtgagat atttatgcca gccagccagc agacgcagac gcgccgagac agaacttaat ggcccgctaa cagcgcgatt tgctggtga ccaatgcg

[0327] accagatgct ccacgcccag tcgcgtaccg tcttcatggg agaaaataat actgttgatg ggtgtctggt cagagacatc aagaaataac gccggaac

[0328] attagtgcaggcagcttccacagcaatggcatcctggtcatccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagattgtgcaccg

[0329] ccgctttacaggcttcgacgccgcttcgttctaccatcgacaccaccacgctggcacccagttgatcggcgcgagatttaatcgccgcgacaatttgcg

[0330] acggcgcgtgcagggccagactggaggtggcaacgccaatcagcaacgactgtttgcccgccagttgttgtgccacgcggttgggaatgtaattca

[0331] gctccgccatcgccgcttccactttttcccgcgttttcgcagaaacgtggctggcctggttcaccacgcgggaaacggtctgataagagacaccggca

[0332] tactctgcgacatcgtataacgttactggtttcacattcaccaccctgaattgactctcttccgggcgctatcatgccataccgcgaaaggttttgcgccatt

[0333] cgatggtgtccgggatctcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcaccgccgccgcaa

[0334] ggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaa

[0335] gtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccgg

[0336] CGTAGAGGATCGAGATCTCGATCCCACGAAATTAATACGACTC ACTATAGGGGAATTGTGAGCGGAT AACAATTCCCCTCTAGAAATAATTTGTTTA ACTT

[0337] TAAGAAGGAGATATAAGCAGGATCCATGGCCGCTACCGCCGCTCTGCGTAGCGGTGATACCCTGCCCAGACCGCCGCAGCATTTC CGCCGCCTCC

[0338] GGTGACCGCCCCTATTGATCGTGCCGCGTGGAATTCGCCGATTTCCGCTTTGTGCGTAGCGAAACC GAACGCCGCAGCACCCTGAGCGCAGAA

[0339] GATCAGCAGGTGCAGAGCATGGCAGATGCAAGCCCGACCAATGGCATCGTGCACATGTTACCTGGTTTTTTGAACAGTTTCTGCTGC GC GAACATCTG

[0340] CCGGGTTATGCAATTTATGATGAACGCCTGCATTA TCTGTTTAATAGTTATTATGTGGCCGCAGGCCCGC GTCAGCCGCGTTTCAGCGTG GTATGATTACC

[0341] CGTCCGACC ATGGCAGAAGTTACC GCCTATCGC GCACATGTGGATCGTGCAGTGGAAAGTCTGCTGGGCCAGGCCGCCGATGGCGCTTTAGAAGCA

[0342] GTTCTGCCGATTC TGGAAATTGGTCTGTATCATGAACAGCAGCATCAGGAAC TGC TGC TACCGATATTCTGCATGCATTTGCACAGAATCCGCTGGGTCC

[0343] GGTTTATGATGCAGAATGGCGTTTCCGGCCGTGGCCGGCCAGGGTG GTCAGGCACCTCTGGCTCGCGGCATTGCGTGGA TTGGTCATGAAGGC GATG

[0344] gttttagctttgataatgaaagtccgcgtcatgaagcactgattctgccgggtcgcattgataaagcactggtgaccaatcgtgattggctgggctttatg

[0345] gaagcaggcggttatgccaaaccggaactgtggctgagcgatggctggtatgccggtcaggccgaaggttgggaagcaccgggttattggcgccg

[0346] tgatggtgaaggctgggccaccatgaccctgggtggtgttcgtccggttgaactggatgcaccggtgacccatattagttattatgaagcagatgcctat

[0347] gcccgctgggccggccgtaccttaccgacagaatttgaatgggaagtggccgcccgtgatggtgccctgccggatgcatttggtctggtgtggcagt

[0348] ggacccgtagcgcctatgttgcctatccgggttatcgtccgctgccgggcgcactgggtgaatataatggtaaatttatggtgagtcagttcgttctgcgt

[0349] ggtagtagtgtggcaaccccggaaggccatgcccgcctgccttatcgtaattttttttatccgcatcagcgttggcagtttaccggtctgcgcctggccg

[0350] atgtggcccatcatcatcatcatcactaattaagaaggagatataagcaggatcatgaccctgagcctggccaattatctggccgcagatagcgccgcc

[0351] gaagccctgcgtcgtgatgttcgtgcaggtctgaccgcagcaccgaaaagcctgccgccgaaatggttttatgatgccgtgggcagtgatctgtttgat

[0352] cagattacccgtctgccggaatattatccgacccgcaccgaagcccagattctgcgtacccgtagcgcagaaattattgccgccgcaggtgccgatac

[0353] cctggtggaactgggtagcggcaccagcgaaaaaacccgcatgctgctggatgcaatgcgtgatgcagaactgctgcgtcgttttattccgtttgatgt

[0354] ggatgcaggtgttctgcgcagtgccggcgcagccattggtgccgaatatccgggtattgaaattgatgcagtgtgcggtgattttgaagaacatctggg

[0355] taaaattccgcatgttggccgtcgtctggtggtgtttctgggcagtaccattggtaatctgaccccggccccgcgcgccgaatttctgagcaccctggca

[0356] gataccctgcagccgggtgatagcctgctgctgggcaccgatctggttaaagataccggccgcctggtgcgcgcatatgatgatgcagccggtgtga

[0357] ccgcagcatttaatcgtaatgtgctggccgttgttaatcgtgaactgagcgccgattttgatctggatgcatttgaacatgtggccaaatggaatagcgat

[0358] gaaacgcattgaaatgtggctgcgcgcacgtaccgcacagcatgtgcgtgttcagcactggatctggaagttgatttgccgcaggcgaagaaa

[0359] tgctgaccgaagttagttgcaaatttcgccccggaaaatgttgttgcagaactggcagaagcaggcctgcgccagacccattggtggaccgatccggc

[0360] cggcgattttggcctgagcctggcggttcgtcatcatcatcatcatcactaaggcgaatgctagcataaccccttggggcctctaaacgggtcttgagg

[0361] ggttttttggaaattaatacgactcactataggggaattgtgagcggataacaattcccatactgctgttaagaaggagatataccgaaggacgtgatgct

[0362] ggcccagcagtggcgcgatgcacgccctaaagtggcaggcctgcatctggatagtggtgcctgcagccgccagagctttgccgtgattgatgccac

[0363] caccgcacatgcacgccatgaagccgaagttggcggttatgttgcagcagaagcagccaccccggccctggatgccggtagagcagccgttgcca

[0364] gtctgattggttttgcagcaagtgatgtggtttataccagcggtagcaatcatgccattgatctgctgctgagtagttggccgggtaaacgtaccctggca

[0365] tgcctgccgggtgaatatggtccgaatctgagtgcaatggccgcaaatggttttcaggtgcgcgcactgccggttgatgatgatggtcgcgtgctggtt

[0366] gatgaagcaagtcatgaactgagcgcccatccggttgcactggttcatctgaccgcactggccagtcatcgtggcattgcccagccggccgcagaac

[0367] tggttgaagcctgccataatgccggtattccggttgtgattgatgcggcacaggccctgggccatctggattgtaatgttggtgcagatgcagtttatagt

[0368] agtagtcgcaaatggctggccggtccgcgcggcgttggtgttctggctgtgcgcccggaactggccgaacgtctgcagccgcgtattccgccgagc

[0369] gattggccgattccgatgagtgtgctggaaaaactggaactgggtgaacataatgccgccgcacgcgtgggttttagtgtggccgttggcgaacatct

[0370] ggccgcaggtccgaccgccgtgcgtgaacgtctggcagaagttggtcgtctgagccgtcaggtgctggccgaagttgatggttggcgcgtggttga

[0371] accggttgatcagccgaccgcaattaccaccctggaaagcaccgatggtgcagatccggccagcgtgcgcagttggctgattgccgaacgcggtatt

[0372] gtgaccaccgcatgtgaactggcccgcgcaccgtttgaaatgcgcaccccggtgctgcgcattagtccgcatgttgatgtgaccgttgatgaactgga

[0373] acagtttgcagccgccctgcgtgaagccccgcatcatcatcatcatcactaaaagcttgcggccgcttaagaaggagatataagcaggatcatgggg

[0374] ctattagaaggagaagagttggtactgagaggccgcggtcaaggtggcgaaccgcgtccggagcgcgaaccggagctgaagctggagcacgtgc

[0375] cggagcgtgcgccggacggcgagccagagacagaaggtcaactgggtccacgtaaagaacccgaacacaaacttgaggcggaaagcgaaccg

[0376] Ctccaagaaactccgcagcgtgaagtcctggcgtttggccgtgcttggaaatctgagttcctgttcgatccggcatggcgtaacctgaaccacggcag

[0377] Cttcggcacctacccgctttacatccgtgacaagctgagagcttatcaggaccaggcagaagcgcgtccggatcattttatccgttacgaggaatcaaa

[0378] Attactgcatcgtagccgcgcggcggtggctaaaatcgtgaatgccccgttggacaccgtcgtgttcgtgggtaacgccaccgaaggcgtgaacacc

[0379] Gtgctgcgtaatctgagatgggatagcctggagaagggtggtcaaaaagatgtcatcctgtcgttcagcacggtttatgaggcgtgtggcaacgcggc

[0380] Agactacatcgttgagtacttcgcaggtaaagtggagcaccgtaccattgaactggagtacccggtcgaagacgctgatgttattgctgctttacgcgg

[0381] Agcggctacccaggttgcccgcgagggcaagcgcgcgcgtttggcaatgatggatgttgtgaccagccgtccgggcgttgtctttccgtgggaggct

[0382] Gcggttcgtgtttgccgtgagctgggcattttgtccctggtggacggtgcccagggtgttggtatggttcgtttggacctaaccgcagctgacccggact

[0383] Tctttgttagcaattgccataagtggctgctggtaccgcgcgggtgcgctatgctgtacaccccggcaagaactcaatgtctgctccggaccgcgttgg

[0384] ccacctcccatggttatgtcccgcctagtgcggcgccggcgcctccgggttcgaagagccgctacgttgccaattttgaatttgtcggcaccagggata

[0385] atggtccgtatctatgcgtagcggatgccatcgcgtggcgtgaacgcgtgtgcggtggcgaagagaacattctccgctatctgtgggcattgaataaa

[0386] aaaggcattcgtatcgtggcccgtgcactgggtacgacccacctggacaacgaaaccgaaacgctgacgaactgcgccatgggtaacgtagctttg

[0387] ccgatgcgtgtggacgacgaagatgcctctacggcgctggacgcggcgccgtctgcagcgattgcggcgccagacgttgtggtggctcgtgagaa

[0388] cgtggccttggttgacaagtggatgcgtgagcgtctgtttgatgattacaagaccttcatgaccttgttcgtcatgcaggatcgttactgggttcgtttgtcc

[0389] gcgcagatttatttggacgagcaggattatgaagctgcgggtgatatcctcaaggcgctgtgtgaacgcatcagacgccgtgagtatctggttccgcaa

[0390] ccggtggagcatcatcatcatcatcactaactcgagcaccaccaccaccaccactgagatccggctgctaacaaagcccgaaaggaagctgagttgg

[0391] ctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat

[0392] Construction of recombinant plasmid pCDFDuet-1-egt12-egtBDE and transformation

[0393] Obtaining of egt12 fragment: enzyme cutting sites were introduced at both ends of egt12 gene, primer egt12-FF3 / egt12-RR3 (see Table 1 for primer sequence) was designed, and egt12 amplification fragment was obtained by PCR technology, and the amplified egt12 fragment was purified and recovered by gel recovery kit (Tianjin ZK Biological Technology Co., Ltd.). PCR reaction system: 2 x phantamax buffer 10 μL, dNTP mixture (10 mM) 0.4 μL, template 0.4 μL (20 ng / μl) of the constructed plasmid pET28a-egt12, egt12-FF3 primer (10 μM) 0.8 μL, egt12-RR3 primer (10 μM) 0.8 μL, DMSO 0.4 μL, phantamax x Super Fidelity DNA Polymerase 0.4 μL, and super pure water was added to 20 μL. PCR reaction conditions: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 62 °C annealing for 15 s, 72 °C extension for 150 s, denaturation, annealing and extension for 35 cycles; 72 °C extension for 5 min; 4 °C to end the reaction.

[0394] Obtaining of egtBDE fragment: enzyme cutting sites were introduced at both ends of egtBDE gene, primer egtBDE-FF4 / egtBDE-RR4 (see Table 1 for primer sequence) was designed, and egtBDE amplification fragment was obtained by PCR technology, and the amplified egtBDE fragment was purified and recovered by gel recovery kit (Tianjin ZK Biological Technology Co., Ltd.). PCR reaction system: 2 x phantamax buffer 10 μL, dNTP mixture (10 mM) 0.4 μL, template 0.4 μL (20 ng / μl) of the constructed plasmid pET28a-egtBDE, egtBDE-FF4 primer (10 μM) 0.8 μL, egtBDE-RR4 primer (10 μM) 0.8 μL, DMSO 0.4 μL, phantamax x Super Fidelity DNA Polymerase 0.4 μL, and super pure water was added to 20 μL. PCR reaction conditions: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 62 °C annealing for 15 s, 72 °C extension for 150 s, denaturation, annealing and extension for 35 cycles; 72 °C extension for 5 min; 4 °C to end the reaction.

[0395] Construction and transformation of recombinant plasmid pCDFDuet-1-egtBDE: The plasmid pCDFDuet-1 was digested with restriction endonuclease EcoRI and NotI at 37°C for 30 min, and then the linear fragment of the vector was obtained using a purification recovery kit (Tiangen Biotech Co., Ltd.). The amplified egtBDE fragment and the linear fragment of the pCDFDuet-1 vector were connected by homologous recombination using one-step cloning, thereby obtaining the recombinant plasmid pCDFDuet-1-egtBDE.

[0396] The recombinant plasmid pCDFDuet-1-egtBDE 2 μl (100 μg / ml) was transformed into E. coli DH5α or JM109 competent cells. The transformation product was spread on LB solid plates containing 50 μg / mL streptomycin and incubated at 37°C overnight until single colonies were clearly visible. The primers egtBDE-F / egtBDE-R (see Table 1 for primer sequences) were designed, and positive transformants were selected for colony PCR verification to obtain the strains E. coli DH5α pCDFDuet-1-egtBDE or E. coli JM109 pCDFDuet-1-egtBDE. After the correct transformants were inoculated in LB liquid medium and incubated overnight, the plasmid was extracted and sequenced for further verification. The correct verification obtained the recombinant plasmid pCDFDuet-1-egtBDE. The plasmid map of the recombinant plasmid pCDFDuet-1-egtBDE is shown in FIG. 1, and the nucleotide sequence of the recombinant plasmid pCDFDuet-1-egtBDE is as follows. Figure 6

[0397] pCDFDuet-1-egtBDE (SEQ ID NO. 28):

[0398] ​

[0399] gccaccaccgcacatgcacgccatgaagccgaagttggcggttatgttgcagcagaagcagccaccccggccctggatgccggtagagcagccgt

[0400] tgccagtctgattggttttgcagcaagtgatgtggtttataccagcggtagcaatcatgccattgatctgctgctgagtagttggccgggtaaacgtaccc

[0401] tggcatgcctgccgggtgaatatggtccgaatctgagtgcaatggccgcaaatggttttcaggtgcgcgcactgccggttgatgatgatggtcgcgtg

[0402] ctggttgatgaagcaagtcatgaactgagcgcccatccggttgcactggttcatctgaccgcactggccagtcatcgtggcattgcccagccggccgc

[0403] agaactggttgaagcctgccataatgccggtattccggttgtgattgatgcggcacaggccctgggccatctggattgtaatgttggtgcagatgcagtt

[0404] tatagtagtagtcgcaaatggctggccggtccgcgcggcgttggtgttctggctgtgcgcccggaactggccgaacgtctgcagccgcgtattccgc

[0405] cgagcgattggccgattccgatgagtgtgctggaaaaactggaactgggtgaacataatgccgccgcacgcgtgggttttagtgtggccgttggcga

[0406] acatctggccgcaggtccgaccgccgtgcgtgaacgtctggcagaagttggtcgtctgagccgtcaggtgctggccgaagttgatggttggcgcgtg

[0407] gttgaaccggttgatcagccgaccgcaattaccaccctggaaagcaccgatggtgcagatccggccagcgtgcgcagttggctgattgccgaacgc

[0408] ggtattgtgaccaccgcatgtgaactggcccgcgcaccgtttgaaatgcgcaccccggtgctgcgcattagtccgcatgttgatgtgaccgttgatgaa

[0409] ctggaacagtttgcagccgccctgcgtgaagccccgcatcatcatcatcatcactaaaagcttgcggccgcataatgcttaagtcgaacagaaagtaat

[0410] cgtattgtacacggccgcataatcgaaattaatacgactcactataggggaattgtgagcggataacaattccccatcttagtatattagttaagtataaga

[0411] aggagatatacatatggcagatctcaattggatatcggccggccacgcgatcgctgacgtcggtaccctcgagtctggtaaagaaaccgctgctgcg

[0412] aaatttgaacgccagcacatggactcgtctactagcgcagcttaattaacctaggctgctgccaccgctgagcaataactagcataaccccttggggcc

[0413] tctaaacgggtcttgaggggttttttgctgaaacctcaggcatttgagaagcacacggtcacactgcttccggtagtcaataaaccggtaaaccagcaat

[0414] agacataagcggctatttaacgaccctgccctgaaccgacgaccgggtcatcgtggccggatcttgcggcccctcggcttgaacgaattgttagacat

[0415] tatttgccgactaccttggtgatctcgcctttcacgtagtggacaaattcttccaactgatctgcgcgcgaggccaagcgatcttcttcttgtccaagataa

[0416] gcctgtctagcttcaagtatgacgggctgatactgggccggcaggcgctccattgcccagtcggcagcgacatccttcggcgcgattttgccggttact

[0417] gcgctgtaccaaatgcgggacaacgtaagcactacatttcgctcatcgccagcccagtcgggcggcgagttccatagcgttaaggtttcatttagcgc

[0418] ctcaaatagatcctgttcaggaaccggatcaaagagttcctccgccgctggacctaccaaggcaacgctatgttctcttgcttttgtcagcaagatagcc

[0419] agatcaatgtcgatcgtggctggctcgaagatacctgcaagaatgtcattgcgctgccattctccaaattgcagttcgcgcttagctggataacgccacg

[0420] gaatgatgtcgtcgtgcacaacaatggtgacttctacagcgcggagaatctcgctctctccaggggaagccgaagtttccaaaaggtcgttgatcaaa

[0421] gctcgccgcgttgtttcatcaagccttacggtcaccgtaaccagcaaatcaatatcactgtgtggcttcaggccgccatccactgcggagccgtacaaa

[0422] tgtacggccagcaacgtcggttcgagatggcgctcgatgacgccaactacctctgatagttgagtcgatacttcggcgatcaccgcttccctcatactct

[0423] tcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaatagctagctcactcggtc

[0424] gctacgctccgggcgtgagactgcggcgggcgctgcggacacatacaaagttacccacagattccgtggataagcaggggactaacatgtgaggc

[0425] aaaacagcagggccgcgccggtggcgtttttccataggctccgccctcctgccagagttcacataaacagacgcttttccggtgcatctgtgggagcc

[0426] gtgaggctcaaccatgaatctgacagtacgggcgaaacccgacaggacttaaagatccccaccgtttccggcgggtcgctccctcttgcgctctcctg

[0427] ttccgaccctgccgtttaccggatacctgttccgcctttctcccttacgggaagtgtggcgctttctcatagctcacacactggtatctcggctcggtgtag

[0428] gtcgttcgctccaagctgggctgtaagcaagaactccccgttcagcccgactgctgcgccttatccggtaactgttcacttgagtccaacccggaaaag

[0429] cacggtaaaacgccactggcagcagccattggtaactgggagttcgcagaggatttgtttagctaaacacgcggttgctcttgaagtgtgcgccaaag

[0430] TCCGGCTACACTGGAAGGACAGATTTGGTTGCTGTGCTCTGCGAAAGCCAGTTACCACGGTTAAGCAGTTCCCCA ACTGACTTAACCTTCGATCAAAACA

[0431] CCTCCCCAGGTGTTTTTTTCGTTTACAGGGCAAAGATTACGCACAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACTGAACC GCTCTAGATT

[0432] CAGTGCAATTTATCTCTTCAATGTAACCTGAAGTCAGCCCCATACGATATAAGTTGTAATTCTCATGTTAGTCA TGCCCCGCACCGAAGGAGC

[0433] TGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAATTACATTAATTGC GTTGCGCTCCTGCCCGCTTTCCA

[0434] GTTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCAACGCACGGGGAGAGGC GGTCTGCCTATTGGGCACCAAGGTGGTTTTTCTTTTCACCA

[0435] GTGAGACGGGCAACAGCTGATTGCCCTTCACCACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTG GTTTGCCCCAGCAGCGAAAATCCT

[0436] GTTTGATGGTGTTAACGGCGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCAC TACCAGATGTCCGCACCAACGCACCCCAGACTCG

[0437] GTAATGGCGCGCATTGCACCCAGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATT CAGCATTTCATGGTTTGTTCAGAAA

[0438] ccggacatggcactccagtcgccttcccgttccgctatcggctgaatttgattgcgagtgagatatttatgccagccagccagacgcagacgcgccga

[0439] gacagaacttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagatgctccacgcccagtcgcgtaccgtcttcatgggagaaa

[0440] ataatactgttgatgggtgtctggtcagagacatcaagaaataacgccggaacattagtgcaggcagcttccacagcaatggcatcctggtcatccagc

[0441] ggatagttaatgatcagcccactgacgcgttgcgcgagaagattgtgcaccgccgctttacaggcttcgacgccgcttcgttctaccatcgacaccacc

[0442] acgctggcacccagttgatcggcgcgagatttaatcgccgcgacaatttgcgacggcgcgtgcagggccagactggaggtggcaacgccaatcag

[0443] caacgactgtttgcccgccagttgttgtgccacgcggttgggaatgtaattcagctccgccatcgccgcttccactttttcccgcgttttcgcagaaacgt

[0444] ggctggcctggttcaccacgcgggaaacggtctgataagagacaccggcatactctgcgacatcgtataacgttactggtttcacattcaccaccctga

[0445] attgactctcttccgggcgctatcatgccataccgcgaaaggttttgcgccattcgatggtgtccgggatctcgacgctctcccttatgcgactcctgcatt

[0446] aggaaattaatacgactcactata

[0447] The plasmid pCDFDuet-1-egtBDE was digested with restriction endonuclease BglII and XHOI at 37°C for 30 min, and then a linear fragment of the vector was obtained using a purification recovery kit (Tianjin Zixiu Biotechnology Co., Ltd.). The amplified egt12 fragment was ligated to the linear fragment of the double-digested pCDFDuet-1-egtBDE vector by homologous recombination to obtain the recombinant plasmid pCDFDuet-1-egt12-egtBDE.

[0448] Transformation of the recombinant plasmid pCDFDuet-1-egt12-egtBDE: 2 μl (100 μg / ml) of the recombinant plasmid pCDFDuet-1-egt12-egtBDE was added to centrifuge tubes containing E. coli DH5α or JM109 competent cells that had been thawed in an ice bath, the tubes were tapped to mix, and the mixture was incubated in an ice bath for 30 min. The mixture was heat shocked at 42°C for 60 s and then immediately incubated in an ice bath for 5 min (do not move during this process). Under sterile conditions, 900 μL of LB medium was added to the centrifuge tube, the mixture was mixed by pipetting, and the mixture was incubated at 37°C with shaking at 180 r / min for 45 min. The centrifuge tube was centrifuged at 10,000 r / min for 1 min, 900 μL of supernatant was removed, the remaining liquid was mixed by pipetting, and the mixture was plated on an LB solid plate containing 50 μg / mL of streptomycin. The LB plate was incubated at 37°C overnight until single colonies were clearly visible. The primers egt12-F and egt12-R (see Table 1 for primer sequences) were designed, and positive transformants were selected for colony PCR verification to obtain the strains E. coli DH5α egt12-egtBDE or E. coli JM109 egt12-egtBDE. The correct transformants were inoculated into LB liquid medium and incubated overnight, and the plasmids were extracted and sequenced for further verification. The correct recombinant plasmid pCDFDuet-1-egt12-egtBDE was obtained. The plasmid map of the recombinant plasmid pCDFDuet-1-egt12-egtBDE is shown in FIG. 1, and the nucleotide sequence of the recombinant plasmid pCDFDuet-1-egt12-egtBDE is as follows. Figure 7

[0449] pCDFDuet-1-egt12-egtBDE (SEQ ID NO. 29):

[0450] ​

[0451] gccaccaccgcacatgcacgccatgaagccgaagttggcggttatgttgcagcagaagcagccaccccggccctggatgccggtagagcagccgt

[0452] tgccagtctgattggttttgcagcaagtgatgtggtttataccagcggtagcaatcatgccattgatctgctgctgagtagttggccgggtaaacgtaccc

[0453] tggcatgcctgccgggtgaatatggtccgaatctgagtgcaatggccgcaaatggttttcaggtgcgcgcactgccggttgatgatgatggtcgcgtg

[0454] ctggttgatgaagcaagtcatgaactgagcgcccatccggttgcactggttcatctgaccgcactggccagtcatcgtggcattgcccagccggccgc

[0455] agaactggttgaagcctgccataatgccggtattccggttgtgattgatgcggcacaggccctgggccatctggattgtaatgttggtgcagatgcagtt

[0456] tatagtagtagtcgcaaatggctggccggtccgcgcggcgttggtgttctggctgtgcgcccggaactggccgaacgtctgcagccgcgtattccgc

[0457] cgagcgattggccgattccgatgagtgtgctggaaaaactggaactgggtgaacataatgccgccgcacgcgtgggttttagtgtggccgttggcga

[0458] acatctggccgcaggtccgaccgccgtgcgtgaacgtctggcagaagttggtcgtctgagccgtcaggtgctggccgaagttgatggttggcgcgtg

[0459] gttgaaccggttgatcagccgaccgcaattaccaccctggaaagcaccgatggtgcagatccggccagcgtgcgcagttggctgattgccgaacgc

[0460] ggtattgtgaccaccgcatgtgaactggcccgcgcaccgtttgaaatgcgcaccccggtgctgcgcattagtccgcatgttgatgtgaccgttgatgaa

[0461] ctggaacagtttgcagccgccctgcgtgaagccccgcatcatcatcatcatcactaaaagcttgcggccgcataatgcttaagtcgaacagaaagtaat

[0462] cgtattgtacacggccgcataatcgaaattaatacgactcactataggggaattgtgagcggataacaattccccatcttagtatattagttaagtataaga

[0463] aggagatatacatatggcagatctatgccaagtgctgaatctatgacaccctcaagcgcattgggtcaattgaaggcgaccggtcaacatgtgctctcc

[0464] aagcttcaacagcagaccagcaacgccgatatcattgacatccgtcgtgttgcggttgaaatcaatctgaagacggagatcaccagcatgtttcgtccg

[0465] aaagatggtccgcgccaactgccgaccttgcttctgtacaatgaacgcggtctgcaactcttcgagaggatcacctacttggaagaatattacctcacg

[0466] aacgatgagattaaaattctgacgaaacacgctactgaaatggcatcctttattccgagcggcgcaatgatcatcgagttaggcagcggcaatctgcgc

[0467] aaggtgaacctgttgctggaagcgttggacaacgcgggtaaagcgatcgactactatgcattagacttgagccgtgaagagctggaacgtactttggc

[0468] tcaagttccatcctataaacacgtaaaatgccacggcttactgggaacctacgacgacggccgtgattggctgaaggcccccgagaacattaacaagc

[0469] aaaaatgtatccttcacttgggctcatcgattggtaactttaaccgtagcgacgctgcaacctttttgaagggcttcaccgatgttctcggtccgaatgata

[0470] aaatgctgatcggcgtcgatgcgtgtaatgacccggcgcgtgtttaccatgcgtataatgacaaggtgggtataacccacgaatttattctgaatggtct

[0471] gcgcaatgctaacgagatcattggggaaaccgctttcatcgagggtgattggcgtgttattggcgaatacgtgtacgatgaagagggtggccgtcatc

[0472] aggcgttttatgctccgacccgtgacaccatggttatgggtgaactgattcgtagccatgatcgtatccagattgaacagtccctgaagtattcgaaaga

[0473] agagtcagaacgactgtggagcaccgcaggcctggaacaggttagcgagtggacctacggcaacgagtacggtctccacctgctggcgaagagc

[0474] cgtatgagctttagcctgatcccgtcggtgtatgcgcgtagtgcattgcctactctggacgactgggaagctctgtgggcaacctgggatgtggtcacc

[0475] cgtcagatgctgccgcaggaggagctcttggaaaaaccgatcaaactgcgcaacgcctgcattttctacctgggtcacatcccgacgttcctggatatc

[0476] cagctgaccaaaaccaccaaacaggcgccctccgagccggcgcacttttgcaaaatcttcgagcgcggcatcgacccggatgttgataatccggag

[0477] ctgtgccatgcgcatagcgaaatcccagatgaatggcctccggtggaagaaattcttacctaccaggagacagtccgttctcgtttgcgcggtctgtac

[0478] gcgcatgggatcgccaatatcccgcgcaatgtgggccgcgcaatttgggtcggtttcgagcacgagttaatgcatattgagacgctgttatacatgatg

[0479] ctgcagagcgataaaaccttgattccgacccatattccgcgccctgacttcgacaagctcgcacgcaaggcggaatctgagcgcgtgccaaaccagt

[0480] ggtttaaaatcccggcgcaagagattacgatcggtttggacgatccggaagacggctctgacatcaacaagcactatggttgggacaacgagaagcc

[0481] gccgcgcagagtgcaggttgcagcgtttcaggcgcaaggtcgtccgattaccaatgaggaatacgcacaatatctactggaaaagaacattgacaag

[0482] ctgcctgcgtcctgggcccgtctggacaacgaaaatatcagcaacggcaccaccaatagcgtctccggccatcattctaacagaacctcgaagcaac

[0483] aactgccgtcctctttcttagaaaaaacggctgttagaaccgtgtacggccttgtgccgctgaagcacgcgctggattggccggtttttgcaagctatga

[0484] cgagctagcgggttgcgcagcgtacatgggcggcagaattccgacctttgaggagacgcgttctatctacgcgtacgctgacgccctgaagaaaaa

[0485] aaaagaggctgagcgtcagctgggccgtacggtgccggcggtgaacgcccacctgacgaacaacggtgttgagattaccccgccaagttcaccgt

[0486] cgagcgaaaccccggcggaaagctcctccccgtctgatagcaataccacgctgattactactgaggatctgttctccgacctggatggtgcgaacgtt

[0487] ggtttccacaattggcacccgatgccgatcaccagcaaaggcaacaccctggtcggccagggtgaattggggggggtgtgggaatggaccagcag

[0488] cgtactgcgtaaatgggagggcttcgagccgatggaactgtacccgggttataccgccgacttcttcgatgagaagcacaacattgtgctgggtggta

[0489] gctgggccacgcacccgcgcatcgcgggtcgcaagagcttcgttaactggtatcagcgtaactatccgtatgcttgggttggcgcgcgtgtggttcgt

[0490] gaccttcatcatcatcatcatcactaaggcgaatggctagcataaccccttggggcctctaaacgggtcttgaggggttttttggaaattaatacgactca

[0491] ctataggggaattgtgagcggataacaattccctcaagtacttaagaaggagatataagcaggatcatggggctattagaaggagaagagttggtact

[0492] gagaggccgcggtcaaggtggcgaaccgcgtccggagcgcgaaccggagctgaagctggagcacgtgccggagcgtgcgccggacggcgag

[0493] ccagagacagaaggtcaactgggtccacgtaaagaacccgaacacaaacttgaggcggaaagcgaaccgctccaagaaactccgcagcgtgaag

[0494] tcctggcgtttggccgtgcttggaaatctgagttcctgttcgatccggcatggcgtaacctgaaccacggcagcttcggcacctacccgctttacatccg

[0495] tgacaagctgagagcttatcaggaccaggcagaagcgcgtccggatcattttatccgttacgaggaatcaaaattactgcatcgtagccgcgcggcg

[0496] gtggctaaaatcgtgaatgccccgttggacaccgtcgtgttcgtgggtaacgccaccgaaggcgtgaacaccgtgctgcgtaatctgagatgggata

[0497] gcctggagaagggtggtcaaaaagatgtcatcctgtcgttcagcacggtttatgaggcgtgtggcaacgcggcagactacatcgttgagtacttcgca

[0498] ggtaaagtggagcaccgtaccattgaactggagtacccggtcgaagacgctgatgttattgctgctttacgcggagcggctacccaggttgcccgcg

[0499] agggcaagcgcgcgcgtttggcaatgatggatgttgtgaccagccgtccgggcgttgtctttccgtgggaggctgcggttcgtgtttgccgtgagctg

[0500] ggcattttgtccctggtggacggtgcccagggtgttggtatggttcgtttggacctaaccgcagctgacccggacttctttgttagcaattgccataagtg

[0501] gctgctggtaccgcgcgggtgcgctatgctgtacaccccggcaagaactcaatgtctgctccggaccgcgttggccacctcccatggttatgtcccgc

[0502] ctagtgcggcgccggcgcctccgggttcgaagagccgctacgttgccaattttgaatttgtcggcaccagggataatggtccgtatctatgcgtagcg

[0503] gatgccatcgcgtggcgtgaacgcgtgtgcggtggcgaagagaacattctccgctatctgtgggcattgaataaaaaaggcattcgtatcgtggcccg

[0504] tgcactgggtacgacccacctggacaacgaaaccgaaacgctgacgaactgcgccatgggtaacgtagctttgccgatgcgtgtggacgacgaag

[0505] atgcctctacggcgctggacgcggcgccgtctgcagcgattgcggcgccagacgttgtggtggctcgtgagaacgtggccttggttgacaagtggat

[0506] gcgtgagcgtctgtttgatgattacaagaccttcatgaccttgttcgtcatgcaggatcgttactgggttcgtttgtccgcgcagatttatttggacgagcag

[0507] gattatgaag ctgcgggtga tacctcaagg cgctgtgtga acgcatcaga cgccgtgagt atctggttcc gcaaccggtg gagcatcatc atcatcatca t

[0508] cactaactcg agtctggtaa gaaaccgctg ctgcgaaatt tgaacgccag cacatggact cgtctactag cgcagcttaatt aacctaggc tgctgcc

[0509] accgctgagc aataactagc ataacccctt gggcctctaa acgggtcttg aggggttttt tgctgaaacc tcaggcattt gagaagcacacggtcaca

[0510] ctgcttccgg tagtcaataa accggtaaac cagcaataga cataagcggc tatttaacga ccctgccctg aaccgacga ccgggtcatc gtggccgg

[0511] atcttgcggc ccctcggctt gaacgaattg ttagacatta tttgccgact accttggtga ctgcgctttc acgtagtgga caaattcttc aactgatctg c

[0512] gcgcgaggcc aagcgatctt cttcttgtcc aagataagcc tgtctagctt caagtatga cgggctgata ctgggccggc aggcgctcca ttgcccagtc

[0513] ggcagcgaca tccttcggcg cgattttgcc ggttactgcg ctgtaccaaa tgcgggacaa cgtaagcact acatttcgc tcatcgccag ccagtcgg

[0514] gcggcgagtt ccatagcgtt aaggtttcat ttagcgcctc aaatagatcc tgttcaggaaccggatcaaagagttcctccgccgctggacctaccaagg

[0515] caacgctatgttctcttgcttttgtcagcaagatagccagatcaatgtcgatcgtggctggctcgaagatacctgcaagaatgtcattgcgctgccattctc

[0516] caaattgcagttcgcgcttagctggataacgccacggaatgatgtcgtcgtgcacaacaatggtgacttctacagcgcggagaatctcgctctctccag

[0517] gggaagccgaagtttccaaaaggtcgttgatcaaagctcgccgcgttgtttcatcaagccttacggtcaccgtaaccagcaaatcaatatcactgtgtg

[0518] gcttcaggccgccatccactgcggagccgtacaaatgtacggccagcaacgtcggttcgagatggcgctcgatgacgccaactacctctgatagttg

[0519] agtcgatacttcggcgatcaccgcttccctcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgt

[0520] atttagaaaaataaacaaatagctagctcactcggtcgctacgctccgggcgtgagactgcggcgggcgctgcggacacatacaaagttacccacag

[0521] attccgtggataagcaggggactaacatgtgaggcaaaacagcagggccgcgccggtggcgtttttccataggctccgccctcctgccagagttcac

[0522] ataaacagacgcttttccggtgcatctgtgggagccgtgaggctcaaccatgaatctgacagtacgggcgaaacccgacaggacttaaagatcccca

[0523] ccgtttccggcgggtcgctccctcttgcgctctcctgttccgaccctgccgtttaccggatacctgttccgcctttctcccttacgggaagtgtggcgcttt

[0524] ctcatagctcacacactggtatctcggctcggtgtaggtcgttcgctccaagctgggctgtaagcaagaactccccgttcagcccgactgctgcgcctt

[0525] atccggtaactgttcacttgagtccaacccggaaaagcacggtaaaacgccactggcagcagccattggtaactgggagttcgcagaggatttgttta

[0526] gctaaacacgcggttgctcttgaagtgtgcgccaaagtccggctacactggaaggacagatttggttgctgtgctctgcgaaagccagttaccacggtt

[0527] aagcagttccccaactgacttaaccttcgatcaaaccacctccccaggtggttttttcgtttacagggcaaaagattacgcgcagaaaaaaaggatctca

[0528] agaagatcctttgatcttttctactgaaccgctctagatttcagtgcaatttatctcttcaaatgtagcacctgaagtcagccccatacgatataagttgtaatt

[0529] ctcatgttagtcatgccccgcgcccaccggaaggagctgactgggttgaaggctctcaagggcatcggtcgagatcccggtgcctaatgagtgagct

[0530] aacttacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggc

[0531] ggtttgcgtattgggcgccagggtggtttttcttttcaccagtgagacgggcaacagctgattgcccttcaccgcctggccctgagagagttgcagcaa

[0532] gcggtccacgctggtttgccccagcaggcgaaaatcctgtttgatggtggttaacggcgggatataacatgagctgtcttcggtatcgtcgtatcccact

[0533] accgagatgtccgcaccaacgcgcagcccggactcggtaatggcgcgcattgcgcccagcgccatctgatcgttggcaaccagcatcgcagtggg

[0534] aacgatgccctcattcagcatttgcatggtttgttgaaaaccggacatggcactccagtcgccttcccgttccgctatcggctgaatttgattgcgagtga

[0535] gatatttatgccagccagccagacgcagacgcgccgagacagaacttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagat

[0536] gctccacgcccagtcgcgtaccgtcttcatgggagaaaataatactgttgatgggtgtctggtcagagacatcaagaaataacgccggaacattagtg

[0537] caggcagcttccacagcaatggcatcctggtcatccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagattgtgcaccgccgcttt

[0538] acaggcttcgacgccgcttcgttctaccatcgacaccaccacgctggcacccagttgatcggcgcgagatttaatcgccgcgacaatttgcgacggc

[0539] GCGTCGAGGGCCAGACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTGTGCCACGCGGTTGGGAATGTAATTCAGCTCCG

[0540] CCATCGCCGCTTCCACTTTTTCCCgcgtTTTCgcagaaacGTGGCTGGCCTGgtTCACCACgcGGGAAacGgtCTGATaAGAGACACCggCATACTCTG

[0541] CGACATCGTATAACGTTACTGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCgCTATCATGCCATAccgcGAAAGGTTTgcGCCATTCGATGG

[0542] TGTCcGGGATCTCGACGCTCTCCCTTATGcGACTCCTGCATTAGGAAATTAATACGACTCActATa

[0543] Table 1. Nucleotide sequence of primers

[0544]

[0545] Example 6. Obtaining of engineering strains

[0546] The recombinant plasmids pET28a-egtBDE, pET28a-egt12, pET28a-egtBDE-egt1, pET28a-egtBDE-egt2, pCDFDuet-1-egt12-egtBDE constructed and verified correctly in Examples 1-5 were transformed into E. coli BW25113 to obtain five engineering strains with high yield of ergot alkaloids.

[0547] The recombinant plasmid pET28a-egtBDE 2 μl (100 μg / ml) after verification of Example 1 was added to the centrifuge tube containing E. coli BW25113 competent cells which had been thawed in an ice bath, flicked the tube wall, mixed, and ice bathed for 30 min. 42°C heat shock for 60 s, and then immediately ice bathed for 5 min (do not move during this process). Under sterile conditions, 900 μL of LB medium was added to the centrifuge tube, mixed by flicking, and then cultured at 37°C, 180 r / min for 45 min. The centrifuge tube was centrifuged at 10,000 r / min for 1 min, 900 μL of supernatant was removed, the remaining liquid was mixed by flicking with a pipette, and then spread onto a LB solid plate containing 50 μg / mL kanamycin. The LB plate was incubated at 37°C overnight until single colonies were clearly visible. The primers egtBDE-F / egtBDE-R (see Table 1 for primer sequences) were designed, and positive transformants were selected for colony PCR verification to obtain the E. coli BW25113 egtBDE strain.

[0548] The recombinant plasmid pET28a-egtBDE 2 μl (100 μg / ml) after verification of Example 1 was added to the centrifuge tube containing E. coli BW25113 competent cells which had been thawed in an ice bath, flicked the tube wall, mixed, and ice bathed for 30 min. 42°C heat shock for 60 s, and then immediately ice bathed for 5 min (do not move during this process). Under sterile conditions, 900 μL of LB medium was added to the centrifuge tube, mixed by flicking, and then cultured at 37°C, 180 r / min for 45 min. The centrifuge tube was centrifuged at 10,000 r / min for 1 min, 900 μL of supernatant was removed, the remaining liquid was mixed by flicking with a pipette, and then spread onto a LB solid plate containing 50 μg / mL kanamycin. The LB plate was incubated at 37°C overnight until single colonies were clearly visible. The primers egtBDE-F / egtBDE-R (see Table 1 for primer sequences) were designed, and positive transformants were selected for colony PCR verification to obtain the E. coli BW25113 egtBDE strain.

[0549] Add 12 μl (100 μg / ml) of the recombinant plasmid pET28a-egtBDE-egt verified in Example 3 to a centrifuge tube containing Escherichia coli BW25113 competent cells that has been melted in an ice bath, flick the tube wall, mix well, and ice bath for 30 minutes. Heat shock at 42°C for 60 seconds, then immediately ice bath for 5 minutes (do not move during this process). Under sterile conditions, add 900 μL of LB culture medium to the centrifuge tube, pipette to mix, and shake and culture at 37°C and 180 r / min for 45 minutes. Centrifuge the centrifuge tube at 10,000 r / min for 1 minute, remove 900 μL of supernatant, pipette the remaining liquid to mix well, and apply it to a solid LB plate containing 50 μg / mL kanamycin. The LB plate was inverted and cultured at 37°C overnight until single colonies were clearly visible. Primers egt1-F / egt1-R were designed (primer sequences are shown in Table 1). Positive transformants were picked for colony PCR verification to obtain the Escherichia coli BW25113 egtBDE-egt1 strain.

[0550] Add 2 μl (100 μg / ml) of the recombinant plasmid pET28a-egtBDE-egt2 verified in Example 4 to a centrifuge tube containing Escherichia coli BW25113 competent cells that has been melted in an ice bath, flick the tube wall, mix, and ice bath for 30 minutes. Heat shock at 42°C for 60 seconds, then immediately ice bath for 5 minutes (do not move during this process). Under sterile conditions, add 900 μL of LB culture medium to the centrifuge tube, pipette to mix, and shake and culture at 37°C and 180 r / min for 45 minutes. Centrifuge the centrifuge tube at 10,000 r / min for 1 minute, remove 900 μL of supernatant, pipette the remaining liquid to mix, and apply it to a solid LB plate containing 50 μg / mL kanamycin. The LB plate was inverted and cultured at 37°C overnight until single colonies were clearly visible. Primers egt2-F / egt2-R were designed (primer sequences are shown in Table 1). Positive transformants were picked for colony PCR verification to obtain the Escherichia coli BW25113 egtBDE-egt2 strain.

[0551] After the recombinant plasmid pCDFDuet-1-egt12-egtBDE of Example 5 was verified, 2 μl (100 μg / ml) was added to a centrifuge tube containing E. coli BW25113 competent cells that had been thawed in an ice bath, the tube was flicked, mixed, and placed in an ice bath for 30 min. The tube was heat shocked at 42°C for 60 s, and then immediately placed in an ice bath for 5 min (do not move during this process). Under sterile conditions, 900 μl of LB medium was added to the centrifuge tube, mixed by flicking, and then incubated at 37°C with shaking at 180 r / min for 45 min. The centrifuge tube was centrifuged at 10,000 r / min for 1 min, 900 μl of supernatant was removed, the remaining liquid was mixed by flicking with a pipette, and then spread onto an LB solid plate containing 50 μg / ml of streptomycin. The LB plate was incubated at 37°C overnight, until single colonies were clearly visible. Primers egtBDE-F / egtBDE-R and egt12-F / egt12-R (see Table 1 for primer sequences) were designed, and positive transformants were selected and verified by colony PCR to obtain the E. coli BW25113 egt12-egtBDE strain.

[0552] Example 7: Method for producing ergothioneine

[0553] The engineered strain obtained in Example 6 was subjected to shake flask fermentation culture, as follows:

[0554] (1) Slant culture: the engineered strain stored at -80°C was streak inoculated onto an activated slant, and incubated at 37°C for 12 h, and then subcultured once.

[0555] (2) Seed culture in a shake flask: a loop of the slant seed was scraped with an inoculation loop, and inoculated into a test tube containing 5 ml of seed culture medium, and incubated at 25-37°C with shaking at 200 rpm for 10-16 h. The seed culture medium was as follows: 20 g of proteose peptone, 10 g of yeast extract, and 10 g of NaCl, and water was added to make up to 1 L.

[0556] (3) Shake flask fermentation culture: the seed liquid was inoculated into a 250 mL triangular flask containing fermentation medium at an inoculation amount of 5%, the flask was sealed with eight layers of gauze, and incubated at 35°C with shaking at 200 r / min. The fermentation medium was as follows: 16-20 g / L Na2HPO4·12H2O, 5 g / L KH2PO4, 16 g / L (NH4)2SO4, 10 mM MgSO4, 0.5 mM CaCl2, 10 g / L yeast extract, 15 g / L glucose, and pH 6.5-7.0. During the fermentation process, the pH was maintained at 7.0-7.2 by adding ammonia water, and the culture was induced by adding 0.2 mM IPTG after 3 h of incubation. Samples were taken every 24 h, and the fermentation broth was collected, and the fermentation broth contained ergothioneine.

[0557] Example 8: Detection of ergothioneine content

[0558] Standard sample preparation: 1 g / L ergothioneine standard sample was prepared, and was diluted into 5, 25, 50, 100, 200, 400 mg / L standard samples, 1 mL membrane for testing;

[0559] Sample preparation: 1 mL of the fermentation broth obtained in Example 7 was centrifuged at 5000 rpm for 4 min, and the supernatant was filtered for testing;

[0560] Ergothioneine determination method: high performance liquid chromatography (HPLC) detection method: Agilent 1260, UV detector, Hypersil BDS C18 column (200*4.6 mm, 5 μm); column temperature: 30 DEG C; mobile phase A: acetonitrile-water (3:97), mobile phase B: methanol; flow rate: 1.0 mL / min; detection wavelength: 254 nm; injection volume: 20 μL; each sample detection time is 20 min; during the use of liquid phase to detect the target product, the mobile phase A is used to detect the sample, and the mobile phase B is used for column protection.

[0561] The measured ergothioneine content in different high-yield engineering strains is shown in Table 1. Figure 8 The ergothioneine yields of the engineering strains egtBDE and egt12 in a 50 mL shake flask are 39.83 mg / L and 42.91 mg / L, respectively, and the ergothioneine yields of the combinations egtBDE-egt1, egtBDE-egt2 and egtBDE-egt12 are 48.81 mg / L, 41.57 mg / L and 77.54 mg / L, respectively. Figure 8 It can be seen that the ergothioneine content obtained by fermentation of the engineering strain of the application is 39-78 mg / L, while the traditional ergothioneine construction is generated by five-step enzymatic reaction catalysis, and the three plasmids containing egtB, egtA co-expression, egtC, egtE co-expression and egtD are transformed into the E. coli chassis strain. Since egtB cannot directly utilize cysteine, it can only catalyze the combination of gamma-glutamyl cysteine (gamma GC) and histidine betaine (Her) to generate hexyl-glutamyl cysteine sulfoxide (gamma GC-Her), which will cause low utilization rate of cysteine, thereby resulting in a shake flask fermentation ergothioneine yield of only 17 mg / L.

[0562] As can be seen from the above examples and experimental examples, the application provides a high-yield ergothioneine engineering strain and a method for producing ergothioneine, wherein the two key enzymes egt1 and egt2 in the ergothioneine synthesis pathway are combined and co-expressed, which improves the egtABCDE reaction efficiency in traditional prokaryotes, and the ergothioneine yield is more than 4 times higher than that of the traditional pathway, and no external amino acids such as histidine, cysteine and other precursor substances need to be added.

[0563] The above merely describes the preferred embodiments of the present application, and it should be pointed out that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered as falling within the protection scope of the present application.

Claims

1. A high-yield thioneine engineering strain, characterized in that, The engineered strain uses Escherichia coli as a chassis strain, and overexpresses the ergothioneine synthesis gene cluster egtBDE, the ergothioneine biosynthesis protein egt1 encoding gene, and the ergothioneine biosynthesis protein egt2 encoding gene in the chassis strain; The Escherichia coli is Escherichia coli BW25113; The ergothioneine synthesis gene cluster egtBDE is composed of egtB gene, egtD gene, and egtE gene, the nucleotide sequence of the egtB gene is shown in SEQ ID NO.1, the nucleotide sequence of the egtD gene is shown in SEQ ID NO.2, and the nucleotide sequence of the egtE gene is shown in SEQ ID NO.3; The nucleotide sequence of the gene encoding the ergothioneine biosynthesis protein egt1 is shown in SEQ ID NO.5, and the nucleotide sequence of the gene encoding the ergothioneine biosynthesis protein egt2 is shown in SEQ ID NO.

6.

2. A method for producing thioneine, characterized in that, The engineered strain according to claim 1 is activated and cultured, then inoculated into a seed culture medium for culture, and then inoculated into a fermentation culture medium for fermentation culture to obtain ergothioneine.

3. The method according to claim 2, characterized in that The activation culture temperature is 35-40° C., and the activation culture time is 10-16 hours.

4. The method according to claim 2, characterized in that The temperature for culturing the inoculated seed culture medium is 25 to 37° C., and the time for culturing the inoculated seed culture medium is 10 to 16 hours.

5. The method according to claim 2, characterized in that The inoculation amount when inoculating into the fermentation medium is 1-5%, the fermentation culture temperature is 25-37° C., and the fermentation culture time is 20-30 hours.

6. The method according to claim 2, characterized in that After 3 to 5 hours of fermentation culture, 0.1 to 0.5 mM IPTG is added to the fermentation medium for subsequent culture.

Images