Construction of chemiluminescent reporter plasmid and application of chemiluminescent reporter plasmid in detecting transcription level of target gene of acetobacter pasteurianus
By constructing the chemiluminescent reporter plasmid pBBR402, the problem of dynamic monitoring of gene transcription in live cells of Acetobacter pasteurellis in existing technologies has been solved, achieving real-time, low-cost, and efficient detection, which is suitable for food fermentation and environmental remediation research.
Patent Information
- Application Number
- CN202511554197.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-29
- Publication Date
- 2026-01-13
AI Technical Summary
Existing technologies make it difficult to achieve real-time and quantitative monitoring of the transcriptional dynamics of target genes in live cells in Acetobacter pasteurellium. Furthermore, the detection process is complex and costly, and the incompatibility of existing reporter plasmids leads to a lack of effective chemiluminescence reporter systems.
A chemiluminescent reporter plasmid pBBR402 was constructed, containing oriV, rep, kanamycin resistance gene, promoter insertion site, luxCDABE gene cluster, and transcription terminator, to detect the transcription level of target genes in Acetobacter pasteurellosis. The visualization and dynamic monitoring of gene expression were achieved by inserting a specific promoter.
It enables real-time and continuous monitoring of gene transcription levels in Acetobacter pasteurellium. It is simple to operate, low in cost, and has high detection specificity. It is suitable for detecting transcription levels of different genes and is applicable to food fermentation and environmental remediation research.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of molecular biology and genetic engineering, and particularly relates to construction of a chemiluminescent reporter plasmid and application thereof in detecting transcription level of Acetobacter pasteurianus target gene. BACKGROUND
[0002] Acetobacter pasteurianus, as a typical strain of Acetobacteraceae, has the physiological characteristics of efficiently oxidizing ethanol to generate acetic acid, and is an important industrial strain in traditional vinegar brewing, industrial acetic acid production and biosynthetic chemical synthesis. In addition, Acetobacter pasteurianus also has strong acid tolerance and wide environmental adaptability, and shows good application potential in food fermentation field and environmental remediation research. In the industrial fermentation, functional research and metabolic engineering of Acetobacter pasteurianus, real-time and quantitative monitoring of the transcription activity of target gene is a key means to evaluate the effect of strain modification and process optimization. At present, the detection methods for the transcription level of target gene of Acetobacter pasteurianus are still very limited, which greatly limits the in-depth analysis of the gene regulation mechanism of Acetobacter pasteurianus and the rapid optimization of fermentation process.
[0003] qPCR has become one of the widely used detection methods in existing research due to its high sensitivity and specificity. However, qPCR technology also has certain limitations: first, the detection process requires lysis of bacteria, which cannot realize real-time monitoring of the transcription dynamics of target gene of living cells; second, the operation process is complex, time-consuming and susceptible to RNA degradation, reagent contamination and other factors, resulting in poor repeatability of detection results; third, the detection cost is high, which requires special fluorescence quantitative PCR instrument and expensive reagent kit, which is not conducive to high-throughput detection of large-scale samples. These shortcomings limit the application of qPCR in certain specific situations.
[0004] The reporter gene system has become an important alternative to make up for the defects of qPCR technology because it can realize the visualization and dynamic monitoring of target gene expression. GFP, RFP and other fluorescent proteins are the earliest reporter genes used for visualization of gene expression in living cells, which have been verified in various bacteria and eukaryotic cells. However, when fluorescent protein genes are used as reporter genes, they need to rely on external excitation light to excite fluorescent signals, which is easy to cause cell photobleaching phenomenon, and the excitation light will have phototoxicity to living cells, affecting the normal physiological activities of cells.
[0005] In contrast, the chemiluminescence type fluorescent enzyme reporter system (such as the luciferase gene cluster luxCDABE) has the advantages of no need for external excitation light, self-synthesis of luciferin, strong luminescence signal and low background interference. The luxCDABE gene cluster contains luciferase structural genes (luxA, luxB) and luciferin synthesis related genes (luxC, luxD, luxE), and can autonomously complete the synthesis and oxidative luminescence process of luciferin in the host cell without adding external substrates, greatly simplifying the detection process. In addition, the luminescence signal is linearly related to the gene transcription level, which can monitor the target gene transcription level in real time and continuously, and has the advantages of high sensitivity and wide linear range.
[0006] Due to the incompatibility of existing reporter plasmid replicons or screening markers, there is currently a lack of chemiluminescence reporter systems that can effectively work in O. pickettii. Therefore, the present application develops a luxCDABE chemiluminescence reporter plasmid suitable for O. pickettii, which has important significance for the gene function research of O. pickettii. SUMMARY
[0007] The present application provides a chemiluminescence reporter plasmid for detecting the transcription level of the target gene of O. pickettii.
[0008] Another object of the present application is to provide a construction method of the above-mentioned plasmid.
[0009] Still another object of the present application is to provide the application of the above-mentioned plasmid in detecting the transcription level of the target gene of O. pickettii.
[0010] The present application adopts the following technical solutions:
[0011] In the first aspect of the present application, a chemiluminescence reporter plasmid pBBR402 for detecting the transcription level of the target gene of O. pickettii is provided, which is composed of a replication origin, a replication protein gene, a resistance gene, a promoter insertion site, a chemiluminescence reporter gene and a transcription terminator connected in sequence. Further, the replication origin is oriV, and the replication protein gene is rep, both of which are from pBBR1MCS-2 plasmid. The resistance gene is kanamycin resistance gene, the promoter insertion site includes BamH I, Ava I and Xho I, the chemiluminescence reporter gene is luxCDABE gene cluster, and the transcription terminator is T1 Terminator, all of which are from pMS402 plasmid.
[0012] The oriV and rep from pBBR1MCS-2 plasmid can help the pBBR402 plasmid to replicate in the O. pickettii. The O. pickettii itself does not have kanamycin resistance, so the kanamycin resistance gene is suitable for screening the pBBR402 plasmid in the O. pickettii. The promoter insertion site is used for inserting the promoter of the foreign gene to be detected. The reporter gene cluster luxCDABE of luciferase from the pMS402 plasmid does not carry a promoter, so the promoter of the gene to be detected can be connected to the promoter insertion site in front of the luciferase gene, so that the promoter of the target gene starts the expression of the luxCDABE luciferase gene, wherein luxCDE encodes a reaction substrate synthetase, and luxAB encodes a luciferase. The reaction substrate synthetase promotes the synthesis of the substrate, and the luciferase promotes the synthesized substrate to produce a luminescence phenomenon, so that the transcription level of the target gene in different environments can be reflected by detecting the chemiluminescence intensity of the promoter reporter vector.
[0013] In another aspect of the present application, the construction method of the pBBR402 plasmid comprises the following steps as shown in the formula (I): Figure 1
[0014] The pBBR1MCS-2 plasmid, the pMS402 plasmid and the O. pickettii genome are respectively used as templates, and the following primers are used for amplification:
[0015]
[0016] The pBBR1MCS-2 plasmid is used as a template, pBBR1MCS2-pin-S and pBBR1MCS2-pin-A are used as primers, and the pBBR1MCS-2 splicing partial fragment is obtained by PCR amplification, and the sequence is shown in SEQ ID NO. 1. The pMS402 plasmid is used as a template, pMS402-pin-S and pMS402-pin-A are used as primers, and the pMS402 splicing partial fragment is obtained by PCR amplification, and the sequence is shown in SEQ ID NO. 2. The two fragments obtained above are respectively subjected to EcoR I and Kpn I double enzyme digestion, and the fragments with correct enzyme digestion band size are recovered by gel recovery. The two fragments are connected into a ring by T4 DNA ligase, and the pBBR402 plasmid is constructed by PCR verification and enzyme digestion verification, and the sequence is shown in SEQ ID NO. 4.
[0017] In another aspect of the present application, the application of the reporter plasmid in detecting the transcription level of the target gene of the O. pickettii.
[0018] On the basis of the above technical solutions, the acoA promoter fragment is obtained by PCR amplification with the acetobacter pasteurianus genome as a template and acoA-promoter-S and acoA-promoter-A as primers, and the sequence is shown as SEQ ID NO. 3. The acoA promoter fragment and the pBBR402 plasmid are respectively subjected to Xhol I and BamH I double enzyme digestion, and the fragments with correct enzyme digestion band sizes are respectively subjected to gel recovery. The above two fragments are connected into a loop by using T4 DNA ligase, and the pBBR402-acoA recombinant plasmid is constructed by PCR verification and enzyme digestion verification. The pBBR402-acoA recombinant plasmid is used for detecting the transcription level of the acoA gene of the acetobacter pasteurianus. The acetobacter pasteurianus competent cells are prepared, the pBBR402 plasmid and the pBBR402-acoA plasmid are respectively electroporated into the acetobacter pasteurianus competent cells, and the transformants are screened on a solid plate containing kanamycin. The solid plate covered with colonies is placed in a dark box, and the camera is exposed for 10 min, and the acetobacter pasteurianus into which the pBBR402-acoA plasmid is transferred emits light, while the acetobacter pasteurianus into which the pBBR402 plasmid is transferred does not emit light, proving that the light emission is derived from the specific transcription start of the acoA promoter, rather than from the plasmid itself. The correct single colony is picked and cultured in a liquid medium, and the bacterial liquid is taken in a 96-well plate every other time, and placed in an enzyme marker instrument to detect the OD 600 value and the light emission intensity LUM value of the bacterial liquid, so as to judge the transcription level of the acoA in the acetobacter pasteurianus according to the light emission intensity value (LUM / OD 600 ) under the unit cell density.
[0019] The application is used for constructing a chemiluminescence reporter plasmid and the application thereof in detecting the transcription level of the target gene of the acetobacter pasteurianus, and has the following characteristics compared with the prior art.
[0020] (1) The chemiluminescence reporter plasmid constructed in the application contains a promoter insertion site, and the promoter of a specific gene of the acetobacter pasteurianus can be inserted according to the experimental requirements, the transcription level of different genes is detected, and the chemiluminescence reporter plasmid has wide applicability to different genes of the acetobacter pasteurianus.
[0021] (2) The detection process of the chemiluminescence reporter plasmid constructed in the application is simple, the OD 600 value and the light emission intensity LUM value of the bacterial liquid can be detected by using an enzyme marker instrument at the same time, so as to directly obtain the light emission intensity under the unit cell density, and the specificity is high, and the transcription level of the target gene of the acetobacter pasteurianus can be efficiently and accurately detected. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 It is a schematic diagram of the construction process of the chemiluminescence reporter plasmid pBBR402 and pBBR402-acoA in Example 1 of the application.
[0023] Figure 2 The luminescence of Acetobacter pasteurii CICC 22518 with the report plasmid was detected in the dark box for 10 min in Example 2 of the present application, wherein 1 and 2 were Acetobacter pasteurii CICC 22518 with pBBR402-acoA plasmid, and 3 and 4 were Acetobacter pasteurii CICC 22518 with pBBR402 plasmid.
[0024] Figure 3 The luminescence of Acetobacter pasteurii CICC 22518 with the report plasmid was detected in the dark box for 10 min in Example 2 of the present application, wherein 1 and 2 were Acetobacter pasteurii CICC 22518 with pBBR402-acoA plasmid, and 3 and 4 were Acetobacter pasteurii CICC 22518 with pBBR402 plasmid. 600 DETAILED DESCRIPTION
[0025] The following examples are further illustrations of the present application and are not intended to limit the present application. The experimental methods in the examples, if not specified, were usually carried out according to the conventional conditions or according to the conditions suggested by the manufacturers.
[0026] Example 1: Construction of chemiluminescent report plasmid pBBR402
[0027] In this example, a report plasmid containing chemiluminescent reporter gene luxCDABE, promoter insertion site, kanamycin resistance gene, transcription terminator, and oriV and rep replication genes suitable for Acetobacter pasteurii was constructed, and the specific steps were as follows:
[0028] The pBBR1MCS-2 plasmid was used as a template, and pBBR1MCS2-pin-S and pBBR1MCS2-pin-A were used as primers to obtain a pBBR1MCS-2 plasmid splicing partial fragment by PCR amplification, and the sequence is shown as SEQ ID NO. 1; the pMS402 plasmid was used as a template, and pMS402-pin-S and pMS402-pin-A were used as primers to obtain a pMS402 plasmid splicing partial fragment by PCR amplification, and the sequence is shown as SEQ ID NO. 2. The above PCR products were subjected to agarose gel electrophoresis, and the band of the correct size was recovered. The pBBR1MCS-2 plasmid splicing partial fragment and the pMS402 plasmid splicing partial fragment were subjected to EcoR I and Kpn I double digestion, respectively, and the entire enzyme digestion system was subjected to agarose gel electrophoresis. The band of the correct size was recovered. The two fragments after double digestion were ligated into a ring by T4 DNA ligase, and the ligation product was transformed into E. coli DH5α by chemical transformation, and was inoculated on an LB (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride) solid plate containing kanamycin 50 μg / mL. Single colonies were picked and subjected to PCR verification using pBBR1MCS2-pin-S and pBBR1MCS2-pin-A and pMS402-pin-S and pMS402-pin-A as primers. The correct colonies were inoculated on an LB solid plate containing kanamycin 50 μg / mL, and the plasmid was extracted after the bacteria grew. The extracted plasmid was subjected to double digestion with EcoR I and Kpn I, and the un-digested plasmid and the digested plasmid were subjected to agarose gel electrophoresis. The correct pBBR402 plasmid was obtained, and the sequence is shown as SEQ ID NO. 4.
[0029] Example 2: Chemiluminescence reporter plasmid pBBR402 for detecting the transcription level of a gene of interest of O. pickettii
[0030] The acoA gene in O. pickettii CICC 22518 was used as an example, and a recombinant vector pBBR402-acoA was constructed for detecting the transcription level of acoA in O. pickettii CICC 22518, and the specific operation steps are as follows:
[0031] (1) With the genome of Acetobacter pasteurii CICC 22518 as a template, acoA-promoter-S and acoA-promoter-A as primers, acoA promoter fragment was obtained by PCR amplification, and the sequence is shown as SEQ ID NO. 3. The PCR product was subjected to agarose gel electrophoresis, and the band of the correct size was recovered. The acoA promoter fragment and pBBR402 plasmid were subjected to Xhol I and BamH I double digestion, respectively. The whole enzyme digestion system was subjected to agarose gel electrophoresis, and the band of the correct size was recovered. The double-digested pBBR402 plasmid was dephosphorylated, and then ligated with the double-digested acoA promoter fragment to form a circle. The ligation product was transformed into E. coli DH5α by chemical transformation, and then inoculated on LB solid plate containing kanamycin 50 μg / mL. The single colony was picked up, and PCR verification was performed with acoA-promoter-S and acoA-promoter-A as primers. The correct colonies were inoculated on LB solid plate containing kanamycin 50 μg / mL, and then the plasmid was extracted after the bacteria grew. The extracted plasmid was subjected to double digestion with Xhol I and BamH I, and the un-digested plasmid and the digested plasmid were subjected to agarose gel electrophoresis. The correct pBBR402-acoA plasmid was verified by the band of the correct size.
[0032] (2) Acetobacter pasteurii CICC 22518 was cultured in YPGE (tryptone 5 g / L, yeast powder 5 g / L, glycerol 5 g / L, ethanol 4%) liquid medium for 48 h, and then transferred to YPG (tryptone 5 g / L, yeast powder 5 g / L, glycerol 5 g / L) liquid medium at an inoculation amount of 10% and cultured to OD 600 =0.8. The bacteria were collected by centrifugation, and 10% glycerol at 4°C was used to prepare Acetobacter pasteurii CICC 22518 competent cells. pBBR402-acoA plasmid and pBBR402 plasmid were respectively electroporated into Acetobacter pasteurii CICC 22518 competent cells, and then the two recovered bacterial liquids were respectively inoculated on YPGA (tryptone 5 g / L, yeast powder 5 g / L, glycerol 5 g / L, acetoin 2 g / L) solid plate containing kanamycin 50 μg / mL.
[0033] (3) Place the solid plate covered with colonies in a dark chamber without opening the lid, and expose it to the camera for 10 min. Acetobacter pasteurellium CICC 22518 transformed with the pBBR402-acoA plasmid will luminesce, while Acetobacter pasteurellium CICC22518 transformed with the pBBR402 plasmid will not luminesce. This proves that the luminescence specifically originates from the transcriptional initiation of the acoA promoter, and not from the plasmid itself. Select the verified single colonies and culture them in YPGA liquid medium containing 50 μg / mL kanamycin. At regular intervals, take a fixed volume of bacterial solution into a 96-well plate and use a microplate reader to detect the OD of the bacterial solution. 600 and the luminescence intensity LUM value, based on the luminescence intensity LUM / OD per unit cell density. 600 The value is used to determine the transcription level of acoA in Acetobacter pasteurellosis.
[0034] The embodiments described above merely illustrate implementation methods of the present invention and should not be considered as limiting the scope of the present invention. The scope of protection of the present invention should be determined by the scope defined in the claims. Various modifications to the present invention by those skilled in the art based on the above description and drawings are also considered to be within the scope of the appended claims.
Claims
1. A reporter plasmid pBBR402 for detecting the transcription level of a target gene, characterized in that, The plasmid is suitable for Acetobacter pasteurellosis and is a chemiluminescent reporter plasmid, the sequence of which is shown in SEQ ID NO.
4.
2. The chemiluminescent reporter plasmid pBBR402 according to claim 1, characterized in that: The origin of replication (oriV) and replication protein gene (rep) were derived from the pBBR1MCS-2 plasmid; the kanamycin resistance gene, promoter insertion sites (BamHⅠ, AvaⅠ, and XhoⅠ), bioluminescent reporter gene (luxCDABE), and transcription terminator (T1 Terminator) were derived from the pMS402 plasmid.
3. The plasmid pBBR402 according to claim 1, characterized in that: The promoter insertion sites (BamHⅠ, AvaⅠ, and XhoⅠ) are used to connect the target gene promoter of Acetobacter pasteurellosis to drive the expression of the luxCDABE reporter gene.
4. The method for constructing plasmid pBBR402 according to claim 1, characterized in that, Includes the following steps: (1) Using pBBR1MCS-2 plasmid as template, PCR amplification was performed using primers pBBR1MCS2-pin-S and pBBR1MCS2-pin-A to obtain the pBBR1MCS-2 plasmid splice fragment. (2) Using pMS402 plasmid as a template, PCR amplification was performed using primers pMS402-pin-S and pMS402-pin-A to obtain the pMS402 plasmid splice fragment. (3) The PCR products from steps (1) and (2) were digested with EcoRI and KpnI, respectively, and the digested fragments were recovered. (4) The two enzyme-digested fragments were ligated into a circular shape using T4 DNA ligase to obtain the pBBR402 plasmid.
5. The method according to claim 4, characterized in that, The primer sequences are as follows: pBBR1MCS2-pin-S:ATTGGTACCTTGGTGTCCAACCGGCTCG pBBR1MCS2-pin-A:ATTGAATTCATAGTCTGGAACAGCGCACTTACG pMS402-pin-S:ATTGAATTCCTCGGGCAAATCGCTGAATA pMS402-pin-A:ATTGGTACCTCTAGGGCGGCGATTTGT.
6. The application of the bioluminescent reporter plasmid pBBR402 of claim 1 in detecting the transcriptional level of the target gene of Acetobacter pasteurellosis.
7. The application according to claim 6, characterized in that, Includes the following steps: (1) Using the genome of Acetobacter pasteurellii as a template, the promoter fragment of the gene to be tested in Acetobacter pasteurellii was amplified using specific primers; (2) The promoter fragment and the bioluminescent reporter plasmid pBBR402 were digested with corresponding enzymes, and after gel recovery, they were ligated with T4 DNA ligase to construct recombinant plasmids; (3) Electroporate the recombinant plasmid into competent cells of Acetobacter pasteurellosis and screen transformants on solid plates containing kanamycin; (4) The transformants obtained by culture and screening were tested for OD of the bacterial culture using an enzyme-linked immunosorbent assay (ELISA) reader. 600 Value and luminescence intensity LUM value, based on luminescence intensity per unit cell density (LUM / OD). 600 To determine the transcription level of the target gene.
8. The method according to claim 7, characterized in that, The target gene to be detected is the acoA gene, and the primer sequences are as follows: acoA-promoter-S:ATTCTCGAGTGTCTGCTTCTCCTCCAAACAG acoA-promoter-A:ATTGGATCCCTGCACAGCGTTACACGGGT.