A recombinant bacillus subtilis for producing L-fucose and a construction method and application thereof

Abstract

The application provides a kind of production L-fucose recombinant bacillus subtilis and its construction method and application, including recombinant bacillus subtilis BS164GF-pW, BS164FU;BS164GF-pW is obtained by cloning GDP-D-mannose hydrolase gene construction vector pMK4-T7-WcaH transformation recombinant bacillus subtilis BS164GF, BS164FU is obtained by integrating GDP-D-mannose hydrolase gene on BS164GF;The BS164GF is obtained by sequentially integrating comk gene, T7 RNA polymerase gene, T7-manA-manB-manC gene, T7-gmd-wcaG gene on bacillus subtilis genome.The application realizes the de novo synthesis of L-fucose by constructing recombinant bacillus subtilis for the first time with GDP-L-fucose as substrate, which is more environmentally friendly than traditional acid hydrolysis.

Description

Technical Field

[0001] This invention belongs to the field of microbial engineering, specifically relating to a recombinant Bacillus subtilis for producing L-fucose, its construction method, and its application. Background Technology

[0002] L-fucose (6-deoxy-L-galactose) is a monosaccharide widely found in plants, bacteria, and animals, primarily existing in nature as a polysaccharide. Brown algae, seagrass, and echinoderms contain a class of fucose-rich sulfate carbohydrates called fucoidan. L-fucose is a major component of bacterial extracellular polysaccharides (EPS), and in mammalian cells, it exhibits numerous N- and O-terminal modifications at the fucose end, linking glycans and glycolipids. The structural difference between fucose and other hexoses lies in the absence of a hydroxyl group at the 6-carbon position. L-fucose and fucose-containing molecules, such as fucosyl oligosaccharides and fucoidan, possess biological activity and perform unique physiological functions. The monosaccharide fucose can serve as an energy source, adhesion site, or virulence factor for bacteria. In human hosts, many antibodies target fucose-containing glycan motifs, which can influence the outcome of immune responses, protecting the host from infection and inflammation. Fucosyl oligosaccharides constitute the largest proportion of identified human milk oligosaccharides (HMOs) and are crucial for infant growth and health. For example, 2'-fucosyllactose has physiological functions such as inhibiting pathogens, preventing allergic diseases, promoting the growth of probiotics, and promoting the development of the infant's immune system and brain. In addition, fucoidan has an inhibitory effect on a range of respiratory viruses by inhibiting viral attachment, entry, and replication.

[0003] L-fucose can be extracted from brown algae via acid hydrolysis or from fucose-rich microbial extracellular polysaccharides via enzymatic hydrolysis. These hydrolysis methods require purification of fucose from the sugar mixture. Some isohexoses can also be converted to L-fucose chemically. However, these L-fucose production methods are environmentally unfriendly or uneconomical, limiting their application. Therefore, designing and constructing artificial synthetic pathways from sustainable carbon sources using classic engineered microorganisms is an efficient and environmentally friendly approach. As a GRAS (Generally Regarded As Safe) strain, Bacillus subtilis does not produce pyrogens or endotoxins and has no toxic side effects, reducing subsequent separation and purification costs, making it suitable for L-fucose production. Currently, there are no reported technologies or studies demonstrating de novo L-fucose synthesis using Bacillus subtilis. Summary of the Invention

[0004] The purpose of this invention is to provide a recombinant Bacillus subtilis strain for producing L-fucose, its construction method, and its application, thereby solving the problems of low economic efficiency and environmental unfriendliness in existing L-fucose production methods.

[0005] To solve the above problems, the present invention adopts the following technical solution:

[0006] According to a first aspect of the present invention, a method for constructing recombinant Bacillus subtilis for producing L-fucose is provided, comprising the following steps: 1) integrating a gene sequence encoding the transformation transcription factor comK regulated by the PmtlA promoter into the nprE site of the Bacillus subtilis genome; after eliminating the resistance gene, integrating a T7 gene regulated by the P43 promoter into the aprE site. 1) An RNA polymerase gene fragment was used to obtain recombinant Bacillus subtilis BS164MCT; 2) Based on the recombinant Bacillus subtilis BS164MCT obtained in step 1), a gene fragment encoding mannose-6-phosphate isomerase, phosphogmannose mutase, and mannose-1-phosphate guanylate transferase, controlled by the T7 promoter, was integrated at the srfAA site; after eliminating the resistance gene, a gene fragment encoding GDP-mannose dehydratase and GDP-L-fucose synthase, controlled by the T7 promoter, was integrated at the bacA site to obtain recombinant Bacillus subtilis BS164GF; 3) GDP-D-mannose water from Escherichia coli K-12 or its derivative strains was cloned. 4) Transform the high-efficiency expression plasmid pMK4-T7-WcaH controlled by the T7 promoter into the expression vector pMK4; 5) Transform the high-efficiency expression plasmid pMK4-T7-WcaH obtained in step 3) into the recombinant Bacillus subtilis BS164GF obtained in step 2) to obtain a recombinant Bacillus subtilis BS164GF-pW that produces L-fucose; 6) Based on the recombinant Bacillus subtilis BS164GF obtained in step 2), integrate the gene fragment encoding GDP-D-mannose hydrolase controlled by the T7 promoter at the rocD site to obtain another recombinant Bacillus subtilis BS164FU that produces L-fucose.

[0007] In a preferred embodiment, the gene sequence encoding the transforming transcription factor comK is controlled by the mannitol-inducible promoter PmtlA, and the gene sequence encoding the transforming transcription factor comK is the sequence shown in SEQ ID NO:1, or a sequence having more than 85% homology with SEQ ID NO:1 and having the same function; the gene encoding the T7 RNA polymerase is controlled by the T7 promoter, and the fusion gene fragment encoding the T7 RNA polymerase is the sequence shown in SEQ ID NO:2, or a sequence having more than 85% homology with SEQ ID NO:2 and having the same function.

[0008] As a preferred embodiment, the fusion gene fragment encoding mannose-6-phosphate isomerase, mannose phosphate mutase, and mannose-1-phosphate guanylate transferase is the sequence shown in SEQ ID NO:3, or a sequence having more than 85% homology with SEQ ID NO:3 and having the same function; the fusion gene fragment encoding GDP-mannose dehydratase and GDP-L-fucose synthase is the sequence shown in SEQ ID NO:4, or a sequence having more than 85% homology with SEQ ID NO:4 and having the same function.

[0009] As a preferred embodiment, the pMK4-T7-WcaH is a high-efficiency expression plasmid vector, which clones a gene of GDP-D-mannose hydrolase from Escherichia coli K-12 or its derivative strains into the expression vector pMK4. The nucleotide sequence of the pMK4-T7-WcaH is shown in SEQ ID NO:5, or is a sequence that has more than 85% homology with SEQ ID NO:5 and has the same function.

[0010] As a preferred embodiment, the recombinant Bacillus subtilis BS164FU that produces L-fucose encodes a fusion gene fragment of GDP-D-mannose hydrolase that is the sequence shown in SEQ ID NO:6, or a sequence that has more than 85% homology with SEQ ID NO:6 and has the same function.

[0011] According to a preferred embodiment of the present invention, the nucleotide sequences of the PmtlA comk gene, P43 T7 RNAP gene, T7-manA-manB-manC gene, T7-gmd-wcaG gene, pMK4-T7-WcaH plasmid, and GDP-D-mannose hydrolase gene are as shown in SEQ ID NO:1-6.

[0012] As a preferred embodiment, the Bacillus subtilis is Bacillus subtilis ATCC 6051a.

[0013] According to a second aspect of the present invention, a recombinant Bacillus subtilis strain for producing L-fucose is provided, comprising recombinant Bacillus subtilis BS164GF-pW and recombinant Bacillus subtilis BS164FU capable of producing L-fucose; the recombinant Bacillus subtilis BS164GF-pW is obtained by constructing a high-efficiency expression plasmid vector pMK4-T7-WcaH by cloning the gene of GDP-D-mannose hydrolase, and transforming it into recombinant Bacillus subtilis BS164GF; the recombinant Bacillus subtilis BS164FU is obtained by integrating the gene encoding GDP-D-mannose hydrolase into the rocD site of recombinant Bacillus subtilis BS164GF; wherein the recombinant Bacillus subtilis BS164GF is obtained by sequentially integrating the conk gene encoding the transformation transcription factor into the nprE site and the T7 gene into the aprE site using Bacillus subtilis as the starting strain. The RNA polymerase gene was obtained by integrating genes encoding mannose-6-phosphate isomerase, mannose phosphate mutase, and mannose-1-phosphate guanosine transferase at the srfAA site, and genes encoding GDP-mannose dehydratase and GDP-L-fucose synthase at the bacA site.

[0014] As a preferred embodiment, the recombinant Bacillus subtilis BS164GF-pW and recombinant Bacillus subtilis BS164FU capable of producing L-fucose are obtained through the construction method mentioned above.

[0015] According to a third aspect of the invention, an application of the recombinant Bacillus subtilis for producing L-fucose is also provided, wherein the recombinant Bacillus subtilis BS164GF-pW and recombinant Bacillus subtilis BS164FU are used to ferment and produce L-fucose.

[0016] As a preferred embodiment, the carbon source for the fermentation of recombinant Bacillus subtilis BS164GF-pW and recombinant Bacillus subtilis BS164FU to produce L-fucose is selected from glycerol, glucose, sucrose, xylose, fructose, mannose, starch or konjac flour.

[0017] As a preferred embodiment, the culture medium for fermenting recombinant Bacillus subtilis BS164GF-pW and recombinant Bacillus subtilis BS164FU to produce L-fucose contains 24-26 g / L of carbon source.

[0018] The present invention also provides a shake-flask fermentation method for producing L-fucose-producing recombinant Bacillus subtilis. The method is as follows: 1% of overnight cultured recombinant Bacillus subtilis culture is added to the culture medium, and 10% glycerol is added after 4-8 hours. The recombinant Bacillus subtilis is fermented under the above culture conditions to produce L-fucose.

[0019] Compared with the prior art, the recombinant Bacillus subtilis for producing L-fucose, its construction method, and its application provided by the present invention have the following advantages:

[0020] 1) The technical solution of this invention constructs a recombinant Bacillus subtilis and achieves the de novo synthesis of L-fucose for the first time using GDP-L-fucose as a direct substrate;

[0021] 2) The technical solution of this invention constructs and ferments recombinant Bacillus subtilis to produce L-fucose using a relatively inexpensive carbon source. Compared with the traditional acid hydrolysis method for producing L-fucose, this method is more environmentally friendly and makes it easier to separate and purify the product.

[0022] 3) The Bacillus subtilis strain used in the production of this invention is a food-safe strain, and the product will not be contaminated by endotoxins, making it more suitable for use as a functional food additive. Attached Figure Description

[0023] Figure 1 This is a schematic diagram illustrating the construction of recombinant Bacillus subtilis BS164FU in Example 1 of the present invention;

[0024] Figure 2 This is a schematic diagram of the expression plasmid pMK4-T7-WcaH and the construction diagram of recombinant Bacillus subtilis BS164GF-pW in Example 2 of the present invention;

[0025] Figure 3 Peak patterns of L-fucose detected by high performance liquid chromatography;

[0026] Figure 4 This is a schematic diagram showing the product changes over time during fed-batch fermentation of recombinant Bacillus subtilis BS164FU to produce L-fucose in Example 4 of the present invention. Detailed Implementation

[0027] The technical solution of the present invention will be described in detail below with reference to the embodiments. Operations not specifically described in the embodiments shall be performed under conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, all reagents and biological materials used below are commercial products.

[0028] The sources of the biological materials used in the following embodiments are as follows:

[0029] Bacillus subtilis ATCC 6051a is the type strain of the American Type Culture Collection (ATCC), and 6051a is its collection number. It can be purchased from the American Type Culture Collection (ATCC).

[0030] The ClonExpress Ultra One Step Cloning Kit (C115-01) and 2×Phanta Master Mix (P511-01) used in each example were purchased from Nanjing Novizan Biotechnology Co., Ltd.; the restriction endonuclease QuickCut™ Dpn I (C1609) was purchased from TaKaRa; erythromycin (C808819) and chloramphenicol (C804169) were purchased from Shanghai Maclean Biochemical Technology Co., Ltd.; and L-fucose standard was purchased from Shanghai Huicheng Biotechnology Co., Ltd.

[0031] Explanation of abbreviations in the embodiments:

[0032] GDP: Guanosine triphosphate

[0033] HPLC: High Performance Liquid Chromatography

[0034] ManA: mannose-6-phosphoisomerase

[0035] ManB: Phosphomannose mutase

[0036] ManC: Mannose-1-phosphoguanylate transferase

[0037] Gmd: GDP-mannose dehydratase

[0038] WcaG: GDP-L-fucose synthase

[0039] WcaH: GDP-D-mannose hydrolase

[0040] Table 1. Primer sequences (SEQ ID NO:7-54) and their uses used in this embodiment.

[0041] name Primer sequence (5'-3') use npr1F gtgtttcgtccgcataatcaaaaacaatagagc Amplifying the upstream homologous arm of the nprE site npr1R taaaaataaaaaggctcctggtttattaggaaaagcctgagatccctcagg Amplifying the upstream homologous arm of the nprE site PmtlAF agggatctcaggcttttcctaataaaccaggagcctttttatttttaaaaaattgtcac Amplification of the mannitol promoter PmtlA PmtlAR aaggtgcgtctgttttctgactcatatataaaccctccctgttttgtttgtcgc Amplification of the mannitol promoter PmtlA ComkF caaacaaaacagggagggtttatatatgagtcagaaaacagacgcacctt Amplification of the comk gene ComkR cggtagcggccgcaagcttggatcccatatgactttggatccaagagaatat Amplification of the comk gene comErmF attctcttggatccaaagtcatatgggatccaagcttgcggccgctaccg Amplifying erythromycin resistance fragments comErmR cagtattttcaaaaagggggatttatttaagttagcccgggcatatgtaccgt Amplifying erythromycin resistance fragments npr2F gtacatatgcccgggctaacttaaataaatccccctttttgaaaatactg Amplifying the downstream homologous arm of the nprE site npr2R catgacagccatcgtcacccacttattc Amplifying the downstream homologous arm of the nprE site apr1F acgacggccagtgaattccatcgcttcttttaacgaaagattc Amplifying the upstream homologous arm of the aprE site PaprER ctttgatttttagatatctctttaccctctccttttaaaaaaa Amplifying the upstream homologous arm of the aprE site T7PF gatatctaaaaatcaaagggggaaatgg Amplification of T7 RNA polymerase T7PR ttacgcgaacgcgaagtccgactct Amplification of T7 RNA polymerase T7ErmF gacttcgcgttcgcgtaaggatccaagcttgcggccgctaccg Amplifying erythromycin resistance fragments T7ErmR taagttagcccgggcatatgtaccg Amplifying erythromycin resistance fragments apr2F tatgcccgggctaacttatagtaaaaagaagcaggttcctcca Amplifying the downstream homologous arm of the aprE site apr2R tcgacgggcccgggatccgccagctgggctaaggatcaggtta Amplifying the downstream homologous arm of the aprE site P43-F tgcttggcgaatgttcattcaaaagcttcgtgcatgcaggccg Amplifying the p43 promoter P43-R ctttgatttttagatatcgtgtacattcctctcttacctataa Amplifying the p43 promoter UmanF gcctgtagctcaaattttcgcctct Amplifying the upstream homologous arm of the manA site UmanR gcggccgcaagcttaagcttaaaaagaaaatcccccgctttattcgattt Amplifying the upstream homologous arm of the manA site manErmF aaatcgaataaagcgggggattttctttttaagcttaagcttgcggccgc Amplifying erythromycin resistance fragments manErmR aagatcgggctcgccacgaattcggtacccccgggcatatgtaccg Amplifying erythromycin resistance fragments T7manBF ttcgtggcgagcccgatcttccccatcggtgatg Amplification of the manBmanC gene fragment manCR cctccttactcgttcagcaacgtcagcaga Amplification of the manBmanC gene fragment manAF ggaggaactactatgacgactgaaccgttatttttca Amplifying the manA homologous arm manAR gccctgccatgttacagatgggagacgataca Amplifying the manA homologous arm UbacF attattaatcaagacatcgagcccgc Amplifying the upstream homologous arm of the bacA site UbacR ggatcatatggtgcactctcagtaccatcagcataaggaggtccaaatcg Amplifying the upstream homologous arm of the bacA site bacErmF cgatttggacctccttatgctgatggtactgagagtgcaccatatgatcc Amplifying erythromycin resistance fragments bacErmR tttaaagggtttttttgtttgtatgggtttttaagcttaagcttgcggcc Amplifying erythromycin resistance fragments T7gmdF ccgaattcgtggcgagcccgatcttcccccatc Amplification of the gmdwcaG gene fragment wcaGR tacccccgaaagcggtcttgattctca Amplification of the gmdwcaG gene fragment DbacF cgcaagcttaagcttaaaaacccatacaaacaaaaaaaccctttaaaaag Amplifying the downstream homologous arm of the bacA site DbacR caaggtgatgggactgatcgtttca Amplifying the downstream homologous arm of the bacA site pMK4-F gaattcctgctaacaaagcccgaaagg Amplifying the pMK4 vector backbone pMK4-R ggtatatcctcctttcttaaagtta Amplifying the pMK4 vector backbone rocUF atatgccatttatgcagaagggggt Amplifying the upstream homologous arm of the rocD site rocUR gcggccgcaagcttaagcttaaaaaatcaaaccggaaaacgtcgtcatca Amplifying the upstream homologous arm of the rocD site ErmwHF tgatgacgacgttttccggtttgattttttaagcttaagcttgcggccgc Amplifying erythromycin resistance fragments ErmwHR caaagtcttcctgacgtaaaaaCATggtatatcctcctttctt Amplifying erythromycin resistance fragments EWcaHF aagaaaggaggatataccATGtttttacgtcaggaagactttg Amplification of the wcaH gene EWcaHR ctttgttagcaggaattcttataatccgggtactccggtacgc Amplification of the wcaH gene rocDF ggatcatatggtgcactctcagtacgaaattttctcactcgtctaacgaa Amplifying the downstream homologous arm of the rocD site rocDR ggaaggtcattggcatcaattcaat Amplifying the downstream homologous arm of the rocD site WcaHF aagaaaggaggatataccatgtttttacgtcaggaagactttgc Amplification of the wcaH gene WcaHR ctttgttagcaggaattcttataatccgggtactccggtacgc Amplification of the wcaH gene

[0042] Example 1: Construction of recombinant Bacillus subtilis BS164FU

[0043] Recombinant Bacillus subtilis BS164FU is a DNA sequence integrated into the genome of Bacillus subtilis ATCC 6051a. For example... Figure 1As shown, PmtlA comk cassette was integrated at the nprE site (SEQ ID NO:1), P43 T7 RNAP cassette was integrated at the aprE site (SEQ ID NO:2), T7-manA-manB-manC cassette was integrated at the srfAA site (SEQ ID NO:3), T7-gmd-wcaG cassette was integrated at the bacA site (SEQ ID NO:4), and T7-wcaH cassette was integrated at the rocD site (SEQ ID NO:6).

[0044] SEQ ID NO:1 (PmtlA comk cassette)

[0045]

[0046] SEQ ID NO:2 (P43-T7P):

[0047]

[0048] SEQ ID NO:3 (PT7-manB-manC-manA):

[0049]

[0050] SEQ ID NO:4 (PT7-gmd-wcaG)

[0051]

[0052] SEQ ID NO:6 (T7-wcaH)

[0053] taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactttaagaaaggaggatataccATGtttttacgtcaggaagactttgccacggtagtgcgctccactccgcttgtctctctcgactttattgtcgagaacagtcgcggcgagtttctgcttggcaaatttaccaaccgcccggcgcagggttactggtttgtgccgggagggcgcgtgcagaaagacgaaacgctggaagccgcatttgagcggctgacgatggcggaactggggctgcgtttgccgataacagcaggccagttttacggtgtctggcagcacttttatgacgataacttctctggcacggataagaccactcactatgtggtgctcggttttcgcttcagagtatcggaagaagagctgttactgccggatgagcagcatgacgattaccgctggctgacgtcggacgcgctgctcgccagtgataatgttcatgctaacagccgcgcctattttctcgctgagaagcgtaccggagtacccggattataa

[0054] The specific construction method of recombinant Bacillus subtilis BS164FU is as follows:

[0055] First, linear DNA fragments were prepared. Taking PmtlA comk cassette as an example, it was obtained by fusion PCR from five separate DNA fragments: U-nprE, ermC, PmtlA, comk, and D-nprE. First, using the Bacillus subtilis ATCC 6051a genome as a template, U-nprE, D-nprE, PmtlA, and comK were amplified; using the synthesized resistance gene DNA fragment ermC as a template, ermC was amplified. The above five DNA fragments were amplified using 2×Phanta Master Mix. The PCR system consisted of 25 μL 2×Phanta Master Mix, 2.5 μL F-terminal primer (10 μM), 2.5 μL R-terminal primer (10 μM), 0.5 μL template, and 19.5 μL ddH2O. The PCR reaction conditions were: pre-denaturation at 95℃ for 5 min, denaturation at 95℃ for 15 s, annealing at 55℃ for 15 s, extension at 72℃ for 1-3 min, for a total of 30 cycles. The PCR products were detemplated using QuickCut™ Dpn I according to the product instructions, and then purified and recovered using the AxyPrep PCR Clean Kit according to the product instructions. The concentration of the DNA fragments was determined using Nanodrop. The five fragments were fused using fusion PCR. The fusion PCR method was as follows: the PCR reaction mixture consisted of 10 μL of 2× Phanta Master Mix, 200 ng of each of the five fragments, and ddH2O was added to a final volume of 20 μL. The first round of PCR was performed under the following conditions: pre-denaturation at 95 °C for 5 min, followed by denaturation at 95 °C for 15 s, annealing at 60 °C for 15 s, and extension at 72 °C for 3 min, for a cycle count of 10. A second round of fusion PCR was then performed using the following reaction mixture: 25 μL 2×Phanta Master Mix, 2.5 μL of U-nprE F-terminal primer (10 μM), 2.5 μL of D-nprE R-terminal primer (10 μM), 1 μL of the first round PCR product, and 19 μL ddH2O. The PCR conditions were: pre-denaturation at 95 °C for 5 min, followed by denaturation at 95 °C for 15 s, annealing at 55 °C for 15 s, and extension at 72 °C for 3 min, for a cycle count of 30, to obtain the fusion fragment PmtlA comk cassette. The obtained PmtlA comk cassette was then transformed into Bacillus subtilis ATCC6051a and evenly spread on a plate containing 10 μg / mL erythromycin resistance. The plate was then incubated overnight at 37 °C.Transformants were identified by colony PCR. Positive transformants were identified as colonies of *PmtlA comk cassette* integrated into the genome of *Bacillus subtilis* ATCC 6051a. Using the selected positive transformant strains as templates, the integrated fragment was amplified with 2 × PhantaMaster Mix. The PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Transformants whose sequencing results were verified were named *Bacillus subtilis* BS164MC.

[0056] Next, following similar steps as described above, P43 T7RNAP cassette is integrated into the aprE site of Bacillus subtilis 164MC to obtain recombinant Bacillus subtilis BS164MCT.

[0057] Then, T7-manA-manB-manCcassette is integrated into the srfAA site of recombinant Bacillus subtilis BS164MCT, and T7-gmd-wcaG cassette is integrated into the bacA site to obtain recombinant Bacillus subtilis BS164GF.

[0058] Finally, T7-wcaH cassette was integrated into the rocD site of recombinant Bacillus subtilis BS164GF, and the resulting strain was recombinant Bacillus subtilis BS164FU.

[0059] Example 2: Construction of recombinant plasmid pMK4-T7-WcaH and recombinant Bacillus subtilis BS164GF-pW

[0060] The GDP-D-mannose hydrolase gene or its mutant from *Escherichia coli* K-12 or its derivative strains was cloned into the expression vector pMK4 to construct a high-efficiency expression plasmid pMK4-T7-WcaH controlled by the T7 promoter. Then, this plasmid pMK4-T7-WcaH was transformed into the recombinant *Bacillus subtilis* BS164GF prepared in Example 1, resulting in the recombinant *Bacillus subtilis* BS164GF-pW strain. The construction process is as follows: Figure 2 As shown.

[0061] The specific construction methods of recombinant plasmid pMK4-T7-WcaH and recombinant Bacillus subtilis BS164GF-pW are as follows:

[0062] First, the T7 promoter and terminator fragments were amplified from the pET28a(+) vector by PCR and cloned into the pMK4 plasmid to obtain pMK4T7N. Then, the expression elements of the vector were obtained from the pMK4T7N plasmid by PCR. The PCR amplification system consisted of 25 μL 2×Phanta Master Mix, 2.5 μL pMK4-F (10 μM), 2.5 μL pMK4-R (10 μM), 0.5 μL template, and 19.5 μL ddH2O. The PCR reaction conditions were: pre-denaturation at 95 ℃ for 5 min, followed by denaturation at 95 ℃ for 15 s, annealing at 55 ℃ for 15 s, and extension at 72 ℃ for 2 min, for a cycle number of 30. Similarly, the wcaH fragment was amplified using the same PCR reaction system and PCR program, with the BL21(DE3) strain genome as the template and wcaHF / wcaHR primers as described above. The PCR product was purified using the Axygen PCR Clean Kit and then ligated using the ClonExpress II One Step Cloning Kit. The ligation solution was transformed into E. coli DH5α, and the recombinant plasmid pMK4-T7-WcaH was isolated from E. coli. The sequence of pMK4-T7-wcaH is shown in SEQ ID NO:5.

[0063] SEQ ID NO:5 (pMK4-T7-wcaH)

[0064]

[0065] The extracted plasmid was transformed into Bacillus subtilis BS164GF prepared in Example 1 according to the transformation method in Example 1, so as to obtain recombinant Bacillus subtilis BS164GF-pW.

[0066] Example 3: L-fucose production by shake-flask fermentation of recombinant Bacillus subtilis BS164FU and BS164GF-pW

[0067] The fermentation medium chosen was LB medium, consisting of 10 g / L peptone, 5 g / L yeast extract, and 10 g / L NaCl.

[0068] The recombinant Bacillus subtilis BS164FU prepared in Example 1 and the recombinant Bacillus subtilis BS164GF-pW prepared in Example 2 were activated by streaking on LB agar plates. Single colonies were then picked and cultured in test tubes containing 3 mL of LB medium, and incubated overnight at 37°C with shaking at 200 rpm. 0.5 mL of the culture was inoculated into a 500 mL shake flask containing 50 mL of fresh LB medium and incubated at 37°C with shaking at 200 rpm. After 6 h of cell growth, different concentrations of carbon sources (glycerol, glucose, sucrose, or fructose, etc.) were added. Cell growth was then assessed every 12 h, and L-fucose production was detected by liquid chromatography. The method is as follows: Shimadzu HPLC system, model 20AVP, using an Aminex HPX-87H column (300×7.8 mm) (Bio-Rad, USA), with 5 mM H2SO4 as the mobile phase, a flow rate of 0.6 mL / min, a column temperature of 65℃, and a parallax detector (model RID-10A) for detection.

[0069] The results are as follows Figure 3 As shown, L-fucose was successfully produced from the fermentation broths of recombinant Bacillus subtilis BS164FU and BS164GF-pW. Shake-flask fermentation results showed that BS164GF-pW could produce L-fucose with a yield of 1.6 g / L when glycerol was used as the carbon source. Knocking wcaH into the rocD site into the constructed BS164FU increased the yield by 1.5 times. Carbon source experiments showed that L-fucose could be produced using glycerol and glucose, with glycerol being the optimal carbon source. Shake-flask fermentation experiments indicated that the maximum L-fucose yield of 2.4 g / L was achieved when using glycerol at a concentration of 20 g / L as the carbon source.

[0070] Example 4: L-fucose production by fed-bacterial fermentation of recombinant Bacillus subtilis

[0071] Taking recombinant Bacillus subtilis BS164FU as an example, fed-batch fermentation was used to produce L-fucose. The first step was to prepare the seed culture for fermentation. The process was as follows: First, the prepared recombinant Bacillus subtilis BS164FU was streaked onto an LB agar plate for activation. Then, a single colony was picked and cultured in a test tube containing 3 mL of LB medium, and incubated overnight at 37°C with shaking at 200 rpm. 0.5 mL of the overnight culture was inoculated into a 500 mL shake flask containing 50 mL of fresh LB medium, and incubated for another 8 hours at 37°C with shaking at 200 rpm. The seed culture was then inoculated into the fermentation medium at an inoculation rate of 5%. The fermentation medium consisted of: 25 g / L glycerol, 5 g / L yeast extract, 20 g / L peptone, 10 g / L potassium dihydrogen phosphate, 5 g / L ammonium sulfate, 3 g / L magnesium chloride hexahydrate, 10 g / L corn steep liquor, and 1 g / L antifoaming agent. The 5 L fermenter was filled with 3 L of liquid and sterilized at 115℃ for 20 min before use. The initial pH of fermentation was 6.5. The fermentation control parameters were: aeration rate of 5 L / min, rotation speed of 800 rpm, temperature of 37℃, and the pH of the fermenter was maintained at approximately 6.5 by adding glycerol and ammonia. During fermentation, the glycerol content was controlled to be >20 g / L. Samples were taken periodically, and the yield of L-fucose and the consumption of glycerol were determined by liquid chromatography. The liquid chromatography method was the same as in Example 3.

[0072] See Figure 4 This is a schematic diagram showing the product changes over time during fed-bacterial fermentation of recombinant Bacillus subtilis BS164FU to produce L-fucose. The fed-bacterial fermentation results show that the L-fucose yield continuously accumulated during the culture process, reaching a maximum yield of 6.8 g / L at 96 h of fermentation.

[0073] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of the invention. Various variations can be made to the above embodiments of the present invention. All simple and equivalent changes and modifications made in accordance with the claims and description of this application fall within the protection scope of the claims of this patent. All aspects not described in detail in this invention are conventional technical content.

Claims

1. A method for constructing a recombinant Bacillus subtilis strain for producing L-fucose, characterized in that, Includes the following steps: 1) PmtlA comk cassette was integrated into the nprE site of the Bacillus subtilis ATCC 6051a genome, the sequence of which is shown in SEQ ID NO:1; after eliminating the resistance gene, P43 T7 RNAP cassette was integrated into the aprE site, the sequence of which is shown in SEQ ID NO:2, to obtain recombinant Bacillus subtilis BS164MCT; 2) Based on the recombinant Bacillus subtilis BS164MCT obtained in step 1), a T7-manA-manB-manC cassette is integrated at the srfAA site, the sequence of which is shown in SEQ ID NO:3; after eliminating the resistance gene, a T7-gmd-wcaG cassette is integrated at the bacA site, the sequence of which is shown in SEQ ID NO:4, to obtain recombinant Bacillus subtilis BS164GF; 3) Construct the expression plasmid pMK4-T7-WcaH controlled by the T7 promoter, the gene sequence of which is shown in SEQ ID NO:5; 4) Transform the expression plasmid pMK4-T7-WcaH obtained in step 3) into the recombinant Bacillus subtilis BS164GF obtained in step 2) to obtain a recombinant Bacillus subtilis BS164GF-pW that produces L-fucose; 5) Based on the recombinant Bacillus subtilis BS164GF obtained in step 2), T7-wcaH cassette is integrated at the rocD site. The sequence of T7-wcaH cassette is shown in SEQ ID NO:6, to obtain another recombinant Bacillus subtilis BS164FU that produces L-fucose.

2. A recombinant Bacillus subtilis strain for producing L-fucose, obtained using the construction method described in claim 1, characterized in that, This includes recombinant Bacillus subtilis BS164GF-pW and recombinant Bacillus subtilis BS164FU, which can produce L-fucose.

3. The application of the recombinant Bacillus subtilis strain for producing L-fucose as described in claim 2, characterized in that, L-fucose was produced by fermentation using the recombinant Bacillus subtilis BS164GF-pW and recombinant Bacillus subtilis BS164FU.

4. The application according to claim 3, characterized in that, The carbon source for the fermentation of L-fucose by recombinant Bacillus subtilis BS164GF-pW and recombinant Bacillus subtilis BS164FU is selected from glycerol, glucose, sucrose, xylose, fructose, mannose, starch, and konjac flour.

Images