A method and kit for detecting the concentration of a target molecule in a mixed system

Abstract

The present application relates to a kind of methods for quantitatively detecting target molecule X concentration, comprising: adding reporter molecule A to the reaction system comprising the target molecule X and lasting at least first given time, wherein the specific binding activity between the reporter molecule A and target molecule X;Competitive molecule B is added to the reaction system, the specific binding activity between the competitive molecule B and the reporter molecule A does not have any binding activity with the target molecule X, when the target molecule X is not present, when the competitive molecule B is combined with the reporter molecule A, it emits the fluorescence intensity L0 of given intensity;Mix the system and detect the fluorescence intensity L of the system after waiting at least second given time;In ideal concentration range, the concentration of target molecule X can be linearly related with L0-L value;The linear relationship established above is used as standard curve, and the concentration of target molecule X can be calculated from the actual measured fluorescence intensity change value L0-L.The present application also relates to the kit matched with the above method.

Description

[0001] This case is a divisional application of the invention patent application filed on December 10, 2020, with application number 202011434928.2 and invention title "A method and reagent kit for detecting the concentration of target molecules in a mixed system". Technical Field

[0002] This invention relates to the field of chemical analysis technology, specifically to a method and kit for detecting the concentration of target molecules in a mixed system. Background Technology

[0003] The detection of substance concentration has wide applications in chemical engineering, biomedicine, and medicine. The research on nucleic acid aptamers, which emerged and developed in the 1990s, has further propelled the development of this field. Nucleic acid aptamers are short oligonucleotide sequences or short polypeptides obtained through in vitro screening that can bind to corresponding ligands with high affinity and strong specificity. Their emergence has provided the chemical biology and biomedical communities with a new, efficient, and rapid identification research platform, and has shown promising application prospects in many areas.

[0004] Traditional methods for detecting target molecule concentrations using nucleic acid aptamers mostly involve G4 conjugate color development, fluorescence energy resonance transfer, complex primer and probe design, and relatively cumbersome experimental procedures. This results in a lack of good balance between time, cost, specificity, sensitivity, and simplicity among various detection methods.

[0005] The Cas12a protein complex with crRNA can recognize and bind to a specific sequence of single-stranded DNA, subsequently exhibiting remarkable trans-cleavage activity. Therefore, single-stranded DNA fluorescent reporter molecules in the Cas12a binding system have been used in DNA detection research. Recently, Zhang Lixin and Tan Gaoyi's team developed a "cat's nose" method, utilizing the characteristic of small allosteric proteins to release DNA in the presence of specific small molecules, binding to Cas12a for target molecule detection. However, this method can only detect small molecules containing the corresponding allosteric protein, which has significant limitations. Summary of the Invention

[0006] Therefore, this application develops a detection method for target molecule binding aptamers and CRISPR technology, named Molecularradar (…). r andom Molecular a ptamer- d ependent CRISPR- a ssist r This method can quantitatively detect any small molecule within 0.5 hours.

[0007] The technical solution provided in this application is:

[0008] 1. A method for quantitatively detecting the concentration of target molecule X, comprising:

[0009] Add reporter molecule A to a reaction system containing the target molecule X and wait for at least a first given time, wherein the reporter molecule A has specific binding activity with the target molecule X;

[0010] A competing molecule B is added to the reaction system. The competing molecule B has specific binding activity with the reporter molecule A but no binding activity with the target molecule X. When the target molecule X is not present, the competing molecule B emits a fluorescence intensity L0 of a given intensity when it binds to the reporter molecule A.

[0011] After mixing the system and waiting for at least a second given time, the fluorescence intensity L of the system is detected.

[0012] Within the ideal concentration range, the concentration of target molecule X can establish a linear relationship with the L0-L value;

[0013] Using the linear relationship established above as a standard curve, the concentration of the target molecule X can be calculated from the actual measured fluorescence intensity change value L0-L.

[0014] 2. The method according to item 1, wherein the target molecule X is any molecule suitable for screening nucleic acid aptamers.

[0015] 3. The method according to item 2, wherein the reporter molecule A is ssDNA, and the reporter molecule ssDNA comprises at least two parts: a nucleic acid aptamer ssDNA capable of specifically binding to the target molecule X, and a fluorescent-quenched probe ssDNA carrying a fluorescent group and a quenching group and a fixed sequence.

[0016] 4. The method according to claim 3, wherein the competing molecule B is a Cas12a / crRNA complex, wherein the crRNA is capable of specifically binding to the nucleic acid aptamer ssDNA in reporter molecule A.

[0017] 5. The method according to item 4, wherein the target molecule is ATP, the sequence of the nucleic acid aptamer ssDNA is SEQ ID NO.1, and the sequence of the crRNA is SEQ ID NO.2;

[0018] SEQ ID NO.1(5'-3'):

[0019] ACCTGGGGGAGTATTGCGGAGGAAGGT

[0020] SEQ ID NO.2(5'-3'):

[0021] UAAUUUCUACUAAGUGUAGAUUCCUCCGCAAUACUCCCCCA.

[0022] 6. The method according to item 4, wherein the ratio of the Cas12a / crRNA complex to the nucleic acid aptamer ssDNA is from 3:1 to 1.05:1 when used.

[0023] 7. The method according to item 4, wherein the concentration of the fluorescence-quenching probe ssDNA is excessive relative to the concentration of the nucleic acid aptamer ssDNA or the Cas12a / crRNA complex.

[0024] 8. The method according to item 1, wherein a fluorescence analyzer is used for performing the fluorescence intensity measurement.

[0025] 9. The method according to item 4, wherein the ideal concentration range is from 25 μM to 0.5 mM.

[0026] 10. The method according to item 4, wherein the first given time is 15 minutes.

[0027] 11. The method according to item 4, wherein the second given time is 10 minutes.

[0028] 12. A kit for determining the concentration of a target molecule X, comprising at least a reporter molecule A and a competitor molecule B, wherein the reporter molecule A is specifically capable of binding to the target molecule X, and the competitor molecule B is specifically capable of binding to the reporter molecule A and does not bind to the target molecule X in any way; when the target molecule X is absent, the competitor molecule B emits a fluorescence intensity L0 of a given intensity when it binds to the reporter molecule A.

[0029] 13. The kit according to item 12, wherein the target molecule X is any molecule suitable for screening nucleic acid aptamers.

[0030] 14. The kit according to claim 13, wherein the reporter molecule A is ssDNA, the reporter molecule ssDNA comprising at least two parts: a nucleic acid aptamer ssDNA capable of specifically binding to the target molecule X, and a fluorescent-quenched probe ssDNA carrying a fluorescent group and a quenching group and a fixed sequence.

[0031] 15. The kit according to claim 14, wherein the competing molecule B is a Crispr-Cas12a / crRNA complex, wherein the crRNA is capable of specifically binding to the nucleic acid aptamer ssDNA in the reporter molecule A. 16. The kit according to claim 15, wherein the target molecule is ATP, the sequence of the nucleic acid aptamer ssDNA is SEQ ID NO.1, and the sequence of the crRNA is SEQ ID NO.2.

[0032] 17. The kit according to item 15, wherein the ratio of the Cas12a / crRNA complex to the nucleic acid aptamer ssDNA is from 3:1 to 1.05:1 when used.

[0033] 18. The kit according to item 15, wherein the concentration of the fluorescence-quenching probe ssDNA during use is excessive relative to the concentration of the nucleic acid aptamer ssDNA or the Cas12a / crRNA complex.

[0034] The beneficial technical effects achieved by the technical solution of this application are as follows:

[0035] The advantages of the technical solution in this application compared to other detection technologies are that it has the potential to screen suitable nucleic acid aptamers for various types of molecules to establish detection methods to replace traditional methods. At the same time, it is simple to operate, takes very little time (results can be obtained within 10-30 minutes), and can be quantified. Attached Figure Description

[0036] Figure 1 A schematic diagram illustrating the principle of Cas12a-mediated small molecule detection;

[0037] Figure 2 is a schematic diagram of feasibility verification; where A shows that the addition of ATP to the positive control group can cause a decrease in fluorescence signal; while B shows that the decrease in signal is not due to the effect of ATP on protein activity;

[0038] Figure 3 shows the effect of different buffer solutions on the trans-cleavage activity of Cas12a;

[0039] Figure 4 shows the fluorescence increase curves over time for different concentrations of the Cas12a / crRNA complex; (A) positive control; (B) 5 mM ATP;

[0040] Figure 5 Optimize the addition ratio of Cas12a:crRNA;

[0041] Figure 6 shows the different trans-cleavage activities of Cas12a when the DNA activator is at different concentrations. A. Fluorescence value of ssDNA (without PAM sequence) (ATP aptamer) at different concentrations as a function of time; B. Bar chart of fluorescence value at 30 min in Figure 6; C. Bar chart of fluorescence value of ssDNA (with PAM sequence) at 30 min in different concentrations; D. Bar chart of fluorescence value of dsDNA (with PAM sequence) at 30 min in different concentrations.

[0042] Figure 7 shows the effect of different FQ probe concentrations on trans-cutting. A. Fluorescence value-time curves for the first 40 minutes. B. Fluorescence values ​​at the plateau phase for all curves at 90 minutes.

[0043] Figure 8. A shows the kinetics of fluorescence at different ATP concentrations; B shows the quantification of ATP concentration by monitoring the inhibition phenomenon; C shows the specificity for 1 mM nucleosides; where ATP: adenosine triphosphate; TTP: thymidine triphosphate; CTP: cytidine triphosphate; GTP: guanosine triphosphate; UTP: uridine triphosphate. Detailed Implementation

[0044] It should be noted that certain terms are used in the specification and claims to refer to specific components. Those skilled in the art will understand that different terms may be used to refer to the same component. This specification and claims do not distinguish components based on differences in terminology, but rather on differences in function. The terms "comprising" or "including" used throughout the specification and claims are open-ended and should be interpreted as "comprising but not limited to." The following descriptions are preferred embodiments for carrying out the invention; however, these descriptions are for the purpose of understanding the general principles of the specification and are not intended to limit the scope of the invention. The scope of protection of this invention is determined by the appended claims.

[0045] This application relates, in its first aspect, to a method for detecting low concentrations of target molecules in a mixed system.

[0046] In one specific embodiment, a method for quantitatively detecting the concentration of a target molecule X is provided, comprising: adding a reporter molecule A to a reaction system containing the target molecule X and continuing for at least a first given time, wherein the reporter molecule A has specific binding activity with the target molecule X;

[0047] A competing molecule B is added to the reaction system. The competing molecule B has specific binding activity with the reporter molecule A but no binding activity with the target molecule X. When the target molecule X is not present, the competing molecule B emits a fluorescence intensity L0 of a given intensity when it binds to the reporter molecule A.

[0048] After mixing the system and waiting for at least a second given time, the fluorescence intensity L of the system is detected.

[0049] Within the ideal concentration range, the concentration of target molecule X can establish a linear relationship with the L0-L value;

[0050] Using the linear relationship established above as a standard curve, the concentration of the target molecule X can be calculated from the actual measured fluorescence intensity change value L0-L.

[0051] In the context of this specification, "reaction system" should be interpreted broadly, and can be a product solution of a chemical reaction, a product solution of a biological reaction, a cell culture medium, a fermentation broth, a blood sample taken from a patient or experimental animal, etc.

[0052] In one specific embodiment, the target molecule X is any molecule suitable for screening nucleic acid aptamers.

[0053] In the context of this specification, “target molecule X” encompasses molecules of various molecular weights that can be used as targets to screen aptamers from a specific oligonucleotide library. Target molecules can be, for example, ATP-target molecules or large molecules such as surface proteins of influenza virus, Escherichia coli, and Salmonella.

[0054] In another specific embodiment, the reporter molecule A is ssDNA, which comprises at least two parts: a nucleic acid aptamer ssDNA capable of specifically binding to the target molecule X, and a fluorescent-quencher probe ssDNA carrying a fluorescent group, a quencher group, and a fixed sequence. The competing molecule B is a Cas12a / crRNA complex, wherein the crRNA is capable of specifically binding to the nucleic acid aptamer ssDNA in the reporter molecule A.

[0055] In another specific embodiment, the competing molecule B is a Cas12a / crRNA complex, wherein the crRNA is capable of specifically binding to the nucleic acid aptamer ssDNA in reporter molecule A.

[0056] In the context of this specification, "competitive molecule B" can refer to a complex of the Cas12a protein and crRNA. CRISPR-Cas is an abbreviation for Clustered Regularly Interspaced Short Palindromic Repeats-associated protein; and crRNA is an abbreviation for CRISPR RNA. Cas12a is the name of a specific protein within this protein family. Here, the role of crRNA is to specifically recognize and hybridize with a nucleotide substrate; while the role of Cas12a is to cleave the nucleotide substrate and surrounding ssDNA substrate after crRNA has recognized and hybridized with it.

[0057] In the context of this specification, the chemical nature of "reporter molecule A" is ssDNA, an abbreviation for single-stranded DNA. In some specific embodiments, the ssDNA reporter molecule consists of two separate parts: "aptamer ssDNA" and "fluorescent-quenched probe (F-Qprobe) ssDNA". The aptamer ssDNA, due to its specific sequence, can specifically bind to the target molecule (this binding is a physical binding, with binding forces primarily composed of hydrogen bonds, intermolecular forces, and π-π stacking forces), and can also specifically bind to competing molecule B (a complex of Cas12a protein and crRNA), thereby activating the cleavage activity of the Cas12a protein. The fluorescent-quenched probe ssDNA has a fixed sequence, labeled with a FAM fluorescent group at one end and a BHQ quencher group at the other end, with the nucleic acid sequence 5'-FAM-TTTTT-BHQ-3'. In this specification, it can be referred to as a fluorescent probe (F-Qprobe, an abbreviation for Fluorophore-Quencherprobe). When this fluorescent-quenched probe ssDNA is free in the system, in its natural state, the FAM and BHQ groups are close together, quenching the fluorescence and producing no fluorescent signal. However, when the fluorescent probe is cleaved by the trans-cleaving activity of the Cas12a protein, the FAM fluorescent group and the BHQ quencher group separate, and the entire system exhibits a fluorescent signal. It is important to note that when CRISPR-Cas12a is excited to exhibit trans-cleaving activity, it indiscriminately cleaves all surrounding ssDNA, including the fluorescent-quenched probe ssDNA. Therefore, for the competing molecule B (a complex of CRISPR-Cas12a protein and crRNA), the aptamer ssDNA acts as an "activating substrate," while the fluorescent-quenching probe ssDNA acts as a "reactive substrate."

[0058] In another specific embodiment, the target molecule is ATP, the sequence of the nucleic acid aptamer ssDNA is SEQ ID NO.1, and the sequence of the crRNA is SEQ ID NO.2;

[0059] SEQ ID NO.1(5'-3'):ACCTGGGGGAGTATTGCGGAGGAAGGT

[0060] SEQ ID NO.2(5'-3'):

[0061] UAAUUUCUACUAAGUGUAGAUUCCUCCGCAAUACUCCCCCA.

[0062] In one specific embodiment, the ratio of the Cas12a / crRNA complex to the nucleic acid aptamer ssDNA during use is from 3:1 to 1.05:1. Specifically, this ratio can be 3:1, 2.8:1, 2.6:1, 2.4:1, 2.2:1, 2:1, 1.9:1, 1.8:1, 1.7:1, 1.6:1, 1.5:1, 1.45:1, 1.4:1, 1.35:1, 1.3:1, 1.25:1, 1.2:1, 1.15:1, 1.1:1, or 1.05:1.

[0063] In another specific embodiment, the concentration of the fluorescence-quenching probe ssDNA is excessive relative to the concentration of the nucleic acid aptamer ssDNA or the Cas12a / crRNA complex. "Excessive" as described herein can be understood, for example, as the concentration of the fluorescence-quenching probe ssDNA being at least 15 times the concentration of the nucleic acid aptamer ssDNA, specifically, 15, 20, 25, 30, 35, 40, 45, or 50 times.

[0064] In one specific implementation, a fluorescence analyzer is used to measure the fluorescence intensity.

[0065] In yet another embodiment, the ideal concentration range is from 25 μM to 0.5 mM.

[0066] In another specific embodiment, the first given time is 15 minutes; and the second given time is 10 minutes.

[0067] In a second aspect, this application relates to a detection kit for a target molecule X.

[0068] In one specific embodiment, a detection kit for a target molecule X is provided for use with the aforementioned fluorescence analyzer. The kit includes at least the aforementioned reporter molecule A and a competing molecule B, wherein the reporter molecule A can specifically bind to the target molecule X, and the competing molecule B can specifically bind to the reporter molecule A but does not bind to the target molecule X in any way; when the target molecule X is absent, the competing molecule B emits a fluorescence intensity L0 of a given strength when it binds to the reporter molecule A.

[0069] In another specific embodiment, a test kit is provided, wherein the test kit further includes a disposable container for mixing and detection and an instruction manual containing relevant information about the use of the test kit.

[0070] Optimally, the method involved in this application can be designed as follows: the reaction system contains an aptamer ssDNA targeting ATP (a specific embodiment of target molecule X), a fluorescent-quenched probe ssDNA (a specific embodiment of reporter molecule A), a Cas12a protein, and a crRNA (a specific embodiment of competing molecule B) that can specifically recognize and complement the aforementioned aptamer, and a reaction buffer. The applicant designs the crRNA to be a sequence complementary to the ssDNA aptamer. When no target molecule is present in the reaction system, the ssDNA aptamer, acting as an activator, will bind to the Cas12a / crRNA complex to form an aptamer / Cas12a / crRNA trisomy complex. At this time, Cas12a is activated, exhibiting trans-cleavage activity, hydrolyzing all surrounding ssDNA (including the fluorescent-quenched probe ssDNA). At this point, the fluorescent-quenched probe ssDNA becomes the substrate for the trans-cleavage of Cas12a. After hydrolysis, its fluorophore and quencher groups separate, and the light emitted by the fluorophore is no longer quenched, allowing the entire system to display fluorescence values. This fluorescence value is used as a positive control. However, when the target molecule is present in the reaction system, the specific aptamer will bind with high affinity and strong specificity to the target molecule. This reduces the number of aptamer / Cas12a / crRNA trisomy complexes formed by binding to the Cas12a / crRNA complex, leading to a decrease in the number of activated Cas12a molecules. Consequently, the number of FQ probes hydrolyzed by trans-cleavage activity per unit time decreases, ultimately resulting in a decrease in fluorescence intensity per unit time. The working principle of this reaction system can be found in [link to relevant documentation]. Figure 1 .

[0071] <Example Section>

[0072] Specific embodiments of the invention will now be described in more detail with reference to the accompanying drawings. While specific embodiments of the invention are shown in the drawings, it should be understood that the invention can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the invention and to fully convey the scope of the invention to those skilled in the art.

[0073] Example 1 Feasibility Verification Experiment

[0074] To verify the feasibility of this method, we selected the aptamer sequence of ATP (SEQ ID NO. 1) and, based on this sequence and the characteristics and properties of Cas12a nuclease and its crRNA, designed the crRNA-ATP sequence (SEQ ID NO. 2). The positive control (PC, the curve with dots) achieved high fluorescence values ​​by forming a Cas12a-crRNA-aptamer complex, which activated Cas12a and cleaved the FQ probe using trans-activity. In contrast, the other group (the curve with boxes) added ATP as the experimental group showed a decrease in fluorescence values ​​due to the aptamer's specific binding to ATP, resulting in fewer effective aptamers for excitation (see Figure 2A).

[0075] Considering the signal decrease after the addition of ATP, it's possible that the target molecule affected the protein's activity in the reaction system, thus reducing the fluorescence signal, rather than due to the inhibitory effect of the competing aptamer. Therefore, another crRNA-EGFR was designed to specifically recognize the EGFR gene. Here, the crRNA-EGFR sequence is SEQ ID NO.3 (5'-3'): UAAUUUCUACUAAGUGUAGAUUCUUCCGCACCCAGCAGUUU. Neither the EGFR gene nor crRNA-EGFR binds to ATP. Using it as a control in the system for EGFR gene activation of the Cas12a protein / crRNA complex, ATP and mercury ions were added respectively (see Figure 2B). It can be seen that the fluorescence value did not decrease significantly after the addition of ATP, indicating that ATP does not have a non-specific inhibitory effect on Cas12a protein activity. However, in contrast, mercury ions severely affected Cas12a protein activity. This ruled out the influence of ATP on protein activity and verified the feasibility of the experiment.

[0076] Designed experimental conditions

[0077] Typical reaction system:

[0078] Components Added amount Final concentration Cutsmart buffer (10X) 8μL 1X F-Qprobe (2μM) 8μL 200nM Cas12a (0.1 μM) 4μL 5nM crRNA (0.1 μM) 4μL 5nM Aptamer (50 nM) 8μL 5nM Adenosine triphosphate (ATP) 8μL H2O Add to 80μL

[0079] Note: For all PC groups below, replace ATP in the table above with an equal volume of water. For NC groups, replace ATP and aptamers above with an equal volume of water.

[0080] Operating steps:

[0081] 1. Take a 1.5ml light-protected centrifuge tube, label it tube A, add the ATP target molecule and aptamer, and incubate for 20 minutes before starting a 20-minute countdown.

[0082] 2. When the countdown reaches 15 minutes, take another 1.5 ml centrifuge tube, which is designated as tube B, and mix cas12a and crRNA in advance for incubation.

[0083] 3. When the countdown reaches 3 minutes, add H2O, Cutsmart buffer, and FQ probe to tube A in sequence.

[0084] 4. When the countdown reaches 0 minutes, mix the solution in tube B with the solution in tube A, gently shake and centrifuge.

[0085] 5. Dispense into black 96-well plates and read the fluorescence value using a microplate reader.

[0086] ELISA reader program:

[0087] Maintain a temperature of 37℃ and measure fluorescence values ​​every 30 seconds. Excitation wavelength: 492nm; emission wavelength: 518nm.

[0088] Data processing:

[0089] In this study, the ideal scenario was that the fluorescence value increased linearly over time until the FQ probe was completely cleaved, reaching its maximum value and remaining in a plateau phase without further increase. GraphPadPrism 7 was used to process the data and plot the fluorescence value over time. When calculating sensitivity, data that did not reach a plateau and showed approximately linear growth were considered valid data. A parameter, Inhibition Rate (IR%), was defined to represent the degree of inhibition of the target molecule against the positive control.

[0090] The formula is as follows

[0091] IR1(%)=(AB) / (AC)×100

[0092] IR2 (%) = (AB) / A × 100

[0093] IR(%)=MeanofIR1(%)andIR2(%)

[0094] A: Fluorescence intensity of the reaction system without ATP addition, PC group

[0095] B: Fluorescence intensity of the reaction system with added ATP, experimental group

[0096] C: Background fluorescence intensity, NC group

[0097] The difference between IR1 and IR2 lies in whether the influence of the NC group is considered when calculating the inhibition rate. We believe neither is the most perfect choice. For data where the fluorescence value-time curve can regress to a linear relationship, at time zero, IR1 and IR2 values ​​will be extremely large and small, respectively, but they tend to converge to the same intermediate constant value over time, and their curve distributions are axially symmetric. Therefore, defining IR to represent the mean of the two is the most reasonable approach.

[0098] Example 2. Optimization Experiment of the Reaction System

[0099] 1. Optimization of the reaction buffer system:

[0100] Cas12a is a nuclease, and its cleavage activity is inevitably affected by the surrounding environment. Previous reports have mentioned using NEB buffer 2.1, NEB buffer 3.1, NEB buffer 4, NEB cutsmart buffer, or custom-prepared buffers. Therefore, we investigated the effect of different buffer compositions on the Cas12a cleavage activity (see Figure 3). It can be seen that a key factor affecting the Cas12a cleavage activity is the presence of the divalent cation Mg in the test solution. 2+ Concentration. Because the Cas12a RuvC domain cleaves ssDNA via a bimetallic ion mechanism, Mg 2+ Ions induce conformational coordination between the RuvC domain and ssDNA by altering the spatial distribution of ssDNA around the active cleavage site of RuvC. This result is consistent with previous reports. However, when Mg... 2+ At a given concentration, different buffer solutions exhibit different cleavage activities, which may be due to the effect of salt concentration, consistent with the characteristics of nucleases.

[0101] The CutSmart buffer consists of: 50 mM KAc, 20 mM Tris-Ac, 10 mM Mg(Ac)2, and 100 μg / ml BSA (pH 7.9 @ ​​25℃).

[0102] NE buffer 3.1: 100mM NaCl, 50mM Tris-HCl, 10mM MgCl2, 100μg / ml BSA (pH 7.9@25℃);

[0103] Buffer A: 50mM KAc, 20mM Tris-Ac, 1mM Mg(Ac)2, 100μg / ml BSA (pH 7.9@25℃).

[0104] 2. Optimization of protein and RNA concentrations:

[0105] The concentration of the Cas12a / crRNA complex directly determines the number of trans-cleavage active sites and the rate of fluorescence signal growth in the system. We optimized the concentration of the Cas12a / crRNA complex using a Cas12a:crRNA ratio of 1:1 (see Figure 4). It can be seen that when the concentration of the Cas12a / crRNA complex is higher than 5 nM, the reaction rate is very fast, and only the plateau phase data can be observed in the PC group, which is not conducive to data processing. Conversely, when the concentration of the Cas12a / crRNA complex is lower than 5 nM, the fluorescence value of the experimental group with the added target molecule is extremely low, making it difficult to distinguish from the NC group. Therefore, considering all factors, a concentration of 5 nM for the Cas12a / crRNA complex was chosen for subsequent experiments. Compared to previous reports of 50 nM Cas12a in the DETECTR method and 250 nM Cas12a in the HOLMES method, the concentration used in this study significantly reduced reagent usage and greatly saved costs. In Figure 4, the fluorescence values ​​of different Cas12a / crRNA complexes are consistent in the NC group, and are uniformly represented by NC in the figure.

[0106] 3. Optimization of protein and RNA concentration ratio:

[0107] To ensure Cas12a effectively performs its trans-cleavage, it is necessary to guarantee the efficient formation of the Cas12a / crRNA complex. In reported studies, the DETECTR method uses a Cas12a:RNA ratio of 1:1.25, while the HOLMES method uses a Cas12a:RNA ratio of 1:2, indicating that different reaction systems require different Cas12a-RNA concentration ratios. Therefore, we optimized the Cas12a-RNA concentration ratio (see...). Figure 5 As can be seen, there was no significant difference between different addition ratios in the system of this study. In order to save costs, Cas12a:RNA = 1:1 was selected for subsequent experiments.

[0108] 4. Optimization of aptamer addition amount:

[0109] The aptamer added to the PC group is essentially an ssDNA activator. The specific binding of ATP to the aptamer in the system leads to a decrease in fluorescence. Therefore, the amount of aptamer added significantly affects both the fluorescence value of PC and the sensitivity of ATP detection. Thus, we optimized the aptamer concentration by adjusting different concentrations (see Figures 6A and 6B). Interestingly, the fluorescence value of the PC group did not increase indefinitely with increasing aptamer concentration, but rather exhibited a bell-shaped curve. To the left of the peak, when the aptamer concentration was low, the fluorescence value released in the same time period increased with increasing aptamer concentration, indicating that the number of activated Cas12a increased with increasing aptamer concentration. However, when the aptamer concentration was too high, the fluorescence signal decreased in the same time period, indicating a decrease in the number of excited Cas12a. This is the first report of this phenomenon in Cas12a; no previous literature has reported on it. It is speculated that the activation of Cas12a requires the formation of a Cas12a-crRNA-DNA trisomy. When the aptamer concentration is too high, steric hindrance reduces the probability of effective collisions among the three components, thus decreasing the number of effectively activated Cas12a. In this reaction, Cas12a primarily exhibits trans-cleavage activity, and F-Qprobe is the cleaved substrate. Therefore, the aptamer cannot be strictly considered a reaction substrate. If it is considered an "activating substrate" for Cas12a activation, the bell-shaped curve indicates that excessively high "activating substrate" concentrations lead to a decrease in enzyme activity, which is very similar to previously reported substrate inhibition phenomena.

[0110] Furthermore, to investigate whether this phenomenon only occurs when aptamer (ssDNA) activates Cas12a, we verified this using different concentrations of ssDNA with PAM sequences (see Figure 6C) and dsDNA with PAM sequences (see Figure 6D). We found that this phenomenon could be observed in both ssDNA and dsDNA. It is worth noting that at the point of highest fluorescence value, the ratio of Cas12a:crRNA:DNA activator was approximately 1:1:1, but this varied depending on the sequence. For example, the maximum fluorescence value of ssDNA (without PAM sequence) (ATP aptamer) occurred at a concentration of 12.5 nM; the maximum fluorescence value of ssDNA (with PAM sequence) occurred at a concentration of 1 nM; and the maximum fluorescence value of dsDNA (with PAM sequence) occurred at a concentration of 5 nM. Therefore, for each different in vitro RNA-DNA (ssDNA and dsDNA) binding detection method, a working curve needs to be plotted to find the optimal concentration.

[0111] This substrate inhibition phenomenon can also be verified from another perspective. When the concentration of ssDNA (with PAM sequence) (ATP aptamer) (here, the PAM-containing ssDNA sequence is SEQ ID NO.4(5'-3'):AGATTTTGGGCTGGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGA) is increased to 25 nM, adding different concentrations of ATP target molecules as inhibitors, the fluorescence value of the entire system, compared with the PC group, shows that 0.01 mM ATP increases the signal (see...). Figure 1 This is because when ATP at this concentration binds to a portion of the aptamers, the concentration of the effective ssDNA activator decreases from 25 nM, thus bringing it closer to the optimal concentration.

[0112] 5. Concentration optimization of FQ probe:

[0113] We also evaluated the effect of probe concentration on the overall reaction system. As probe concentration increased, the fluorescence growth rate accelerated, and the enzyme-catalyzed reaction rate increased, consistent with enzyme reaction kinetics and the Michaelis-Menten equation. At this point, the Cas12a nuclease reaction was a first-order reaction (see Figure 7A). It can be seen that at 40 min, the 800 nM probe concentration was not completely consumed, and the fluorescence value did not show a plateau trend. By 90 min, all the probe was hydrolyzed by the Cas12a nuclease through trans-cleavage activity, and the fluorescence value no longer increased (see Figure 7B). The fluorescence intensity was directly proportional to the probe concentration. Therefore, a suitable concentration was chosen. Since the fluorescence value decreases in the presence of ATP, to ensure a certain degree of differentiation from the NC group within a limited time, a 200 nM FQ probe was ultimately selected for subsequent experiments.

[0114] Example 3 Sensitivity and Specificity Experiment

[0115] Based on the above optimization conditions, we evaluated the sensitivity of this method for detecting ATP target molecules. We used the case where the aptamer was used as the ssDNA activator as a positive control. After adding different concentrations of ATP, due to the specific binding of ATP and the aptamer, the number of aptamers used to exert the activator effect decreased, resulting in varying degrees of decrease in fluorescence signal (see Figure 8A). Quantitative analysis was performed by monitoring the inhibition rate 13 min after the start of the reaction. We plotted the IR% of ATP on the y-axis and the logarithm of ATP concentration on the x-axis, and obtained a linear response with R² = 0.9496 and a dynamic range of 0.1 mM–5 mM (see Figure 8B). According to the formula Limit of Detection (LOD) = 3 * SD / slope, the LOD of this method can reach 2.66 μM. This sensitivity and dynamic range are better than those of aptamer-based colorimetric sensors, but not as good as those of inorganic material-based detection methods. The curve fitted by [inhibitor] vs. response showed LC50 = 0.60.

[0116] The specificity of this method was tested using various nucleosides at 1 mM (see Figure 8C). It can be seen that ATP significantly reduced the fluorescence value of the reaction, while the other four nucleosides had almost no effect on the PC group. This demonstrates the extremely high specificity of the method. The data in Figure 8 are from three independent measurements in A) and C), and nine independent measurements in B). Error bars represent standard deviations.

[0117] Although embodiments of the present invention have been described above in conjunction with the accompanying drawings, the present invention is not limited to the specific embodiments and application fields described above. The specific embodiments described above are merely illustrative and instructive, and not restrictive. Those skilled in the art can make many other forms based on the guidance of this specification and without departing from the scope of protection of the claims of the present invention, and all of these are within the scope of protection of the present invention.

Claims

1. A method for quantitatively detecting the concentration of target molecule X, comprising: Add reporter molecule A to a reaction system containing the target molecule X and wait for a first given time, wherein the reporter molecule A has specific binding activity with the target molecule X; A competing molecule B is added to the reaction system. The competing molecule B has specific binding activity with the reporter molecule A but no binding activity with the target molecule X. When the target molecule X is not present, the competing molecule B emits a given fluorescence intensity, i.e., L0, when it binds to the reporter molecule A. After adding the competing molecule B, the reaction system was mixed and the fluorescence intensity L of the reaction system was detected after waiting for a second given time. Within a given concentration range, the concentration of target molecule X establishes a linear relationship with the L0-L value; Using the established linear relationship as a standard curve, the concentration of target molecule X is calculated from the actual measured fluorescence intensity change value L0-L; The target molecule X is a molecule capable of screening out nucleic acid aptamers; Wherein, the reporter molecule A is ssDNA, and the reporter molecule ssDNA includes at least two parts: a nucleic acid aptamer ssDNA that can specifically bind to the target molecule X, and a fluorescent-quenching probe ssDNA carrying a fluorescent group, a quenching group and a fixed sequence; The competing molecule B is a Cas12a / crRNA complex, wherein the crRNA is capable of specifically binding to the nucleic acid aptamer ssDNA in reporter molecule A. The target molecule is ATP, the sequence of the nucleic acid aptamer ssDNA is SEQ ID NO.1, and the sequence of the crRNA is SEQ ID NO.2; SEQ ID NO.1 (5'-3'): ACCTGGGGGAGTATTGCGGAGGAAGGT SEQ ID NO.2(5'-3'): UAAUUUCUACUAAGUGUAGAUUCCUCCGCAAUACUCCCCCA; The ratio of the Cas12a / crRNA complex to the nucleic acid aptamer ssDNA during use is 2.8:1 to 1.1:

1.

2. The method according to claim 1, wherein, The concentration of the fluorescence-quenching probe ssDNA is excessive relative to the concentration of the nucleic acid aptamer ssDNA or the Cas12a / crRNA complex.

3. The method according to claim 1, wherein, A fluorescence analyzer was used to perform the fluorescence intensity measurement.

4. The method according to claim 1, wherein, The given concentration range is from 25 μM to 0.5 mM.

5. The method according to claim 1, wherein the first given time is 15 minutes or more.

6. The method of claim 1, wherein the second given time is 10 minutes or more.

7. A kit for determining the concentration of a target molecule X, comprising at least a reporter molecule A and a competitor molecule B, wherein the reporter molecule A is specifically capable of binding to the target molecule X, and the competitor molecule B is specifically capable of binding to the reporter molecule A and does not bind to the target molecule X in any way; when the target molecule X is absent, the competitor molecule B emits a fluorescence intensity L0 of a given intensity when it binds to the reporter molecule A; in, The target molecule X is a molecule capable of screening out nucleic acid aptamers; Wherein, the reporter molecule A is ssDNA, and the reporter molecule ssDNA includes at least two parts: a nucleic acid aptamer ssDNA that can specifically bind to the target molecule X, and a fluorescent-quenching probe ssDNA carrying a fluorescent group, a quenching group and a fixed sequence; The competing molecule B is a Cas12a / crRNA complex, wherein the crRNA can specifically bind to the nucleic acid aptamer ssDNA in reporter molecule A. The target molecule is ATP, the sequence of the nucleic acid aptamer ssDNA is SEQ ID NO.1, and the sequence of the crRNA is SEQ ID NO.

2. The ratio of the Cas12a / crRNA complex to the nucleic acid aptamer ssDNA used is 2.8:1 to 1.1:

1.

8. The kit according to claim 7, wherein, The concentration of the fluorescent-quenched probe ssDNA used is excessive relative to the concentration of the nucleic acid aptamer ssDNA or the Cas12a / crRNA complex.

Images