Use of GFAP amino acid sites as therapeutic targets for neurodegenerative diseases

By blocking the palmitoylation modification of cysteine at position 291 of GFAP and mutation into thiodo amino acids is solved, the problem of accelerated glial hyperplasia in neurodegenerative diseases is solved, protecting neurons, and improving disease symptoms and survival status.

CN116406303BActive Publication Date: 2025-07-29孔二艳
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202080104260.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2020-09-04
Publication Date
2025-07-29
Estimated Expiration
2040-09-04

AI Technical Summary

Technical Problem

Currently, neurodegenerative diseases such as amyotrophic lateral sclerosis, Parkinson's disease, Alzheimer's disease, Huntington's disease lack effective treatment methods. Glial cell hyperplasia accelerates neuronal apoptosis, and palmitoylation modification of GFAP promotes disease progression.

Method used

By blocking the palmitoylation modification of cysteine at position 291 of GFAP, cysteine at position 291 of GFAP is mutated to thio-free amino acids such as alanine by blocking the palmitoylation modification of cysteine at position 291 of GFAP, using gene knock-in or post-translational modification methods, the cysteine at position 291 of GFAP is mutated to thio-free amino acids, such as alanine, which reduces the rate of glial cell proliferation and protects neurons.

Benefits of technology

Effectively reduce glial cell proliferation rate, improve neuronal function, reduce disease progression, and significantly improve symptoms such as epilepsy and lifespan in INCL mouse models.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116406303B_ABST
    Figure CN116406303B_ABST
Patent Text Reader

Abstract

The present invention provides an application of using the GFAP amino acid site as a therapeutic target for neurodegenerative diseases, wherein the GFAP amino acid site is cysteine at position 291 of GFAP, and the way of using the GFAP amino acid site as a therapeutic target for neurodegenerative diseases is to block the palmitoylation of cysteine at position 291 of GFAP, and the application is for screening drugs for treating neurodegenerative diseases. The present invention provides an application of a new therapeutic target for neurodegenerative diseases, and also provides related vectors, sequences and screening schemes required for this application. Based on this, effective methods for treating neurodegenerative diseases and methods for preparing therapeutic preparations can be developed.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the application of a therapeutic target for neurodegenerative diseases, and specifically relates to the application of GFAP amino acid sites as therapeutic targets for neurodegenerative diseases. Background Art

[0002] Neurodegenerative diseases are a group of diseases that result in dysfunction due to the gradual loss or even death of the structure or function of neurons, including amyotrophic lateral sclerosis, Parkinson's disease, Alzheimer's disease, Huntington's disease, spinal muscular atrophy, and so on. Currently, the causes of these diseases are not yet clear and they cannot be cured, posing a serious threat to human health and daily life.

[0003] GFAP is the English abbreviation of glial fibrillary acidic protein and is a marker of astrocyte activation. The activation of astrocytes (characterized by a large proliferation and metamorphosis of the number of astrocytes) is highly correlated with almost all neurodegenerative diseases (characterized by a large reduction in the number of neurons). During the pathological screening of the above-mentioned neurodegenerative diseases, the coexistence and concomitant occurrence of astrocyte proliferation and a decrease in the number of neurons are often seen. The inventor believes that the large proliferation of glial cells promotes the apoptosis process of neurons to a certain extent, accelerates the development of neurodegenerative diseases, and is a negative factor in neurodegenerative diseases. Therefore, the relationship between the proliferation of astrocytes and neurodegenerative diseases is studied in depth, and the present invention is part of the research results.

[0004] The infantile neuronal ceroid lipofuscinosis (INCL) model used in an embodiment of the present invention is a typical research model for neurodegenerative diseases. Infantile neuronal ceroid lipofuscinosis (INCL or CLN1) is a recessive genetic disease caused by abnormal function of palmitoyl protein thioesterase-1 (PPT1), and is the earliest and most severe type of neuronal ceroid lipofuscinosis, mainly manifested as psychomotor regression and visual impairment, followed by epileptic seizures. The corresponding mouse disease model of INCL is to introduce the naturally mutated site in human PPT1 into the genome of mice (PPT1-KI). The PPT1-KI mice well simulate the disease phenotype and pathogenesis of INCL: the pathological characteristics are manifested as a large proliferation of glial cells accompanied by neuronal apoptosis, and the pathogenesis is progressive. When the 6-month-old mice are tail-suspended, the phenotype of epileptic seizures (Seizure) appears in the hind limbs, and the lifespan of the mice is 6-8 months. Currently, there is no effective treatment for INCL.

[0005] With the aging of the population, the incidence of neurodegenerative diseases is increasing day by day. Discovering new therapeutic targets for neurodegenerative diseases, developing effective treatment methods and methods for preparing therapeutic agents are key issues that need to be solved urgently. Summary of the Invention

[0006] An object of the present invention is to provide an application of using the GFAP amino acid site as a therapeutic target for neurodegenerative diseases, wherein the GFAP amino acid site is the 291st cysteine of GFAP, and the way of using the GFAP amino acid site as a therapeutic target for neurodegenerative diseases is to block the palmitoylation of the 291st cysteine of GFAP, and the application is for screening drugs for treating neurodegenerative diseases.

[0007] Blocking the palmitoylation modification of the 291st cysteine of GFAP can effectively reduce the proliferation rate of glial cells, and thus play a protective role on neurons. This is the fundamental starting point for the 291st cysteine of GFAP to become a drug target for treating neurodegenerative diseases. Therefore, the application includes any application of using the site as a therapeutic target for neurodegenerative diseases, as long as it is an application for screening drugs for treating neurodegenerative diseases derived from the therapeutic target known to those skilled in the art, it is within the protection scope of the present invention.

[0008] The neurodegenerative disease can be any of the currently discovered neurodegenerative diseases, such as amyotrophic lateral sclerosis, Parkinson's disease, Alzheimer's disease, Huntington's disease or spinal muscular atrophy.

[0009] The neurodegenerative disease can be a neurodegenerative disease of any animal containing the GFAP expression gene, including but not limited to humans and mice.

[0010] According to the application, a preferred method for "blocking the palmitoylation of the 291st cysteine of GFAP" is a gene knock-in method of mutating the codon of the 291st cysteine of GFAP into a codon without a thiol-containing amino acid.

[0011] The gene knock-in method can be: adding linkers to the sequences near the codon of the 291st amino acid of GFAP to form two complementary sequences with linkers, annealing the complementary sequences, inserting them into the digested vector to form a recombinant vector, and using the recombinant vector for gene recombination to mutate the 291st cysteine of GFAP into a thiol-free amino acid.

[0012] Preferably, the recombinant vector is a recombinant vector formed by inserting into the pX458 vector digested with BbsI; the gene knock-in uses the cleavage site of Cas9, and the cleavage site of Cas9 is closed after the knock-in is completed.

[0013] Each relevant sequence preferably adopts the following sequences:

[0014] The sequence containing the codon near the 291st amino acid of GFAP is the sequence shown in SEQ ID NO:1, that is, the GFAP-gDNA sequence: GCGCAGGGACTCCAGATCGC;

[0015] The two complementary sequences with adapters are the sequences shown in SEQ ID NO:2 and SEQ ID NO:3 respectively, that is

[0016] GFAP-gDNA-F, sequence 2: CACCGCGCAGGGACTCCAGATCGC;

[0017] GFAP-gDNA-R, sequence 3: AAACGCGATCTGGAGTCCCTGCGC.

[0018] Preferably, the sequence GFAP-rDNA for recombination is a DNA sequence containing mutation sites synthesized based on the genomic sequence fragment GFAP-DNA, called GFAP-rDNA, and the genomic sequence fragment GFAP-DNA is shown in SEQ ID NO:4.

[0019] For example, the DNA sequence GFAP-rDNA containing mutation sites with the cysteine at the 291st position mutated to alanine is the sequence shown in SEQ ID NO:5.

[0020] According to the above application, another preferred method for "blocking the palmitoylation of the 291st cysteine of GFAP" is to post-translationally modify the 291st cysteine of GFAP to block its palmitoylation modification.

[0021] The above application can be screening for drugs for treating neurodegenerative diseases, and the screening index is the degree of blocking of the palmitoylation modification of the 291st cysteine of GFAP.

[0022] The above-mentioned recombinant vector in the application is also a part of the present invention and is protected by the present invention.

[0023] Related products that can be used to implement the present invention are also a part of the present invention. For example:

[0024] The mutant GFAP with the 291st cysteine of GFAP mutated to a non-mercapto amino acid.

[0025] The nucleic acid encoding the mutant GFAP.

[0026] Mutation of cysteine at position 291 of GFAP protein or binding of specific small molecules to cysteine at position 291 to block this site can block or reduce the palmitoylation modification of cysteine at position 291 of GFAP protein. The palmitoylation modification at this site directly regulates the proliferation rate of glial cells. PPT1 is an enzyme that regulates the depalmitoylation modification of GFAP. Deletion of PPT1 (PPT1-KI) leads to a significant increase in the palmitoylation level of GFAP, thereby upregulating the proliferation rate of glial cells and accelerating neuronal apoptosis, which is a promoting factor for disease development. Therefore, the mutation of cysteine at position 291 of GFAP blocks the massive proliferation of glial cells caused by the increase in the palmitoylation level of GFAP protein due to the deletion of PPT1. At the same time, the mutation of cysteine at position 291 of GFAP protein can increase the content of tau-1 (neuronal axon marker protein) and NeuN (neuronal nucleus marker protein) in INCL, indicating that neurons in the brains of INCL disease mice have been restored. At the same time, the hind limb epilepsy symptoms that appeared in INCL disease mice at 6 months were also significantly improved. The present invention provides the application of a new therapeutic target for neurodegenerative diseases, and also provides related vectors, sequences or screening means required for this application. Based on this, effective methods for treating neurodegenerative diseases and methods for screening and preparing therapeutic agents can be developed. Description of the Drawings

[0027] Figure 1 It is a Western blot detection diagram, showing that GFAP in HEK-293T cells and mouse brain tissues has palmitoylation.

[0028] Figure 2 It is an absorbance measurement diagram, showing that the palmitoylation modification of cysteine at position 291 of GFAP directly regulates the proliferation rate of glial cells.

[0029] Figure 3 It is a Western blot detection diagram of the 2BP-treated sample, showing that interfering with the palmitoylation modification of cysteine at position 291 of GFAP using 2-BP (palmitoylation inhibitor) also regulates the proliferation rate of glial cells.

[0030] Figure 4 It is a Western blot detection diagram showing that PPT1 negatively regulates the palmitoylation modification of GFAP.

[0031] Figure 5 It is a Western blot detection diagram showing a significant increase in the palmitoylation modification level of GFAP in PPT1-deficient mice (PPT1-KI).

[0032] Figure 6Another absorbance measurement graph shows that the increase in the level of GFAP palmitoylation modification in PPT1-KI mice is particularly evident in keratinocytes and upregulates the proliferation rate of glial cells.

[0033] Figure 7 It is a sequencing result graph of constructing mice with cysteine at position 291 of GFAP mutated to alanine (GFAP-C291A) using CRISPR gene editing technology.

[0034] Figure 8 It is a Western blot detection graph showing that the palmitoylation modification level of GFAP in the constructed GFAP-C291A mice is significantly reduced.

[0035] Figure 9 Another absorbance measurement graph shows that the decrease in the level of GFAP palmitoylation modification in GFAP-C291A mice also significantly reduces the proliferation rate of glial cells.

[0036] Figure 10 It is an immunohistochemical detection graph showing the number of astrocytes in the normal and mutant brain tissues of GFAP in normal mice and PPT1-deficient mice detected by immunohistochemistry.

[0037] Figure 11 It is a scanned image of a mouse brain stained section showing the number of astrocytes and neurons in the normal and mutant brain tissues of GFAP in normal mice and PPT1-deficient mice detected by tissue clearing technology and immunofluorescence technology.

[0038] Figure 12 It is a picture of detecting the contents of GFAP protein, Tau-1 protein, and NeuN protein in mouse brain tissues by Western blot.

[0039] Figure 13 It is a picture of the mouse tail suspension test showing that the hind limb epilepsy behavioral characteristics of 6-month-old mice in the mouse tail suspension test are improved.

[0040] Figure 14 It is a mouse survival curve showing the improvement of the lifespan of mice by knocking in GFAP-C291A in PPT1-KI. Specific implementation manners

[0041] Blocking the palmitoylation modification of cysteine at position 291 of GFAP can effectively reduce the proliferation rate of glial cells, thereby playing a protective role on neurons. This is the fundamental starting point for cysteine at position 291 of GFAP to become a drug target for treating neurodegenerative diseases. This principle has been fully verified by experiments. Before describing the embodiments of the present invention, the experimental verification of the principle will be described first to prove that the technical solutions claimed in the present invention have theoretical and experimental bases.

[0042] Identification of Palmitoylation Modification of GFAP

[0043] 1. Preparation of Test Samples

[0044] Cell Samples: 293T cells (ATCC) were taken out from liquid nitrogen, revived in a 37°C water bath, cultured in a CO2 incubator in DMEM medium in a 10 cm culture dish. When the 293T cells (ATCC) reached about 70% density at the third passage, the plasmid of GFAP-Flag was transfected into the labeled 293T cells by Lip3000 liposome transfection method. After 24 h of transfection, when the cell density was about 90%, the cells were collected. That is, the cells in the culture dish were gently pipetted with 10 ml of 1xPBS and transferred to a 15 ml centrifuge tube. The cells were centrifuged at 800 rcf at room temperature for 5 min, the supernatant was discarded, and the collected cells were quickly placed on ice. Calculate the amount of cell lysate to be added according to the amount of 1 ml of cell lysate (RIPA:PI = 100:1) per 10 cm cell culture dish.

[0045] Brain Tissue Samples: 3-month-old B6 mice were selected for the experiment. First, the grinding container was washed with DDH2O and then dried in an oven to completely remove moisture. An appropriate amount of liquid nitrogen was poured into a heat-insulating foam box and then transferred to the dried mortar for pre-cooling together with the pestle. The above steps were repeated twice, and the grinding container should be fully pre-cooled. Mouse brain tissue was added to the grinding container, an appropriate amount of liquid nitrogen was poured in, and when the brain tissue became brittle, it was quickly ground. RIPA Buffer (PMSF:RIPA = 1:100) was added to the homogenized mouse brain tissue and placed on ice for 30 minutes. Centrifuge at 12000 rpm at 4°C for 10 minutes. Take the supernatant and transfer it to a new centrifuge tube. Then take a small amount of protein to measure the protein concentration, and the remaining samples were stored at -80°C for later use.

[0046] 2. Extraction of Palmitoylated Proteins Using Acyl-RAC (Resin-assisted Capture of S-Acylated Proteins) Technology

[0047] Determine the protein concentration using the BCA method. Take 2 mg of the total protein sample, add 4 volumes of pre-cooled acetone, place at -20 °C for 30 min, centrifuge at 10,000 rpm for 10 min at 4 °C to precipitate the protein. Resuspend the sample in Blocking buffer (100 mM HEPES, 1.0 mM EDTA, 2.5% SDS, pH 7.3) containing PI and 50 mM NEM, and incubate with shaking at 50 °C for 1 h. Add 4 volumes of pre-cooled acetone, place at -20 °C for 30 min, centrifuge at 10,000 rpm for 10 min at 4 °C to precipitate the protein; wash the precipitate with 8 ml of 70% acetone, repeat 3 times. Resuspend in 1.4 ml of Binding buffer (100 mM HEPES, 1.0 mM EDTA, 1% SDS, pH 7.3) to fully dissolve the protein, and divide it into +HA and -HA. Add 50 μl of the prepared beads, incubate at room temperature (guarantee 25 °C) for 4 h, and take an equal amount of the remaining protein as a control. Centrifuge at 1000 g and discard the supernatant. Wash 5 times with Binding buffer and centrifuge at 1000 rpm for 1 min. Treat with 50 μl of Laemmli loading buffer (2.1% SDS, 66 mM Tris, 50 mM DTT) at 42 °C for 15 min to elute the target protein. Analyze the samples by Western blot detection.

[0048] 3. Western blot analysis

[0049] Electrophoresis: First, clean the required glass plates by washing them with DDH2O water. Then align the glass plates and vertically clamp them in the clips to prepare for gel preparation. Prepare a 10% concentration SDS-PAGE gel and load the prepared brain tissue samples; connect the electrophoresis tank to the electrophoresis instrument. When running the stacking gel, use 80 V for about 30 - 40 minutes, and when running to the separating gel, continue electrophoresis at 120 V. Determine the electrophoresis time according to the molecular weight of the target protein. (Electrophoresis instrument brand: Bio-Rad)

[0050] Transfer: In the order from the negative electrode (black plate) to the positive electrode (transparent plate): fiber pad, filter paper, gel, PVDF membrane, filter paper, fiber pad, in a sandwich-like manner. Place the clip in the transfer tank, ensuring that the black side of the clip faces the black side of the tank and the white side of the clip faces the red side of the tank. Add 1x transfer buffer and ice cubes to a container filled with ice. Generally, set the current to 300 mA and the time to 90 minutes. (Transfer instrument brand: Bio-Rad)

[0051] Blocking: Wash the membrane once with 1XTBST (about 5 minutes). Transfer the PDVF membrane (protein side down) into a petri dish containing 5% non-fat milk blocking solution and incubate on a shaker at room temperature for 2 h. Wash the membrane once with 1XTBST (about 5 minutes).

[0052] Antibody Incubation: Incubate the Tau-1 protein antibody overnight at 4°C; incubate the corresponding enzyme-labeled secondary antibody.

[0053] Exposure: Mix the two luminescent agents A and B in the kit at a ratio of 1:1, shake well, and evenly sprinkle it on the protein side of the membrane according to the size of the membrane for exposure.

[0054] 4. Experimental Results

[0055] As Figure 1 shown, obvious protein bands were detected in the HA-treated samples of 293T cell expression and mouse brain tissue samples. The experimental results showed that GFAP is a palmitoylated protein and has palmitoylation modification in both cell expression samples and mouse brain tissue samples.

[0056] Cysteine at position 291 of GFAP directly regulates the proliferation of glial cells

[0057] In 3 dishes of U251 cells with a density of approximately 70%, according to the instructions of Lipofectamine 3000 reagent (Invitrogen), equal amounts of Flag, GFAP-Flag, and GFAP-C291A-Flag plasmids were transfected into 3 dishes of U251 cells for 24 h. Then the transfected U251 cells were respectively seeded into 96-well plates at a density of 1x10 4 cells / well. The proliferation rate of U251 cells at different time points after transfection was measured using a cell counting kit (CCK8, Dojin, Kumamoto, Japan), and the absorbance was measured at 450 nm using a microplate reader (Infinite M200 Pro, Tecan). All experiments were repeated three times.

[0058] The experimental results are as Figure 2 shown, indicating that the proliferation rate of U251 cells transfected with GFAP-Flag plasmid was significantly higher than that of U251 cells transfected with GFAP-C291A-Flag plasmid.

[0059] 2-BP downregulates the palmitoylation modification of GFAP

[0060] Cell sample preparation: Resuscitate U251 cells and culture them in DMEM medium. Conduct experiments after passage for 3 generations. Weigh an appropriate amount of 2BP and dissolve it in DMSO to prepare a stock solution with a concentration of 10 mM. Then, dilute the 10 mM stock solution proportionally to a 2BP concentration of 100 μM (diluted with DMEM) for standby. Culture 6 dishes of U251 cells. When the density reaches approximately 90%, replace the cell medium in 5 randomly selected dishes with DMEM medium containing 2BP at a concentration of 100 μM. Add an equal amount of DMSO to the remaining dish and directly collect the cells. Collect the cells after 2BP treatment for 4 h, 6 h, 8 h, 10 h, and 12 h respectively.

[0061] Extract palmitoylated proteins using the Acyl-RAC (Resin-assisted Capture of S-Acylated Proteins) technique

[0062] Determine the protein concentration using the BCA method. Take 2 mg of the total protein sample, add 4 volumes of pre-cooled acetone, place it at -20°C for 30 min, centrifuge at 10,000 rpm at 4°C for 10 min to precipitate the protein. Resuspend the sample in Blocking buffer (100 mM HEPES, 1.0 mM EDTA, 2.5% SDS, pH 7.3) containing PI and 50 mM NEM, and incubate with shaking at 50°C for 1 h. Add 4 volumes of pre-cooled acetone, place it at -20°C for 30 min, centrifuge at 10,000 rpm at 4°C for 10 min to precipitate the protein; wash the precipitate with 8 ml of 70% acetone and repeat 3 times. Resuspend in 1.4 ml of Binding buffer (100 mM HEPES, 1.0 mM EDTA, 1% SDS, pH 7.3) to fully dissolve the protein, and divide it into +HA and -HA. Add 50 μl of the prepared beads and incubate at room temperature (25°C) for 4 h. Take an equal amount of the remaining protein as a control. Centrifuge at 1000 g and discard the supernatant. Wash 5 times with Binding buffer and centrifuge at 1000 rpm for 1 min. Elute the target protein by treating with 50 μl of Laemmli loading buffer (2.1% SDS, 66 mM Tris, 50 mM DTT) at 42°C for 15 min. Analyze the samples by Western blot.

[0063] Western blot analysis

[0064] Electrophoresis: First, clean the required glass plates. Wash the glass plates with DDH2O until clean. Then align the glass plates and vertically clamp them on the clip to prepare for gel preparation. Prepare a 10% concentration SDS-PAGE gel and load the prepared brain tissue samples. Connect the electrophoresis tank to the electrophoresis instrument. When running the stacking gel, use 80V for about 30 - 40 minutes. After running to the separating gel, continue electrophoresis at 120V. Determine the electrophoresis time according to the molecular weight of the target protein. (Electrophoresis instrument brand: Bio-Rad)

[0065] Transfer membrane: In the order from the negative electrode (black plate) to the positive electrode (transparent plate): fiber pad, filter paper, gel, PVDF membrane, filter paper, fiber pad, forming a sandwich-like structure. Place the clip into the transfer membrane tank, making the black side of the clip face the black side of the tank and the white side of the clip face the red side of the tank. Add 1x transfer membrane buffer and ice cubes into a container filled with ice. Generally, set the current to 300mA and the time to 90 minutes. (Transfer membrane instrument brand: Bio-Rad)

[0066] Blocking: Wash the membrane once with 1XTBST (about 5 minutes). Transfer the PDVF membrane (protein side down) into a petri dish containing 5% non-fat milk blocking solution and incubate on a shaker at room temperature for 2h. Wash the membrane once with 1XTBST (about 5 minutes).

[0067] Antibody incubation: Incubate with Tau-1 protein antibody at 4°C overnight; incubate with the corresponding enzyme-labeled secondary antibody.

[0068] Exposure: Mix the two luminescent agents A and B in the kit in a ratio of 1:1, shake well, and evenly sprinkle them on the protein side of the membrane according to the size of the membrane for exposure.

[0069] Experimental results

[0070] As Figure 3 shown, under the action of 100 μM 2-BP, with the prolongation of time, the modification level of GFAP gradually decreases.

[0071] PPT1 negatively regulates the palmitoylation modification level of GFAP

[0072] Cell sample preparation: HEK-293T cells (ATCC) were quickly taken out from liquid nitrogen and revived in a 37°C water bath. The cells were cultured in a CO2 cell incubator. When the cells were passaged to the third generation and the cell density reached about 70%, the GFAP-Flag plasmid was co-transfected with Flag, APT1-Flag, APT2-Flag, PPT1-Flag, PPT2-Flag, and ABHD17a-Flag plasmids into 6 labeled dishes of HEK-293T cells according to the method described in the Lip3000 liposome transfection kit instructions. After 24 hours of transfection, when the cell density was approximately 100%, the cells were collected. That is, the cells in the culture dish were gently pipetted with 10 ml of 1xPBS and transferred to a 15 ml centrifuge tube. The cells were centrifuged at 800 rcf for 5 minutes at room temperature, the supernatant was discarded, and the collected cells were quickly placed on ice. Calculate the amount of cell lysate to be added according to the amount of 1 ml of cell lysate (RIPA:PI = 100:1) per 1 10-cm cell culture dish.

[0073] Extract palmitoylated proteins using the Acyl-RAC (Resin-assisted Capture of S-Acylated Proteins) technique

[0074] Determine the protein concentration using the BCA method. Take 2 mg of the total protein sample, add 4 volumes of pre-cooled acetone, place it at -20°C for 30 minutes, centrifuge at 10000 rpm for 10 minutes at 4°C to precipitate the protein. Resuspend the sample with Blocking buffer (100 mM HEPES, 1.0 mM EDTA, 2.5% SDS, pH 7.3) containing PI and 50 mM NEM, and incubate with shaking at 50°C for 1 hour. Add 4 volumes of pre-cooled acetone, place it at -20°C for 30 minutes, centrifuge at 10000 rpm for 10 minutes at 4°C to precipitate the protein; wash the precipitate with 8 ml of 70% acetone, repeat 3 times. Resuspend with 1.4 ml of Binding buffer (100 mM HEPES, 1.0 mM EDTA, 1% SDS, pH 7.3) to fully dissolve the protein, and divide it into +HA and -HA. Add 50 μl of the prepared beads, incubate at room temperature for 4 hours (keep the room temperature at 25°C), and take an equal amount of the remaining protein as a control. Centrifuge at 1000 g, discard the supernatant. Wash 5 times with Binding buffer and centrifuge at 1000 rpm for 1 minute. Elute the target protein with 50 μl of Laemmli loading buffer (2.1% SDS, 66 mM Tris, 50 mM DTT) at 42°C for 15 minutes. The samples were analyzed by Western blot.

[0075] Western blot analysis

[0076] Electrophoresis: First, clean the required glass plates. Wash the glass plates with DDH2O until clean, then align the glass plates and vertically clamp them in the clips to prepare for gel preparation. Prepare a 10% concentration SDS-PAGE gel and load the prepared brain tissue samples. Connect the electrophoresis tank to the electrophoresis instrument. Use 80V for the stacking gel, which takes about 30 - 40 minutes. After running into the separating gel, continue electrophoresis at 120V, and determine the electrophoresis time according to the molecular weight of the target protein. (Electrophoresis instrument brand: Bio-Rad)

[0077] Transfer membrane: In the order from the negative electrode (black plate) to the positive electrode (transparent plate): fiber pad, filter paper, gel, PVDF membrane, filter paper, fiber pad, in a sandwich-like structure. Place the clip into the transfer membrane tank, making the black side of the clip face the black side of the tank and the white side of the clip face the red side of the tank. Add 1x transfer membrane buffer and ice cubes into a container filled with ice. Generally, set the current to 300mA and the time to 90 minutes. (Transfer membrane instrument brand: Bio-Rad)

[0078] Blocking: Wash the membrane once with 1XTBST (about 5 minutes). Transfer the PDVF membrane (protein side down) into a petri dish containing 5% non-fat milk blocking solution and incubate on a shaker at room temperature for 2h. Wash the membrane once with 1XTBST (about 5 minutes).

[0079] Antibody incubation: Incubate with Tau-1 protein antibody at 4°C overnight; incubate with the corresponding enzyme-labeled secondary antibody.

[0080] Exposure: Mix the two luminescent agents A and B in the kit in a ratio of 1:1, shake well, and evenly sprinkle them on the protein side of the membrane according to the size of the membrane for exposure.

[0081] Experimental results

[0082] As Figure 4 shown, in the samples co-transfected with PPT1 and GFAP, the palmitoylation modification level of GFAP was significantly lower than that of the flag empty vector control, indicating that PPT1 can negatively regulate the palmitoylation modification of GFAP.

[0083] The palmitoylation modification level of GFAP in the brains of PPT1-deficient mice increased significantly

[0084] Brain tissue samples: B6 and PPT1-KI mice at 1, 3, and 6 months of age were selected for the experiment. First, wash the grinding container with DDH2O, then dry it in an oven to completely remove moisture. Pour an appropriate amount of liquid nitrogen into a thermal insulation foam box, and then transfer it to the dried mortar for pre-cooling together with the pestle. Repeat the above steps twice, and the grinding container should be fully pre-cooled. Add mouse brain tissue to the grinding container, pour in an appropriate amount of liquid nitrogen, wait for the brain tissue to become brittle, and quickly grind it. Add RIPA Buffer (PMSF:RIPA = 1:100) to the homogenized mouse brain tissue and place it on ice for 30 minutes. Centrifuge at 12000 rpm at 4°C for 10 minutes. Transfer the supernatant to a new centrifuge tube, take a small amount of protein to measure the protein concentration, and store the remaining samples at -80°C for later use.

[0085] Extract palmitoylated proteins using the Acyl-RAC (Resin-assisted Capture of S-Acylated Proteins) technique

[0086] Determine the protein concentration using the BCA method. Take 2 mg of the total protein sample, add 4 volumes of pre-cooled acetone, place it at -20°C for 30 min, centrifuge at 10000 rpm at 4°C for 10 min to precipitate the protein. Resuspend the sample with Blocking buffer (100 mM HEPES, 1.0 mM EDTA, 2.5% SDS, pH 7.3) containing PI and 50 mM NEM, and incubate with shaking at 50°C for 1 h. Add 4 volumes of pre-cooled acetone, place it at -20°C for 30 min, centrifuge at 10000 rpm at 4°C for 10 min to precipitate the protein; wash the precipitate with 8 ml of 70% acetone and repeat 3 times. Resuspend with 1.4 ml of Binding buffer (100 mM HEPES, 1.0 mM EDTA, 1% SDS, pH 7.3) to fully dissolve the protein, and divide it into +HA and -HA. Add 50 μl of the prepared beads, incubate at room temperature (ensure 25°C) for 4 h, and take an equal amount of the remaining protein as a control. Centrifuge at 1000 g and discard the supernatant. Wash 5 times with Binding buffer and centrifuge at 1000 rpm for 1 min. Elute the target protein with 50 μl of Laemmli loading buffer (2.1% SDS, 66 mM Tris, 50 mM DTT) at 42°C for 15 min. Perform Western blot analysis on the samples.

[0087] Western blot analysis

[0088] Electrophoresis: First, clean the required glass plates. Wash the glass plates with DDH2O until clean, then align the glass plates and vertically clamp them on the clips to prepare for gel preparation. Prepare a 10% concentration SDS-PAGE gel and load the prepared brain tissue samples. Connect the electrophoresis tank to the electrophoresis instrument. When running the stacking gel, use 80V for about 30 - 40 minutes. After running to the separating gel, continue electrophoresis at 120V. Determine the electrophoresis time according to the molecular weight of the target protein. (Electrophoresis instrument brand: Bio-Rad)

[0089] Transfer membrane: In the direction from the negative electrode (black plate) to the positive electrode (transparent plate) in sequence: fiber pad, filter paper, gel, PVDF membrane, filter paper, fiber pad, in a sandwich-like form. Put the clip into the transfer membrane tank, making the black side of the clip face the black side of the tank and the white side of the clip face the red side of the tank. Add 1x transfer membrane buffer and ice into a container filled with ice. Generally, set the current to 300mA and the time to 90 minutes. (Transfer membrane instrument brand: Bio-Rad)

[0090] Blocking: Wash the membrane once with 1XTBST (about 5 minutes). Transfer the PDVF membrane (protein side down) into a petri dish containing 5% skim milk blocking solution and incubate on a shaker at room temperature for 2h. Wash the membrane once with 1XTBST (about 5 minutes).

[0091] Antibody incubation: Incubate with Tau-1 protein antibody overnight at 4°C; incubate with the corresponding enzyme-labeled secondary antibody.

[0092] Exposure: Mix the two luminescent agents A and B in the kit in a ratio of 1:1, shake well, and evenly sprinkle it on the protein side of the membrane according to the size of the membrane for exposure.

[0093] Experimental results

[0094] As Figure 5 shown, compared with B6 mice, the palmitoylation modification of GFAP protein in the brains of PPT1-KI mice increased significantly with increasing mouse age.

[0095] The increase in the level of GFAP palmitoylation modification in PPT1-deficient mice enhanced the proliferation rate of glial cells

[0096] Isolation and culture of primary mouse astrocytes

[0097] (1) Select four genotypes of mice, namely B6, PPT1-KI, GFAP-C291A / B6, and GFAP-C291A / PPT1-KI, at P1-3. Disinfect the mice and place them in a sterile petri dish. In a laminar flow hood, use clean forceps to tear off the arachnoid and pia mater, remove the hippocampus, cerebellum, and blood vessels. In the avascular area, use forceps to pick up the bilateral cerebral cortex tissues on both sides, place them in cold HBSS and wash 3 times, try to cut them into small pieces and transfer them to a 15ml centrifuge tube, and discard the HBSS.

[0098] (2) Add an appropriate amount of 0.25% trypsin solution (such as adding 400 μl of 2.5% trypsin to HBSS to make 4 ml), digest at 37 °C for 15 min (shake well every 3 min), add 1 - 2 ml of DMEM / F12++ and pipette gently (<30 times). Then add 2 - 3 ml of DMEM / F12++ to terminate the digestion.

[0099] (3) Filter with a stainless steel mesh with a pore size of 100 μm. After filtration, centrifuge the filtrate at 1200 rpm for 5 min and discard the supernatant.

[0100] (4) Suspend the cells with DMEM / F12++ medium, pipette to make a single - cell suspension, count the cells, and inoculate the cells into a culture flask coated with PDL (density about 1.5 - 3.0×10 6 cells / cm 2 ) and culture in a CO2 cell incubator.

[0101] (5) Change the medium the next day (change half of the medium) to remove non - adherent cells with poor viability or dead cells.

[0102] (6) Continue to culture for 9 - 14 d. When the color of the culture medium turns slightly yellow, change the medium, and shake gently each time when changing the medium.

[0103] Analysis of the proliferation rate of glial cells

[0104] Respectively inoculate the isolated astrocytes of B6 and PPT1 - KI mice into 96 - well plates, and inoculate at a density of 2.5x10 4 cells / well. Use a cell counting kit (CCK8, Dojin, Kumamoto Japan) to measure the proliferation rate of U251 cells at different time points after transfection, and use a microplate reader (Infinite M200 Pro, Tecan) to measure the absorbance at 450 nm. All experiments were repeated three times.

[0105] The results are as Figure 6 shown, and the proliferation rate of astrocytes in PPT1 - KI mice increased significantly.

[0106] The following illustrates the specific implementation manners of the present invention through examples, and illustrates the invention effects through experimental verification.

[0107] Example Application of GFAP amino acid sites as therapeutic targets for neurodegenerative diseases

[0108] In this application, the GFAP amino acid site is the 291st cysteine of GFAP. The "treatment of neurodegenerative diseases" is achieved by mutating the 291st cysteine of GFAP to an amino acid without a sulfhydryl group. In this example, the amino acid without a sulfhydryl group is specifically alanine. The following describes the specific scheme for mutating the 291st cysteine of GFAP to alanine, the application of the preparation for treating neurodegenerative diseases derived from this technical scheme, or the application for treating neurodegenerative diseases, as well as the relevant vectors, sequences or fragments and their applications all fall within the scope of protection of the present invention.

[0109] (1) The specific scheme for mutating the 291st cysteine of mouse GFAP to alanine is as follows

[0110] 1. Knock-in scheme

[0111] Based on the genomic sequence of mouse GFAP according to sequence analysis, design the GFAP-gDNA sequence, which is Sequence 1 shown in SEQ ID NO:1: GCGCAGGGACTCCAGATCGC; the cleavage site introduced by the CRIPR system of this sequence is near the 291st amino acid codon of GFAP; add an adapter sequence to the GFAP-gDNA sequence, which is called GFAP-gDNA-F in the present invention, and is Sequence 2 shown in SEQ ID NO:2: CACCGCGCAGGGACTCCAGATCGC; add an adapter sequence to the reverse complementary sequence of Sequence 2, which is called GFAP-gDNA-R in the present invention, and is Sequence 3 shown in SEQ ID NO:3: AAACGCGATCTGGAGTCCCTGCGC; anneal Sequence 2 and 3 directly to form a double-stranded DNA with an adapter, and insert it into the pX458 vector digested by BbsI, which is called pX458-GFAP-gDNA vector in the present invention. The genomic sequence fragment is called GFAP-DNA, and is Sequence 4 shown in SEQ ID NO:4:

[0112] AACCAGTGGTTCCTGTCGGTGCTCACCGTGCCGCGCAGGGACTCCAGATC GCAG GTCAAGGCCTGCAGTTGGCGGC GATAGTCGTTAGCTTCGTGCTTGGCTTG

[0113] At the same time, synthesize the DNA sequence containing the mutation site, which is called GFAP-rDNA, and is Sequence 5 shown in SEQ ID NO:5:

[0114] AACCAGTGGTTCCTGTCGGTGCTCACCGTGCCGCGCAGGGACTCCAGATC AGCAGTCAAGGCCTGCAGTTGGCGGC GATAGTCGTTAGCTTCGTGCTTGGCTTG

[0115] The sequence GFAP-rDNA for recombination contains 4 base mutations. After gene recombination, cysteine at position 291 is mutated to alanine, and at the same time, the cleavage site of Cas9 is blocked to prevent re-cutting.

[0116] 2. Microinjection of fertilized eggs and screening of recombinant mice

[0117] The gRNA / Cas9 mRNA was in vitro transcribed using the pX458-GFAP-gDNA vector (Transcription kit: NEB, Cat.E2050S), and the gRNA / Cas9 mRNA and the recombinant DNA fragment were microinjected into the pronucleus of mouse fertilized eggs; F0 generation mice were obtained.

[0118] (2) The effects of this example were verified by performing relevant tests on the F0 generation mice and the inbred homozygous mice obtained by screening.

[0119] 1. Genotype identification of F0 generation mice was performed using PCR and sequencing analysis. The test results, as Figure 7 shown, the sequencing results showed that the GFAP gene was successfully recombined according to the design.

[0120] 2. F1 generation mice were obtained by self-crossing F0 generation mice, and genotype identification of F1 generation mice was performed using PCR and sequencing analysis; finally, GFAP-KI homozygous mice with cysteine at position 291 of GFAP mutated to alanine were screened. Then the following tests and analyses were carried out.

[0121] The mutation of cysteine at position 291 of GFAP significantly reduced the palmitoylation modification level of GFAP

[0122] Brain tissue samples: B6, PPT1-KI, and mice with GFAP-KI introduced under the PPT1-KI background at 1, 3, and 6 months of age were selected for experiments. First, wash the grinding container with DDH2O, then dry it in an oven to completely remove moisture. Pour an appropriate amount of liquid nitrogen into a thermal insulation foam box, and then transfer it to a dried mortar for pre-cooling together with the column. Repeat the above steps twice, and the grinding container should be fully pre-cooled. Add mouse brain tissue to the grinding container, pour in an appropriate amount of liquid nitrogen, wait until the brain tissue becomes brittle, and quickly grind it. Add RIPA Buffer (PMSF:RIPA = 1:100) to the homogenized mouse brain tissue and place it on ice for 30 minutes. Centrifuge at 12000 rpm at 4°C for 10 minutes. Transfer the supernatant to a new centrifuge tube, take a small amount of protein for measuring protein concentration, and store the remaining samples at -80°C for later use.

[0123] Extraction of Palmitoylated Proteins Using the Acyl-RAC (Resin-assisted Capture of S-Acylated Proteins) Technique

[0124] Determine the protein concentration using the BCA method. Take 2 mg of the total protein sample, add 4 volumes of pre-cooled acetone, place at -20 °C for 30 min, centrifuge at 10,000 rpm for 10 min at 4 °C to precipitate the protein. Resuspend the sample with Blocking buffer (100 mM HEPES, 1.0 mM EDTA, 2.5% SDS, pH 7.3) containing PI and 50 mM NEM, and incubate with shaking at 50 °C for 1 h. Add 4 volumes of pre-cooled acetone, place at -20 °C for 30 min, centrifuge at 10,000 rpm for 10 min at 4 °C to precipitate the protein; wash the precipitate with 8 ml of 70% acetone, repeat 3 times. Resuspend with 1.4 ml of Binding buffer (100 mM HEPES, 1.0 mM EDTA, 1% SDS, pH 7.3) to fully dissolve the protein, and divide it into +HA and -HA. Add 50 μl of the prepared beads, incubate at room temperature (ensure 25 °C) for 4 h, and take an equal amount of the remaining protein as a control. Centrifuge at 1000 g and discard the supernatant. Wash 5 times with Binding buffer, centrifuge at 1000 rpm for 1 min. Elute the target protein by treating with 50 μl of Laemmli loading buffer (2.1% SDS, 66 mM Tris, 50 mM DTT) at 42 °C for 15 min. Analyze the samples by Western blot detection.

[0125] Western blot analysis

[0126] Electrophoresis: First, clean the required glass plates. Wash the glass plates with DDH2O until clean, then align the glass plates and vertically clamp them in the clips to prepare for gel preparation. Prepare a 10% concentration SDS-PAGE gel, and load the prepared brain tissue samples; connect the electrophoresis tank to the electrophoresis instrument. When running the stacking gel, use 80 V first, which takes about 30 - 40 minutes, and then use 120 V to continue electrophoresis after running into the separating gel. Determine the electrophoresis time according to the molecular weight of the target protein. (Electrophoresis instrument brand: Bio-Rad)

[0127] Transfer membrane: In the order from the negative electrode (black plate) to the positive electrode (transparent plate): fiber pad, filter paper, gel, PVDF membrane, filter paper, fiber pad, in a sandwich-like manner. Place the clip into the transfer membrane tank, ensuring that the black side of the clip faces the black side of the tank and the white side of the clip faces the red side of the tank. Add 1x transfer membrane solution and ice into a container filled with ice. Generally, set the current to 300 mA and the time to 90 minutes. (Transfer membrane instrument brand: Bio-Rad)

[0128] Blocking: Wash the membrane once with 1XTBST (about 5 minutes). Transfer the PVDF membrane (protein side down) into a petri dish containing 5% non-fat milk blocking solution and incubate on a shaker at room temperature for 2 hours. Wash the membrane once with 1XTBST (about 5 minutes).

[0129] Antibody Incubation: Incubate with Tau-1 protein antibody overnight at 4°C; incubate with the corresponding enzyme-labeled secondary antibody.

[0130] Exposure: Mix the two luminescent agents A and B in the kit in a 1:1 ratio, shake well, and evenly sprinkle it on the protein side of the membrane according to the size of the membrane for exposure.

[0131] Experimental Results

[0132] As Figure 8 shown, the palmitoylation modification level of GFAP in the brains of mice containing GFAP-KI was significantly reduced.

[0133] Mutation of cysteine at position 291 of GFAP to alanine reduced the proliferation rate of glial cells

[0134] Isolation and Culture of Primary Mouse Astrocytes

[0135] (1) Select four genotypes of mice, B6, PPT1-KI, GFAP-C291A / B6, and GFAP-C291A / PPT1-KI, at P1-3. Disinfect the mice and place them in a sterile petri dish. Under a laminar flow hood, use clean forceps to tear off the arachnoid and pia mater, remove the hippocampus, cerebellum, and blood vessels. In the avascular area, use forceps to pick up the bilateral cerebral cortex tissues, wash them 3 times in cold HBSS, cut them into small pieces as much as possible and transfer them to a 15 ml centrifuge tube, and discard the HBSS.

[0136] (2) Add an appropriate amount of 0.25% (such as adding 400 μl of 2.5% trypsin to HBSS to make 4 ml) trypsin solution, digest at 37°C for 15 minutes (shake well every 3 minutes), add 1 - 2 ml of DMEM / F12++ and blow it into pieces (<30 times). Then add 2 - 3 ml of DMEM / F12++ to terminate the digestion.

[0137] (3) Filter with a stainless steel mesh with a pore size of 100 μm. After filtration, centrifuge the filtrate at 1200 rpm for 5 minutes and discard the supernatant.

[0138] (4) Suspend the cells with DMEM / F12++ medium and pipette to make a single-cell suspension, count the cells, and seed the cells into a PDL-coated culture flask (at a density of about 1.5 - 3.0×10 6 cells / cm 2 ) and culture in a CO2 cell incubator.

[0139] (5) Change the culture medium the next day (change half of the volume), and remove the non-adherent cells with poor viability or dead cells.

[0140] (6) Continue culturing for 9 - 14 days. When the color of the culture medium turns slightly yellow, change the culture medium, and shake gently each time when changing the medium.

[0141] Analysis of the proliferation rate of glial cells

[0142] Four genotypes of astrocytes were respectively inoculated into 96-well plates at a density of 2.5x10 4 cells / well. The proliferation rate of U251 cells at different time points after transfection was measured using a cell counting kit (CCK8, Dojin, Kumamoto Japan), and the absorbance was measured at 450 nm using a microplate reader (Infinite M200 Pro, Tecan). All experiments were repeated three times.

[0143] The experimental results are as Figure 9 shown. The proliferation rate of astrocytes transfected with GFAP-C291A mice was significantly reduced.

[0144] Immunohistochemical analysis of the number of astrocytes in mouse brain tissue

[0145] 2.1.1 Mouse breeding

[0146] The homozygous GFAP knock-in mice (GFAP-KI) constructed were crossed with the homozygous PPT1 knock-in mice (PPT1-KI) to first obtain GFAP-KI / PPT1-KI heterozygous mice; the heterozygous mice were self-crossed and bred, and then through PCR analysis and sequencing analysis, finally, GFAP-KI / PPT1-KI homozygous mice were obtained.

[0147] 2.1.2 Mouse perfusion

[0148] Three-month-old and six-month-old PPT1-KO mice, three-month-old and six-month-old GFAP-KI / PPT1-KI double mutant mice were respectively taken. The experimental mice were anesthetized intraperitoneally and then perfused, that is: first, quickly perfuse with about 150 ml of 1xPBS and then perfuse with about 150 ml of paraformaldehyde. When the mice showed stiffness in the trunk, limbs, and liver, the perfusion was completed. Remove the fixation, quickly take out the brain tissue, rinse it clean with physiological saline, and place it in paraformaldehyde at 4°C for external fixation. The fixation time does not exceed 24 h. After cardiac perfusion, take the brain tissue and place it in 4% paraformaldehyde for 24 hours. Make it into paraffin blocks.

[0149] 2.1.3 Immunohistochemical analysis

[0150] The paraffin sections were placed in an oven at 67°C for 2 hours for baking, then dewaxed to water, rinsed three times with PBS at pH 7.4 for 3 minutes each time. A certain amount of citrate buffer at pH = 6.0 was taken and added to a microwave box, heated to boiling by microwave. The dewaxed and hydrated tissue sections were placed on a heat-resistant plastic section rack and put into the boiling buffer, and treated with medium-power microwave for 10 minutes. The microwave box was taken out and cooled naturally with running water. The glass slides were taken out from the buffer, rinsed twice with distilled water first, and then rinsed 2 times with PBS. One drop of 3% H2O2 was added to each section and incubated at room temperature for 10 minutes to block the activity of endogenous peroxidase. Rinsed 3 times with PBS. The PBS solution was removed, one drop of anti-GFAP rabbit antibody was added to each section and incubated at room temperature for 2 hours. Rinsed 3 times with PBS. The PBS was removed, one drop of polymer enhancer was added to each section and incubated at room temperature for 20 minutes. Rinsed 3 times with PBS. The PBS was removed, one drop of enzyme-labeled anti-rabbit antibody was added to each section and incubated at room temperature for 30 minutes. Rinsed 3 times with PBS. The PBS was removed, one drop of freshly prepared DAB solution (diaminobenzidine) was added to each section and observed under a microscope for 5 minutes. Counterstained with hematoxylin, differentiated with 0.1% HCl, rinsed with tap water, blued, the sections were dehydrated and dried with gradient ethanol, cleared with xylene, and sealed with neutral gum, and observed after air drying.

[0151] 2.1.4 Results

[0152] As Figure 10 shown, by comparing the immunohistochemical results of the brain tissues of PPT1-KI mice and PPT1-KI / GFAP-KI double mutant mice, it was found that after introducing the cysteine mutation at position 291 of GFAP in the background of PPT1-KI mice, the astrocytes in the brain tissues were significantly reduced.

[0153] Analysis of the number of astrocytes in the cerebral cortex of mice

[0154] Mouse perfusion

[0155] The required experimental mice were anesthetized intraperitoneally and then perfused, that is: first perfused rapidly with about 150 ml of 1x PBS and then perfused with about 150 ml of paraformaldehyde. When the trunk, limbs and liver of the mouse became stiff, the perfusion was completed. The fixation was released, the brain tissue was quickly taken out, rinsed clean with normal saline, and placed in paraformaldehyde for external fixation at 4°C, and the fixation time did not exceed 24 h.

[0156] Clarification treatment

[0157] The mouse brain tissues were clarified by the X-CLARITY (Logos Biosystems) method: incubated with hydrogel for 24 h; polymerized for 3 h; tissue clarified for 16 h.

[0158] Staining

[0159] Staining of the transparent mouse brain: The samples were incubated in 1% PBST at 37°C in the dark for 24 h. (65 rpm, changing to fresh PBST three times in the middle), the samples were transferred to the primary antibody solution (the antibody was diluted 1:100), and incubated for about 5 days. (37°C, in the dark, 65 rpm), washed with 1% PBST solution for 24 h, and fresh PBST needed to be replaced during the process, three times. (37°C, in the dark, 65 rpm),

[0160] The samples were transferred to the fluorescent secondary antibody solution (the antibody was diluted 1:100), and incubated for about 5 days. (37°C, in the dark, 65 rpm), washed with 1% PBST solution for 24 h, and fresh PBST needed to be replaced during the process, three times. (37°C, in the dark, 65 rpm), washed with distilled water at least three times, and fresh distilled water needed to be replaced each time, 5 minutes each time, for a total of 15 minutes. (37°C, in the dark, 65 rpm), before imaging, the brain tissue sections were incubated in Mounting Solution for 12 h. (37°C, in the dark), confocal microscopy was used for scanning imaging (Leica DMi8 microscope).

[0161] As Figure 11 shown: The number of astrocytes in the cerebral cortex of 6-month-old PPT1-KI mice was significantly higher than that in the cerebral cortex of mice with the cysteine mutation at position 291 of GFAP introduced on the background of PPT1-KI mice; at the same time, the number of neurons (NeuN staining) in mice with the cysteine mutation at position 291 of GFAP introduced on the background of PPT1-KI mice was significantly increased, indicating that the cysteine mutation at position 291 of GFAP inhibited the proliferation of astrocytes caused by PPT1 deficiency and also inhibited the neuronal damage caused by gliosis.

[0162] Analysis of Tau-1 protein content in mouse brain tissue

[0163] 2.2.1 Extraction of brain tissue proteins: The mice were sacrificed by CO2, and the brain tissues were taken. First, wash the grinding container with DDH2O, then dry it in the oven to completely remove the moisture. Pour an appropriate amount of liquid nitrogen into a thermal insulation foam box, and then transfer it to the dried mortar, and pre-cool it together with the column. Repeat the above steps twice, and the grinding container should be fully pre-cooled. Add mouse brain tissue to the grinding container, pour in an appropriate amount of liquid nitrogen, wait for the brain tissue to become brittle, and quickly grind it. Add RIPA Buffer (PMSF:RIPA = 1:100) to the homogenized mouse brain tissue and place it on ice for 30 minutes. Centrifuge at 12000 rpm at 4°C for 10 minutes. Take the supernatant and transfer it to a new centrifuge tube, and take a small amount of protein for measuring the protein concentration. Make samples at 100°C according to the protein concentration.

[0164] 2.2.2 Western blot analysis

[0165] Electrophorese the same amount of brain tissue proteins from different mice, and perform membrane transfer operations; incubate with Tau-1 protein antibody overnight at 4°C; wash the membrane with PBS, and incubate with the corresponding enzyme-labeled secondary antibody; wash the membrane with PBS. Drop the chromogenic solution on the membrane and expose it for photography. The specific steps are as follows:

[0166] Electrophoresis: First, clean the required glass plates. Wash the glass plates with DDH2O until clean, then align the glass plates and vertically clamp them on the clips for preparing the gel. Prepare a 10% concentration SDS-PAGE gel and load the prepared brain tissue samples; connect the electrophoresis tank to the electrophoresis instrument. When running the stacking gel, use 80V for about 30 - 40 minutes. After running to the separating gel, continue electrophoresis at 120V. Determine the electrophoresis time according to the molecular weight of the target protein. (Electrophoresis instrument brand: Bio-Rad)

[0167] Membrane transfer: In the direction from the negative electrode (black plate) to the positive electrode (transparent plate) in sequence: fiber pad, filter paper, gel, PVDF membrane, filter paper, fiber pad, in a sandwich-like structure. Place the clip in the membrane transfer tank, ensuring that the black side of the clip faces the black side of the tank and the white side of the clip faces the red side of the tank. Add 1x membrane transfer buffer and ice cubes into a container filled with ice. Generally, set the current to 300mA and the time to 90 minutes. (Membrane transfer instrument brand: Bio-Rad)

[0168] Blocking: Wash the membrane once with 1XTBST (about 5 minutes). Transfer the PDVF membrane (protein side down) into a petri dish containing 5% non-fat milk blocking solution and incubate on a shaker at room temperature for 2h. Wash the membrane once with 1XTBST (about 5 minutes).

[0169] Antibody incubation: Incubate with Tau-1 protein antibody overnight at 4°C; incubate with the corresponding enzyme-labeled secondary antibody.

[0170] Exposure: Mix the two luminescent agents A and B in the kit in a ratio of 1:1, shake well, and evenly sprinkle it on the protein side of the membrane according to the size of the membrane for exposure.

[0171] 2.2.3 Results

[0172] As Figure 12 shown, by comparing the content of Tau-1 protein in the brain tissues of PPT1-KI mice and PPT1-KI / GFAP-KI double mutant mice, it was found that after introducing the cysteine mutation at position 291 of GFAP in the background of PPT1-KI mice, the Tau-1 protein in the brain tissue increased significantly, indicating that the neurons of the mice were restored.

[0173] Mouse tail suspension observation

[0174] Take 6-month-old mice, hold the mice's tails with forceps and hang the mice upside down to observe the stretching state of the mice's paws. As Figure 13As shown, 6-month-old PPT1-KI mice showed obvious morbidity, with their hind leg claws retracted together; after introducing the cysteine-291 mutation of GFAP into the background of PPT1-KI mice, the hind leg claws were in an open state, indicating that the cysteine-291 mutation of GFAP restored the disease caused by PPT1 deficiency.

[0175] Mouse survival curve

[0176] Analyze the survival time of PPT1-KI mice and mice with the cysteine-291 mutation of GFAP introduced into the background of PPT1-KI mice. As Figure 14 shown, after introducing the cysteine-291 mutation of GFAP into the background of PPT1-KI mice, the survival time of the mice was significantly prolonged, indicating that the cysteine-291 mutation of GFAP restored the disease caused by PPT1 deficiency.

[0177] The above experiments can verify that blocking the palmitoylation modification of cysteine-291 of GFAP can effectively reduce the proliferation rate of glial cells, thereby playing a protective role on neurons. This is the fundamental starting point for cysteine-291 of GFAP to become a drug target for treating neurodegenerative diseases. Based on the existing physiological and biochemical knowledge and the above description, it can be shown that the technical solution claimed in the present invention has sufficient theoretical and experimental basis. It is easy for those skilled in the art to understand that the present invention involves many specific technical solutions, and these solutions cannot be exhausted. The above description of the principle and examples is sufficient to support the protection scope of the present invention. That is to say, as long as the application of GFAP amino acid sites as drug targets for treating neurodegenerative diseases should be protected by the present invention. SEQUENCE LISTING <110> Kong, Eryan <120> Application of GFAP Amino Acid Sites as Drug Targets for Treating Neurodegenerative Diseases <130> -- <160> 5 <170> PatentIn version 3.3 <210> 1 <211> 20 <212> DNA <213> Artificial <220> <223> GFAP-gDNA <400> 1 gcgcagggac tccagatcgc 20 <210> 2 <211> 24 <212> DNA <213> Artificial <220> <223> GFAP-gDNA-F <400> 2 caccgcgcag ggactccaga tcgc 24 <210> 3 <211> 24 <212> DNA <213> Artificial <220> <223> GFAP-gDNA-R <400> 3 aaacgcgatc tggagtccct gcgc 24 <210> 4 <211> 104 <212> DNA <213> Artificial <220> <223> GFAP-DNA <400> 4 aaccagtggt tcctgtcggt gctcaccgtg ccgcgcaggg actccagatc gcaggtcaag 60 gcctgcagtt ggcggcgata gtcgttagct tcgtgcttgg cttg 104 <210> 5 <211> 104 <212> DNA <213> Artificial <220> <223> GFAP-rDNA <400> 5 aaccagtggt tcctgtcggt gctcaccgtg ccgcgcaggg actccagatc agcagtcaag 60 gcctgcagtt ggcggcgata gtcgttagct tcgtgcttgg cttg 104

Claims

1. Use of GFAP amino acid sites as a therapeutic target for neurodegenerative diseases, characterized in that, The GFAP amino acid site is the 291st cysteine of GFAP. The way of using the GFAP amino acid site as a therapeutic target for neurodegenerative diseases is to block the palmitoylation of the 291st cysteine of GFAP. The application is for screening drugs for treating neurodegenerative diseases.

2. The application according to claim 1, characterized in that, The method of "blocking the palmitoylation of the 291st cysteine of GFAP" is a gene knock-in method in which the codon of the 291st cysteine of GFAP is mutated into a codon without a thiol-containing amino acid.

3. The application according to claim 2, characterized in that, The gene knock-in method is as follows: Add linkers to the sequences near the codon of the 291st amino acid of GFAP to form two complementary sequences with linkers. The complementary sequences are annealed and inserted into the digested vector to form a recombinant vector. The recombinant vector is used for gene recombination to mutate the 291st cysteine of GFAP into an amino acid without a thiol group.

4. The application according to claim 3, characterized in that The recombinant vector is a recombinant vector formed by inserting into the pX458 vector digested by BbsI. The gene knock-in uses the cleavage site of Cas9, and the cleavage site of Cas9 is closed after the knock-in is completed.

5. The application according to claim 3, wherein The sequence near the codon of the 291st amino acid of GFAP is the sequence shown in SEQ ID NO:1; The two complementary sequences with linkers are the sequences shown in SEQ ID NO:2 and SEQ ID NO:3 respectively.

6. The application according to claim 1, wherein The method of "blocking the palmitoylation of the 291st cysteine of GFAP" is to post-translationally modify the 291st cysteine of GFAP to block its palmitoylation modification.

7. The application according to claim 6, characterized in that The screening index for screening drugs for treating neurodegenerative diseases is the degree of blocking of the palmitoylation modification of the 291st cysteine of GFAP.

8. The recombinant vector in the application according to claim 3 or 4.

9. The mutant GFAP after the 291st cysteine of GFAP is mutated into an amino acid without a thiol group.

10. The nucleic acid encoding the mutant GFAP according to claim 9.

Citation Information

Patent Citations

  • Stabilized peptide-mediated targeted protein degradation

    CN112119085A

  • Anti-human GFAP antibody and application thereof

    CN117964753A

  • Gene therapy for diseases with CNS manifestation

    CN119301262A

  • Treatment of diseases associated with protein misfolding by nervous system expression of an enzyme which has a deoxyribonuclease (DNASE) activity

    WO2021011368A1