Application of brassinolide in increasing the content of sakurain in rice

Abstract

The present invention discloses the use of brassinolide for increasing the sakurain content in rice. This study first discovered that brassinolide can be used to increase sakurain content in rice and hypothesized the mechanism, suggesting that BL treatment induces the expression of the sakurain biosynthesizing enzyme OsNOMT, thereby increasing sakurain content. The present invention is simple to implement and has significant effects, providing a powerful reference for increasing sakurain content in rice and improving rice immunity.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to the application of brassinolide in increasing the content of sakurain in rice. Background Art

[0002] Brassinosteroids (BRs) are an important class of growth-promoting sterol hormones endogenously synthesized in plants. The BR pathway, in addition to participating in plant growth and development and physiological processes, also plays a crucial role in host defense against pathogens such as bacteria, fungi, and viruses. Previous studies have shown that the BR pathway plays a crucial role in regulating the synthesis of plant secondary metabolites, particularly flavonoids. Flavonoids are a general term for a series of compounds composed of C6-C3-C6, which can be divided into flavonoids, flavonols, flavanones, isoflavones, and anthocyanins. In addition to regulating plant life, plant flavonoids possess potent physiological activities in medicine, including antitussive and antiasthmatic, antibacterial, anti-inflammatory, antiviral, and antitumor properties, as well as significant therapeutic effects on the cardiovascular and central nervous systems. In the food industry, flavonoids are increasingly valued as food antioxidants due to their high efficacy, low toxicity, low cost, and readily available availability. Brassinolide (BL) is the most bioactive BR discovered to date. Exogenous BL treatment inhibits flavonoid biosynthesis in Arabidopsis and apple. However, in cucumber and grapes, spraying BL induces flavonoid accumulation. This suggests that BL treatment regulates the flavonoid pathway differently in different plant species.

[0003] Sakurenatin is the only flavonoid among the 16 plant-keeping compounds induced by rice after infection with the rice blast fungus. It exhibits strong anti-blast and detoxification activities both in vitro and in vivo. It also plays a significant role in delaying aging, resisting viruses, treating diabetes, and preventing cancer. Under normal growth conditions, sakurenatin content in rice is very low, but its synthesis is significantly induced under stresses such as UV irradiation, CuCl2, and jasmonic acid. Sakurenatin is a product of the flavanone branch of the flavonoid biosynthesis pathway, and naringenin 7-O-methyltransferase (NOMT) ​​is a key enzyme in the synthesis of sakurenatin. To date, there have been no published reports of BR-induced sakurenatin synthesis. Summary of the Invention

[0004] The present invention aims to address the deficiencies of the prior art and to provide a method for increasing the sakurabin content in rice by using brassinolide. Specifically, the method involves spraying BL on rice seedlings during rice cultivation to quickly and effectively increase the sakurabin content in rice.

[0005] In a first aspect, the invention provides the application of brassinolide in increasing the content of sakurain in rice.

[0006] In a first aspect, a method for increasing the content of sakurain in rice is provided, wherein the content of sakurain in rice leaves is increased by exogenous spraying of BL.

[0007] Preferably, BL is sprayed on rice leaves;

[0008] Preferably, the rice is at the 2-3 leaf stage;

[0009] Preferably, the concentration of BL is 1 μM;

[0010] Preferably, the spraying cycle is once every 2 days;

[0011] Preferably, the spraying capacity is such that the entire leaf is wetted, that is, until water begins to drip from the leaf;

[0012] Preferably, BL induces the expression of sakuradin synthase OsNOMT, thereby increasing the content of sakuradin.

[0013] The present invention has the beneficial effect of inducing expression of the rice sakurain biosynthesis gene OsNOMT in rice seedlings after BL treatment, thereby increasing sakurain content. This is the first discovery that BL can be used to increase sakurain content in rice. The mechanism of this discovery is hypothesized, suggesting that BL treatment induces expression of the sakurain biosynthesis enzyme OsNOMT, thereby increasing sakurain content. The present invention is simple to implement and has significant effects, providing a powerful reference for increasing sakurain content in rice and improving rice immunity. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The expression of sakuramin synthase gene OsNOMT after BL treatment.

[0015] Figure 2 HPLC / MS chromatograms of standards and samples.

[0016] Figure 3 This is the result of detecting the sakurain content in rice leaves after BL treatment. DETAILED DESCRIPTION

[0017] The present invention is further described below with reference to specific embodiments. These embodiments should be understood as merely the best examples of the present invention and are not intended to limit the present invention in any way. Any improvements, modifications, and equivalent substitutions made within the scope of the present invention should be included in the scope of the present invention.

[0018] Example 1: BL spraying on rice leaves

[0019] 1. Rice Cultivation: Soak Nipponbare rice seeds in water in a conical flask in a 37°C incubator for two days. Change the water daily, morning and evening, until the seeds turn white. Place 200 mL of nutrient soil in a 1L beaker and sow the seeds, 20 plants per beaker. Cultivate in a greenhouse (28°C, 12 hours of light per day) until ready to use.

[0020] 2. Preparation of BL working solution: BL was first dissolved in anhydrous ethanol to prepare a stock solution, and then the working solution was prepared with 0.1% Triton X-100. 0.1% Triton X-100 was added to an equal volume of anhydrous ethanol as the control group (CK).

[0021] 3. BL spraying on rice: 2-3 leaf size Nipponbare rice plants were sprayed with 1 μM BL and 0.1% Triton X-100 (CK) using a spray bottle, for one treatment.

[0022] 4. The spraying capacity should be enough to soak the entire leaf, that is, until water starts to drip from the leaf.

[0023] Example 2: Fluorescence quantitative PCR detection of the expression level of the sakura synthase gene OsNOMT

[0024] After BL and CK treatment for 0, 1, 2, 4, 6, 9, 12, and 24 hours, RNA was extracted from aerial leaves using the Trizol method. cDNA was obtained by reverse transcription using the HiScript 1st Strand cDNA Synthesis Kit (1 μg of total RNA was added to 20 μl of reverse transcription system). A 10 μL reaction system was prepared using the following ingredients:

[0025]

[0026] The amplification program was as follows: 94°C for 5 min; 94°C for 10 s, 60°C for 20 s, 72°C for 20 s, 40 cycles; fluorescence was collected at 72°C, with OsUBQ5 as the internal reference.

[0027] Depend on Figure 1It can be seen that 2 hours after BL treatment of rice, the expression of the sakurain synthase gene OsNOMT was significantly upregulated, which lasted until 24 hours and reached its peak at 12 hours, indicating that OsNOMT plays an important role in the BL-induced sakurain synthesis process.

[0028] The primer sequences used for the quantitative detection of OsNOMT gene expression are as follows:

[0029] RT-OsNOMT-F: CTAGCCGGATGCATGAAAGT, as shown in SEQ ID No. 1;

[0030] RT-OsNOMT-R: TGCACGTATAGGCACACACA, as shown in SEQ ID No. 2;

[0031] RT-OsUBQ5-F: ACCACTTCGACCGCCACTACT, as shown in SEQ ID No. 3;

[0032] RT-OsUBQ5-R: ACGCCTAAGCCTGCTGGTT, as shown in SEQ ID No. 4;

[0033] Example 3: Detection of sakurain content

[0034] 1. Prepare sakura extract: ethanol: water: acetonitrile: acetic acid = 79:13.99:7:0.01 (volume ratio).

[0035] 2. Sakurain Extraction: Accurately weigh powdered rice aerial parts (stems and leaves) treated with BL for 48 hours, add 2 ml of the extract, shake vigorously, and incubate at 4°C with rotation (20 rpm) for 24 hours. Centrifuge at 16,000 g for 15 minutes at 4°C, collect the supernatant into a new centrifuge tube, and centrifuge again at 16,000 g for 15 minutes at 4°C, collect the supernatant. Detect sakurain using LC-MS / MS.

[0036] 3. Preparation of standard: Weigh 28.63 mg of sakurain standard and dissolve it in 1 ml of sakurain extract to prepare a 10 mg / ml stock solution. Dilute it in a gradient to prepare 100, 25, 6.25, 1.56, 0.39, 0.09 ng / ml gradient to make a calibration curve to calculate the sakurain concentration of the sample. Figure 2 As shown in Figure 3, the signal intensity of the BL treatment group was significantly higher than that of the CK control. The annotated curve for calculating the concentration of sakurain was y=6981.15279x+49.09438(r 2 =0.99980).

[0037] 4. Chromatography mass spectrometry acquisition conditions:

[0038] Using SCIEX ultra-high performance liquid chromatography triple quadrupole tandem mass spectrometer Triple Quad TM LC-MS / MS 5500+ system was used for acquisition, including Ultra Performance Liquid Chromatography UPLC, ExionLC TM AD) and triple quadrupole tandem mass spectrometry (Triple Quad TM LC-MS / MS 5500+).

[0039] Chromatographic column: ZORBAX Eclipse Plus C18 column (1.8 μm, 3.0 mm*100 mm; mobile phase A: ultrapure water (added with 0.01% formic acid, 2 mM ammonium formate); mobile phase B: methanol (added with 0.01% formic acid, 2 mM ammonium formate). Flow rate: 0.4 mL / min, column temperature: 40°C, injection volume: 1 μL. A 15 min gradient elution method was used, and the elution gradient settings are detailed in the table below:

[0040] Table: Liquid phase elution gradient

[0041] time Mobile phase composition (v / v) 0~1.0min 25％B 1.0~11.0min 25％B 11.0~13.0min 95％B 13.0~13.1min 95％B 13.1~15min 25％B

[0042] Mass spectrometry conditions: Data were acquired using Analyst 1.7.1 software. The ion source was electrospray ionization (ESI), and the detection method was multiple reaction monitoring (MRM). The spray voltage (IS) was -4500 V in negative ion mode. The ion source temperature (TEM) was 500°C. The nebulizer gas (Ion Source Gas 1, Gas 1) pressure was 50 psi; the auxiliary gas (Ion Source Gas 2, Gas 2) pressure was 55 psi; and the curtain gas (CUR) pressure was 35 psi. The collision gas (CAD) was 8. Ion pairs were scanned and detected based on the optimized declustering potential (DP) and collision energy (CE).

[0043] like Figure 3 After 48 hours of treatment with 1 μM BL, the content of sakurain in rice leaves was 28.5 times that of the control group, indicating significant induction. These results indicate that BL treatment induces the synthesis of sakurain.

[0044] The above embodiments are not limitations of the present invention, and the present invention is not limited to the above embodiments. As long as the requirements of the present invention are met, they belong to the protection scope of the present invention.

Claims

1. Application of brassinolide in increasing the content of sakurain in rice, characterized in that: The specific application is to spray brassinolide on rice leaves, with the brassinolide spraying cycle being once every 2 days; wherein the concentration of the brassinolide is 1 μM.

2. The application according to claim 1, characterized in that Brassinolide induces sakurain synthase OsNOMT expression, thereby increasing the content of sakurain.

3. A method for increasing the content of sakurain in rice, characterized in that: The method increases the sakurain content in rice leaves by exogenously spraying brassinolide. Specifically, brassinolide is sprayed on the rice leaves, and the brassinolide spraying cycle is once every two days; wherein the concentration of the brassinolide is 1 μM.

4. The method according to claim 3, characterized in that The rice is at the 2-3 leaf stage.

5. The method according to claim 3 or 4, characterized in that The brassinolide spray volume was such that the entire leaf was wet.

Images