A gene encoding DELLA5 protein and its application in determining mango dwarf varieties

Abstract

The present invention belongs to the field of genetic engineering technology, and specifically relates to a gene encoding a DELLA5 protein and its application in determining a mango dwarf variety. A gene encoding a DELLA5 protein, the nucleotide sequence of the gene is shown in SEQ ID No. 1. The gene encoding the DELLA5 protein of the present invention can provide support for early prediction of whether a test material has a dwarfing characteristic.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to a gene encoding a DELLA5 protein and an application thereof in determining a dwarf mango variety. Background Art

[0002] Dwarfing cultivation is an unchanging development trend of large-scale intensive production of perennial woody fruit trees. Plant dwarfing is mainly divided into hereditary dwarfing and physiological dwarfing. Single gene mutation belongs to hereditary dwarfing, and its dwarfing mechanism is mostly gene synthesis protein, protein affects hormone, and hormone affects phenotype; affected by environmental factors, the plant phenotype changes, which belongs to physiological dwarfing, and its dwarfing mechanism is mostly environmental changes affecting plant hormone secretion, which ultimately leads to changes. However, no matter which dwarfing mode, the phenotype must be affected by hormones, and the hormones in the plant growth process are mostly related to gibberellins (GAs).

[0003] GAs is a central regulator in the process of plant growth, and it realizes its function by degrading DELLA proteins. When GAs are absent, DELLA proteins can bind to related transcription factors that regulate plant growth and development, inhibit downstream gene expression, and thus inhibit plant growth; when GAs are present, DELLA proteins are degraded, and their inhibitory effects are released, promoting downstream gene expression and normal plant growth. DELLA proteins play an important role in the GAs signal transduction pathway. In the 1950s, beneficial mutations of DELLA proteins were used in wheat to achieve semi-dwarf breeding, increase grain production, and solve the problem of food and clothing. Now, in a variety of crops and cash crops, the expression level of DELLA proteins can be regulated through transgenic technology to dwarf plants and reduce management costs.

[0004] By comparing the expression levels of the DELLA5 gene in plant materials with tree-like characteristics and dwarfing characteristics, it is possible to predict whether a plant has dwarfing characteristics, which saves both time and effort. Currently, there are no reports on using the DELLA5 gene to predict whether a mango variety has dwarfing characteristics. Summary of the invention

[0005] The present invention provides a gene encoding a DELLA5 protein and application of the gene in determining a mango dwarf variety, which can predict whether a mango variety has a dwarf characteristic, saving time and labor.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] The first object of the present invention is to provide a gene encoding DELLA5 protein, the nucleotide sequence of the gene is shown in SEQ ID No.1.

[0008] More specifically, the open reading frame of the gene is 1590 bp.

[0009] The second object of the present invention is to provide an application of the gene encoding the DELLA5 protein, wherein the gene encoding the DELLA5 protein is used to predict whether a mango variety has a dwarfing characteristic.

[0010] The third object of the present invention is to provide a DELLA5 protein, wherein the DELLA5 protein is encoded by the gene.

[0011] More specifically, the amino acid sequence of the DELLA5 protein is shown in SEQ ID No.2.

[0012] More specifically, the DELLA5 protein consists of 529 amino acids, has a molecular weight of 58.07 KD, and a theoretical isoelectric point of 5.42.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] (1) The present invention obtains the DELLA5 protein gene sequence from the test material, and by analyzing the physicochemical activity of the gene, the gene can be used as an indicator for regulating the dwarfing trait.

[0015] (2) The present invention relates to the cloning of the DELLA5 protein gene and the analysis of its corresponding amino acid sequence. The semi-fluorescence quantitative method is used to determine the expression level of the DELLA5 protein gene, which can provide support for early prediction of whether the test material has dwarfing traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the result of PCR amplification of the middle fragment of DELLA5 gene;

[0017] Figure 2 This is the result of PCR amplification of the 3' end of the DELLA5 gene;

[0018] Figure 3 This is the result of PCR amplification of the 5' end of the DELLA5 gene;

[0019] Figure 4 This is a schematic diagram of the homology comparison between mango DELLA5 and other plant DELLA5;

[0020] Figure 5 This is the amino acid composition diagram of mango DELLA5 protein;

[0021] Figure 6 This is the signal peptide and transmembrane domain analysis diagram of mango DELLA5 protein;

[0022] Figure 7This is the predicted secondary structure of mango DELLA5 protein;

[0023] Figure 8 This is the predicted tertiary structure of mango DELLA5 protein;

[0024] Fig. 9 This is the prediction diagram of the hydrophilicity and hydrophobicity of mango DELLA5 protein;

[0025] Fig.10 This is the phylogenetic tree of mango DELLA5 protein;

[0026] Fig.11 This is a graph showing the expression levels of the DELLA5 gene in Jinhuang Mang and Guiqi Mang at different phenological stages. DETAILED DESCRIPTION

[0027] The following is a clear and complete description of the technical solution of the patent of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by technicians in this field without creative work are within the scope of protection of the present invention.

[0028] In Example 1, the main instruments and reagents are: PCR instrument: Takara; electrophoresis instrument: Bio-Rad; 2000 spectrophotometer: Thermo; Constant temperature shaker; Ultra-fidelity DNA polymerase: NEB; First Choice RLM-RACE Kit: Thermo; 2×Taq Master Mix (Dye Plus): Vazyme.

[0029] In Example 2, the main instruments and reagents are: ABI 7900-Fast Real-Time PCR Detection System: ABI; 2000 spectrophotometer: Thermo; general PCR instrument: Takara; All-in-One TM First-Strand cDNA Synthesis Kit: GeneCopoeia (Cat.No.AORT-0050); All-in-One TM qPCR Mix: GeneCopoeia (Cat.No.AOPR-0200); Epcentre TM RNase R.

[0030] Example 1 :Cloning and sequence analysis of DELLA5 gene from mango

[0031] 1. RNA extraction and purification

[0032] 1. Total RNA extraction (Trizol method)

[0033] (1) Sample treatment: 80-100 mg of mango leaves were placed in a frozen mortar and ground into powder with liquid nitrogen. The powder was transferred to a 2.0 mL centrifuge tube containing 1 mL of Trizol, shaken to mix, and then allowed to stand at room temperature for about 5 min.

[0034] (2) Aqueous phase separation: Add 0.2 mL of chloroform to every 1 mL of Trizol, shake and mix for 15 seconds, then let stand at room temperature for about 3 minutes, and centrifuge at 4°C, 12,000 rpm for 15 minutes.

[0035] (3) Precipitation: Transfer the aqueous phase to a new 2.0 mL centrifuge tube, add 0.5 mL of isopropanol per 1 mL of Trizol, mix well, let stand at room temperature for 20 min, and centrifuge at 4°C, 12,000 rpm for 10 min.

[0036] (4) Washing: discard the supernatant, add 1.5 mL of 80% (mass fraction) ethanol, mix well, and centrifuge at 4°C, 8000 rpm for 5 min.

[0037] (5) Dissolution: Discard the supernatant and air-dry the RNA precipitate for about 5 minutes (be careful not to dry it completely, just make sure the precipitate turns white). Add DEPC-treated water to dissolve the RNA precipitate.

[0038] 2. Purification of Extracted RNA

[0039] (1) Prepare the following reaction solution in a microcentrifuge tube, 50ul system:

[0040]

[0041] (2) After reacting at 37°C for 30 min, the Recombinant DNase I was inactivated.

[0042] (3) Add 10ul 3M sodium acetate and 250ul cold ethanol and let stand at -80℃ for 20min.

[0043] (4) Centrifuge at 12,000 rpm for 10 min at 4°C and discard the supernatant.

[0044] (5) Add 80% (mass fraction) cold ethanol to wash, centrifuge at 12000 rpm at 4°C for 5 min, discard the supernatant, and dry the precipitate.

[0045] 2. Cloning the intermediate fragment of the target gene

[0046] 2.1 Based on the cDNA sequences of the plant DELLA5 gene published in GenBank, after alignment using DNAMAN software, a pair of degenerate primers were designed based on the conserved region.

[0047] DELLA5-F:GGAGCCACCGACTCCAACC

[0048] DELLA5-R:GTAAATCTCAGCGACAGCC

[0049] 2.2 Reverse transcription intermediate fragment

[0050] (1) Thaw the reagents of the First-Strand cDNA Synthesis Kit, gently invert upside down to mix, centrifuge briefly, and place on ice until use.

[0051] (2) Prepare RNA-Primer Mix on ice by adding the following reagents to a pre-cooled RNase-free reaction tube to a total volume of 13 μL;

[0052]

[0053] (3) Mix the RNA-Primer Mix, centrifuge briefly, denature at 65°C for 10 min, and immediately place on ice;

[0054] (4) Add the following reagents to the RNA-Primer Mix reaction tube to a total volume of 25 μL;

[0055]

[0056] (5) Mix the reaction mixture, centrifuge briefly, and incubate at 37°C for 1 h;

[0057] (6) After the reaction is completed, inactivate the product at 85°C for 5 min and store it at -20°C until use.

[0058] 2.3 Intermediate fragment analysis and separation

[0059] Intermediate fragment PCR reaction system:

[0060]

[0061] The PCR reaction program was: 95°C for 5 min; 95°C for 55 s, 58°C for 55 s, 72°C for 2 min, 39 cycles; 72°C for 10 min; 4°C for 10 min. After the end, the PCR reaction product was analyzed by 1% agarose gel electrophoresis. The results are shown in Figure 1 , and perform gel excision to recover the target fragment.

[0062] from Figure 1As can be seen, the middle fragment of the DELLA5 gene cloned from mango leaves is about 800bp in size.

[0063] 2.4 Target fragment recovery

[0064] (1) Add 50 μL of the reaction system to the sample wells of 1% agarose gel and spot DNA Marker DM 2000 on one side of the sample.

[0065] (2) Constant voltage 120V, determine when to end the running time based on the position of the strip moving.

[0066] (3) Under ultraviolet light, cut and recover the target band according to the position of the marker, and purify the intermediate fragment of the target gene using a DNA agarose gel recovery kit.

[0067] (4) Quickly place the cut gel into a centrifuge tube and assess its volume based on the weight of the gel.

[0068] (5) Add the same volume of Binding Buffer to the gel and incubate in a 65°C water bath until the gel is completely melted.

[0069] (6) Pipette the melted solution into the HiBind DNA Mini column, then place the column into a centrifuge tube and centrifuge at 12,000 g for 1 min at room temperature. Discard the waste liquid and keep the column until all the melted solution has completed this step.

[0070] (7) Add 300 μL of XP2 to the column and centrifuge at 12,000 g for 1 min at room temperature. Discard the waste liquid and keep the column.

[0071] (8) Add 700 μL of SPW Wash buffer to the column, centrifuge at 12,000 g for 1 min at room temperature, and discard the waste liquid. Repeat this step once.

[0072] (9) Room temperature, 13000g, idling for 2 min, and removing residual waste liquid.

[0073] (10) Place the column in a new centrifuge tube and add 30 μL of Elution Buffer to the center of the membrane. Incubate at room temperature for 2 min and then centrifuge at 13,000 g for 2 min to elute the DNA.

[0074] 2.5T vector ligation and transformation

[0075] I. Connection

[0076] 4 μL of PCR product and 1 μL of PEASY-T1 cloning vector were gently mixed and reacted at room temperature for 5 min. After the reaction, the centrifuge tube was placed on ice.

[0077] II. Conversion

[0078] (1) Take out the competent E. coli DH5a cells from the -80°C refrigerator, place them in ice until they are completely dissolved, and mix gently.

[0079] (2) Pipette 50 μL of competent cells into a sterilized centrifuge tube, add 5 μL of recombinant plasmid into the tube, mix gently, and place on ice for 30 min.

[0080] (3) Place the centrifuge tube after ice bath in a 42°C water bath for 90 seconds, quickly move it into an ice box filled with ice for 2 minutes, add 600 μl of LB culture medium, and place it on a 37°C constant temperature shaker for culturing at 220 rpm for 1 hour.

[0081] (4) Apply 50 μl of culture medium to the solid LB medium containing Amp, wait for it to dry, and then place it in an incubator at 37°C for inversion. After 12-16 hours, check whether there are colonies in the culture dish.

[0082] (5) Pick a single clone and streak it for culture, and perform colony PCR amplification detection using upstream and downstream primers of the gene.

[0083] (6) Pick the positive single clone, shake the bacteria and sequence it.

[0084] 3. Cloning the 3' end of the target gene

[0085] 3.1 Design a pair of 3'RACE primers based on the obtained intermediate fragment of the target gene.

[0086] DELLA5 3'GSP-1:GGCCGATCTGGCCAATTTAGG

[0087] DELLA5 3'GSP-2:AAACCCTTAAAACCCTTGGCT

[0088] 3.2 Obtaining 3' cDNA

[0089] (1) Add the following ingredients to an RNase-free centrifuge tube and operate on ice:

[0090]

[0091] (2) Mix gently, incubate at 42°C for 1 h, and store at -20°C.

[0092] 3.3 Outer 3' PCR reaction system

[0093]

[0094] The PCR reaction program was: 95°C for 5 min; 95°C for 50 s, 60°C for 50 s, 72°C for 2 min, 35 cycles; 72°C for 10 min; 4°C for 10 min.

[0095] 3.4Inner 3'PCR reaction system

[0096]

[0097]

[0098] The PCR reaction program was: 95°C for 5 min; 95°C for 50 s, 60°C for 50 s, 72°C for 2 min, 35 cycles; 72°C for 10 min; 4°C for 10 min. After the end, the PCR reaction product was analyzed by 1% agarose gel electrophoresis. The results are shown in Figure 2 The target fragment was recovered by gel excision and ligated to the PEASY-T1 cloning vector to transform competent cells, and the positive colonies were identified and sequenced.

[0099] from Figure 2 It can be seen that, based on the sequence information of the middle fragment of the DELLA5 gene, specific primers DELLA5 3'GSP-1 and DELLA5 3'GSP-2 were designed and PCR amplified with respective universal primers to obtain a DNA fragment of about 400 bp.

[0100] IV. Cloning the 5' end of the target gene

[0101] 4.1. Design a pair of 5'RACE primers based on the obtained middle fragment of the target gene.

[0102] DELLA5 5'GSP-1:CGAAGTAAAGGTTAACTGCC;

[0103] DELLA5 5'GSP-2:CGTTCCGGTTAAGGCTTAAC.

[0104] 4.2 Outer 5' PCR reaction system

[0105]

[0106] The PCR reaction program was: 95°C for 5 min; 95°C for 50 s, 60°C for 50 s, 72°C for 2 min, 35 cycles; 72°C for 10 min; 4°C for 10 min;

[0107] 4.3Inner 5' PCR reaction system

[0108]

[0109] The PCR reaction program was: 95°C for 5 min; 95°C for 50 s, 60°C for 50 s, 72°C for 2 min, 35 cycles; 72°C for 10 min; 4°C for 10 min. After the end, the PCR reaction product was analyzed by 1% agarose gel electrophoresis. The results are shown in Figure 3 The target fragment was recovered by gel excision and ligated to the PEASY-T1 cloning vector to transform competent cells, and the positive colonies were identified and sequenced.

[0110] from Figure 3 It can be seen that, based on the sequence information of the middle fragment of the DELLA5 gene, specific primers DELLA5 5'GSP-1 and DELLA5 5'GSP-2 were designed and PCR amplified with respective universal primers to obtain a DNA fragment of about 400 bp.

[0111] 5. Gene sequence assembly and analysis

[0112] 5.1 DNAMAN was used to splice the 5' end, 3' end and middle fragments to obtain the full-length sequence of the DELLA5 gene, see SEQ ID No.1, and translated it into a protein sequence, see SEQ ID No.2; the DELLA protein sequences of plants such as ryegrass, cotton, and Amomum villosum registered on NCBI were compared, and the results were shown in Figure 4 .

[0113] Depend on Figure 4 It can be seen that the obtained gene is the mango DELLA5 gene.

[0114] 5.2 Analysis of physicochemical properties of amino acid sequences

[0115] 5.2.1 Using protparam analysis, the open reading frame of DELLA5 gene is 1590bp. DELLA5 gene encodes 529 amino acids, with a molecular weight of 58.07KD and a theoretical isoelectric point of 5.42.

[0116] The amino acid composition of DELLA5 protein is shown in Figure 5 .

[0117] Depend on Figure 5 It can be seen that the amino acid composition of DELLA5 protein is mainly composed of leucine, alanine, valine, serine and glycine, including 58 acidic amino acids (Asp+Glu) and 43 basic amino acids (Arg+Lys).

[0118] 5.2.2 Online analysis using Phobius (http: / / phobius.sbc.su.se / ), analysis results are shown in Figure 6 .

[0119] Depend on Figure 6 It can be seen that DELLA5 protein is a cytoplasmic protein, and the proteins encoded by DELLA5 do not have a signal peptide. The prediction results of the transmembrane domain of the DELLA5 protein sequence show that the transmembrane region of DELLA5 is not obvious.

[0120] 5.2.3 Prediction of the secondary structure of DELLA5 protein using DNAMAN. The prediction results are shown in Figure 7 .

[0121] Depend on Figure 7 It can be seen that in the DELLA5-encoded protein, the helical structure accounts for 31.38%, the folding accounts for 14.93%, and the random curling accounts for 53.69%.

[0122] 5.2.4 Prediction of the tertiary structure of DELLA5 protein. The prediction results are shown in Figure 8 .

[0123] Depend on Figure 8 It can be seen that the DELLA5 protein is composed of several different α-helices, β-turns and random coils to form the protein peptide chain, and the prediction results are highly consistent with the secondary structure analysis results.

[0124] 5.2.4 Using DNAMAN to predict the hydrophilicity and hydrophobicity of DELLA5, the prediction results are shown in Fig. 9 .

[0125] Depend on Fig. 9 It can be seen that the glutamine at position 523 of the DELLA5 polypeptide chain has the lowest value of -3.14 and is the most hydrophilic, while the methionine at position 529 has the highest value of 3.63 and is the most hydrophobic.

[0126] 5.2.5 In order to study the evolution of Mango DELLA5 protein, a phylogenetic tree of DELLA5 protein amino acid sequence was constructed, such as Fig.10 shown.

[0127] Depend on Fig.10 It can be seen that mango DELLA5 is closely related to pistachio (XP_031269898.1) and pistachio (XP_031282020.1); followed by sweet orange (KAH9761993.1), clementine (XP_006451026.1), sweet orange (XP_006475770.1), Xanthoceras sorbifolia (KAH7572344.1), Acer sorbifolia (KAI9192499.1), Acer truncatum (TXG61330.1), Ulmus pumila (KAE7998809.1), and Bayberry (KAB1209005.1).

[0128] Example 2 : Gene relative quantity PCR detection

[0129] Beacon Designer was used to design primers to explore the expression of DELLA5 gene in different stages of "Jinhuang Mango" (tree-like characteristics) and "Guiqi Mango" (dwarfing characteristics).

[0130] The primers actin-F and actin-R were designed with the mango actin internal reference gene. The specific primers DELLA5-YGF and DELLA5-YGR were designed according to the cloned DELLA5 sequence. The cDNA was obtained in the same way as in Example 1.

[0131] The steps of PCR quantitative reaction are as follows:

[0132] (1) All-in-One TM Thaw the qPCR Mix at room temperature, mix by gentle inversion and centrifuge briefly.

[0133] (2) Prepare PCR Reaction Mix on ice, including 2×All-in One TM qPCR Mix 10μL, qPCR Primer (1μmol / L) 2μL, cDNA Template 2μL, add ddH2O to make the final volume 20μL. NTC (no template control) was designed as a negative control in the experiment, that is, water was used instead of template cDNA, and other reagents remained unchanged to ensure that the system was free of contamination.

[0134] (3) Briefly centrifuge the reaction tube to ensure that all the reaction solution is at the bottom of the reaction tube.

[0135] The PCR reaction program was 95°C for 10 min; 95°C for 15 s, 60°C for 30 s, 72°C for 20 s, 39 cycles; 72°C for 10 min. After the PCR reaction, a melting curve analysis was performed, that is, the temperature was controlled at 72-95°C, increased by 0.5°C every 10 s, and finally maintained at 25°C for 30 s. The experiment was repeated 3 times.

[0136] Using 7300System software and 2 -ΔΔCt The data were analyzed by the method and the results are shown in Fig.11 .

[0137] Depend on Fig.11 It can be seen that in the five phenological periods, the expression level of the DELLA5 gene in the test materials with dwarfing characteristics was much higher than that in the germplasm with tree-like characteristics, indicating that the DELLA5 gene has the function of regulating the dwarfing phenotype of plants.

[0138] In summary, the present invention can provide support for early prediction of whether the test material has dwarfing traits by determining the expression level of DELLA5 gene through semi-fluorescence quantitative analysis.

Claims

1. An application of a gene encoding DELLA5 protein in early prediction of whether a cassia bark has dwarfing characteristics, characterized in that: The nucleotide sequence encoding the DELLA5 protein gene is shown in SEQ ID No.1.

Images