A method for constructing a Macrosialin gene-deficient atherosclerosis mouse model and its application

Abstract

The present invention belongs to the technical field of animal model construction, and in particular relates to a method for constructing a Macrosialin gene-deficient atherosclerosis mouse model and its application. The construction method comprises: ‑ / ‑ Macrosialin knockout in genotyped mice, ApoE ‑ / + Macrosialin ‑ / + F0 mice of different genotypes; F0 mice were crossed with ApoE ‑ / ‑ Genotype mice were backcrossed and screened to obtain ApoE ‑ / ‑ Macrosialin ‑ / + Genotype of F1 mice; F1 mice were self-fertilized and ApoE was obtained by screening ‑ / ‑ Macrosialin ‑ / ‑ The F2 generation mice of the same genotype were induced with a high-fat diet to obtain an atherosclerosis mouse model. The present invention selects the Macrosialin gene as a target, uses the CRISPR / Cas9 system to knock out the gene, and screens to obtain homozygous individuals with both Macrosialin and ApoE biallelic genes knocked out, i.e., an atherosclerosis mouse model, which can breed and lactate normally and can be stably inherited, providing an economical, stable, convenient, and efficient mouse model for studying the role of the Macrosialin gene in the occurrence and development of AS and the diagnosis and treatment of AS.

Description

Technical Field

[0001] The present invention relates to the technical field of animal model construction, and in particular to a method for constructing a Macrosialin gene-deficient atherosclerosis mouse model and application thereof. Background Art

[0002] Atherosclerosis (AS) is a focal chronic inflammatory vascular disease caused by multiple factors such as genetics and the environment. It is characterized by lipid deposition and intimal thickening, forming atherosclerotic plaque lesions or fibrolipid plaques. It is the main cause of cardiovascular disease, stroke and peripheral arterial disease. Atherosclerosis is characterized by the formation of atherosclerotic plaques, and the pathological basis of atherosclerotic plaque formation is the formation of foam cells. Most foam cells are derived from macrophages that gather under the intima of the artery, and a small part is transformed from smooth muscle cells and endothelial cells. Monocytes in the blood circulation migrate to the subintimal layer of the artery and differentiate into macrophages. Oxidized low-density lipoprotein (ox-LDL) in the subintimal layer of the blood vessels is recognized by scavenger receptors on the surface of macrophages and phagocytosed in large quantities, resulting in lipid accumulation in macrophages and transformation of macrophages into lipid-rich foam cells. The effects of foam cells and ox-LDL on atherosclerotic plaques are mainly reflected in the following two aspects: on the one hand, foam cells produce reactive oxygen species (ROS) and induce a series of inflammatory reactions, recruiting more macrophages into the subintimal layer of the blood vessels and transforming into foam cells, resulting in the appearance of fatty streaks on the vascular wall and accelerating the process of atherosclerosis; on the other hand, ox-LDL further induces foam cell necrosis, and the necrotic core formed is a typical feature of late-stage plaque instability. Plaque rupture will follow the blood flow to block the cardiovascular and cerebrovascular vessels, which is the direct cause of cerebral infarction and myocardial infarction. Therefore, reducing macrophage phagocytosis of lipids, slowing down inflammatory reactions and preventing plaque rupture are of great significance in preventing and treating atherosclerotic cardiovascular diseases.

[0003] Macrosialin is a scavenger receptor that can bind to modified LDL, phosphatidylserine, and apoptotic cells. The high specificity and abundance of the macrosialin gene on the surface of mononuclear macrophages make it possible for macrosialin to bind and internalize ox-LDL. Currently, the role of macrosialin in foam cell formation and the development of atherosclerosis is still unclear.

[0004] Experimental animal models play an important role in scientific experiments and drug development. Mice and genetically engineered mouse resources are one of the most important animal models in the fields of disease mechanism research, gene function research, and drug creation, and are also a necessary condition for innovative research in these fields. Using genetically engineered mice to study the various molecular links in the pathological process of atherosclerosis is of great significance for clarifying the molecular mechanism of the occurrence and development of atherosclerosis, finding molecular targets for the treatment of atherosclerosis, and the treatment of related diseases. Summary of the invention

[0005] In view of the problems existing in the prior art, the present invention provides a method for constructing a Macrosialin gene-deficient atherosclerosis mouse model, by successfully knocking out the Macrosialin gene in mice to explore the relationship between the expression of the gene and the occurrence and development of atherosclerosis, thereby providing an economical, convenient and reliable animal model for studying the role of Macrosialin in the occurrence and development of atherosclerosis and the screening of atherosclerosis drugs, and further provides the use of the Macrosialin gene as a drug target in screening drugs for treating atherosclerosis and the use of Macrosialin inhibitors in preparing drugs for treating atherosclerosis.

[0006] The first aspect of the present invention provides a method for constructing a Macrosialin gene-deficient atherosclerosis mouse model, comprising the following steps:

[0007] S1. ApoE - / - Macrosialin knockout in genotyped mice, ApoE - / + Macrosialin - / + Genotype of F0 generation mice;

[0008] S2. The F0 generation mice were cultured with ApoE - / - Genotype mice were backcrossed and screened to obtain ApoE - / - Macrosialin - / + Genotype of F1 mice;

[0009] S3, self-fertilizing the F1 generation mice and screening for ApoE - / - Macrosialin - / - The F2 mice of the same genotype were induced with a high-fat diet to obtain an atherosclerosis (AS) mouse model;

[0010] Wherein, in step S1, obtaining the F0 generation mice specifically comprises the following steps:

[0011] S11, designing the exon 2 region of the Macrosialin gene as a knockout region, and designing and synthesizing three sgRNAs targeting the upper, middle and downstream of the exon 2 region respectively;

[0012] S12, injecting Cas9 mRNA and the three sgRNAs into fertilized oocytes, screening the surviving fertilized oocytes and transplanting them into pseudo-pregnant female mice for gestation, and screening ApoE from the born mice - / + Macrosialin - / + The F0 generation mouse of the genotype; wherein the fertilized egg is composed of ApoE - / - Genotypes of mouse sperm and C57BL / 6 mouse oocytes formed by in vitro fertilization.

[0013] Furthermore, in step S11, the three sgRNAs target 95-117bp, 157-179bp and 271-293bp of exon 2, respectively.

[0014] Furthermore, in step S11, the DNA sequences targeted by the three sgRNAs are respectively shown as SEQ ID NO.1-3.

[0015] Further, in step S11, the sgRNA is synthesized by in vitro transcription technology, comprising the following steps: designing primers IVT-1, IVT-2, IVT-3 and IVT-4 for amplifying the sgRNA, using the pX330 plasmid as a template, pairing primers IVT-1, IVT-2 and IVT-3 with primer IVT-4, respectively, amplifying the corresponding DNA products by PCR reaction, using the DNA products as templates, respectively, and obtaining the sgRNA by in vitro transcription and purification; wherein the DNA sequences of the primers used to amplify the sgRNA are shown in SEQ ID NO.4-7.

[0016] Furthermore, in step S12, the Cas9 mRNA is synthesized by in vitro transcription technology, including the following steps: using the linearized pST1374-Cas9 plasmid as a template, in vitro transcription and purification to obtain the Cas9 mRNA.

[0017] Further, in step S12, each of the sgRNA and the Cas9 mRNA is injected into the fertilized egg cell in equal proportions.

[0018] In addition, the second aspect of the present invention provides a method for constructing a Macrosialin gene-deficient atherosclerosis mouse model as described above, and the use of the constructed atherosclerosis mouse model in studying the effects and mechanisms related to the Macrosialin gene and atherosclerosis disease, as well as in studying the occurrence and development of atherosclerosis and screening of atherosclerosis drugs.

[0019] In addition, the third aspect of the present invention provides the use of Macrosialin gene as a drug target in screening drugs for treating atherosclerotic diseases.

[0020] In addition, the fourth aspect of the present invention provides the use of Macrosialin inhibitors in the preparation of drugs for treating atherosclerotic diseases.

[0021] The advantages and positive effects of the present invention are:

[0022] 1. The present invention selects the Macrosialin gene as the target, designs three specific targeting sites in the upstream, midstream and downstream of exon 2 of the mouse Macrosialin gene to ensure the large fragment deletion of the mouse Macrosialin gene, and then uses the CRISPR / Cas9 system to knock out ApoE - / - Macrosialin gene of mice was expressed, and heterozygous mice with double knockout of Macrosialin gene and ApoE gene were obtained in F0 generation, and then crossed with ApoE - / - The mice were backcrossed and the offspring were self-pollinated to obtain homozygous individuals with Macrosialin biallelic knockout and ApoE biallelic knockout. Under the induction of a high-fat diet, an atherosclerosis mouse model was obtained. The mice could reproduce and lactate normally, and there were no significant differences in serum lipid biochemical indicators. Stable inheritance was obtained, providing an economical, stable, convenient and efficient mouse model for studying the role of the Macrosialin gene in the occurrence and development of atherosclerosis and the diagnosis and treatment of atherosclerosis.

[0023] 2. The present invention found that the Macrosialin gene is closely related to atherosclerosis and can promote or worsen the occurrence and development of AS. Based on this characteristic and function, the Macrosialin gene can be used as a drug target to screen drugs for treating atherosclerotic diseases, and Macrosialin inhibitors can be used to prepare drugs for treating atherosclerotic diseases. This provides a theoretical basis and clinical foundation for studying new targets and new strategies for preventing and treating AS, and has certain originality, practicality and inspiration for basic research on AS. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0025] Figure 1 This is a schematic diagram of the design of sgRNA targeting Macrosialin gene in an embodiment of the present invention;

[0026] Figure 2 ApoE in the embodiment of the present invention - / + Macrosialin - / + Schematic diagram of fluorescent PCR genotype detection of genotype F0 generation mice;

[0027] Figure 3 ApoE in the embodiment of the present invention - / + Macrosialin - / + Sanger sequencing map of genotype F0 generation mice;

[0028] Figure 4 ApoE high-fat diet according to the present invention - / - Macrosialin - / - Genotype of mice and control ApoE - / - Body weight analysis of mice of different genotypes during 12 weeks;

[0029] Figure 5 ApoE high-fat diet according to the present invention - / - Macrosialin - / - Genotype of mice and control ApoE - / - Four test charts of serum biochemical and blood lipids of genotype mice after 12 weeks;

[0030] Figure 6 ApoE high-fat diet according to the present invention - / - Macrosialin - / - Genotype of mice and control ApoE - / - Oil red O staining analysis of aortic root of genotype mice after 12 weeks;

[0031] Figure 7 ApoE high-fat diet according to the present invention - / - Macrosialin - / - Genotype of mice and control ApoE - / - Oil red O staining analysis of whole aorta of genotype mice after 12 or 18 weeks. DETAILED DESCRIPTION

[0032] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with the examples. The equipment and reagents used in each embodiment and test example can be obtained from commercial sources unless otherwise specified. The specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0033] Based on the information contained in this application, it is easy for those skilled in the art to make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined process, properties or components, because these embodiments and other descriptions are only for illustrating specific aspects of the present invention. In fact, various changes that the technicians in this field or related fields can obviously make to the embodiments of the present invention are all covered within the scope of the appended claims.

[0034] In order to better understand the present invention but not to limit the scope of the present invention, all the numbers used in this application to express the amount, percentage, and other numerical values ​​should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties attempted to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant figures and by conventional rounding methods.

[0035] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0036] The embodiment of the present invention provides a method for constructing a Macrosialin gene-deficient atherosclerosis mouse model, comprising the following steps:

[0037] S1. ApoE - / - Macrosialin knockout in genotyped mice, ApoE - / + Macrosialin - / + Genotype of F0 generation mice;

[0038] S2. The F0 generation mice were cultured with ApoE - / - Genotype mice were backcrossed and screened to obtain ApoE - / - Macrosialin - / + Genotype of F1 mice;

[0039] S3, self-fertilizing the F1 generation mice and screening for ApoE - / - Macrosialin - / -The F2 mice of the same genotype were induced with a high-fat diet to obtain an atherosclerosis (AS) mouse model;

[0040] Wherein, in step S1, obtaining the F0 generation mice specifically comprises the following steps:

[0041] S11. According to the Macrosialin gene structure, the exon 2 region of the Macrosialin gene was designed as a knockout region, and three sgRNAs targeting the upper, middle and downstream of the exon 2 region were designed and synthesized respectively;

[0042] S12, injecting Cas9 mRNA and the three sgRNAs into fertilized oocytes, screening the surviving fertilized oocytes and transplanting them into pseudo-pregnant female mice for gestation, and screening ApoE from the born mice - / + Macrosialin - / + The F0 generation mouse of the genotype; wherein the fertilized egg is derived from ApoE - / - Genotypes Mouse sperm and C57BL / 6 mouse oocytes were fertilized in vitro.

[0043] In order to clarify the relationship between Macrosialin gene and atherosclerosis and study how Macrosialin affects the occurrence and development of atherosclerosis, the present invention specifically selected Macrosialin gene as the target and determined for the first time three specific targeting sites for mouse Macrosialin gene, which are located in the upstream, midstream and downstream of exon 2 of Macrosialin gene, respectively. These three targets have high shearing efficiency to ensure large fragment deletion of mouse Macrosialin gene, and then used CRISPR / Cas9 system to target ApoE - / - Macrosialin gene was knocked out in mice with a normal background to obtain heterozygous mice with both Macrosialin gene and ApoE gene knockout in the F0 generation. - / - The mice were backcrossed and the offspring were self-pollinated. Through genotype screening, homozygous individuals with Macrosialin biallelic knockout and ApoE biallelic knockout were obtained. Under the induction of a high-fat diet, an atherosclerosis mouse model was obtained. The mice could reproduce and lactate normally, and there was no significant difference in their immune system compared with wild-type mice, laying the foundation for studying their role in the occurrence and development of atherosclerotic diseases.

[0044] Further experimental data analysis confirmed that compared with the control group ApoE - / - Compared with the symptoms of atherosclerosis (AS) in mice, the constructed ApoE - / - Macrosialin - / -The AS symptoms of genotype mice were significantly improved, there was no significant difference in serum lipid biochemical indicators, and stable inheritance could be obtained, indicating that the Macrosialin-deficient atherosclerosis model mouse was successfully constructed, which has very important basic research and practical application value. And the aforementioned experimental data confirmed that Macrosialin gene knockout inhibited the occurrence of AS and slowed down the pathological degree of AS, indicating that the expression of Macrosialin gene can promote or worsen the occurrence and development of AS, and provide new ideas and theoretical basis for developing new schemes for AS treatment. Therefore, the construction method of the present invention can provide an economical, stable, convenient and efficient ApoE and Macrosialin double gene knockout homozygous mouse model for studying the role of Macrosialin gene in the occurrence and development of atherosclerotic diseases and the diagnosis and treatment of atherosclerosis. Moreover, the atherosclerosis mouse model obtained by the present invention is conducive to meeting the different needs of studying atherosclerosis, saving economic costs and time costs, and has very important potential application value.

[0045] It should be noted that ApoE - / - Genotype refers to the deletion of the gene sequences of both alleles of apolipoprotein E (ApoE), resulting in ApoE homozygous deletion mice; accordingly, ApoE - / + Genotype refers to the gene sequence of one ApoE allele being deleted, resulting in ApoE heterozygous mice. - / - Genotype and Macrosialin - / + Genotype has the same meaning as above and will not be described again here.

[0046] In addition, it should be noted that gene knockout refers to a technique of inactivating or deleting a specific gene in an organism by certain means. In the context of the present invention, knockout and deletion have the same meaning.

[0047] In order to better achieve specific knockout or deletion of the Macrosialin gene and ensure the efficiency of knockout, the above three sgRNAs target 95-117bp, 157-179bp and 271-293bp of exon 2 of the Macrosialin gene respectively.

[0048] Specifically, the DNA sequences targeted by the three sgRNAs are as follows:

[0049] Macrosialin-sgRNA1: 5'-TGGGCCTGTGGCTGGTCGTAGGG-3' (see SEQ ID NO. 1);

[0050] Macrosialin-sgRNA2: 5′-ATGAGTGACAGTTGTGGGTCCGG-3′ (see SEQ ID NO. 2);

[0051] Macrosialin-sgRNA3: 5′-AGGGTGAGGGCCAACAGTGGAGG-3′ (see SEQ ID NO. 3).

[0052] The present invention takes 95-117bp, 157-179bp and 271-293bp of exon 2 of the Macrosialin gene as targets, designs specific sgRNAs that specifically target these three sites, and the targets have high shearing efficiency, can improve the gene knockout efficiency, and can ensure the large fragment deletion of the mouse Macrosialin gene, ensuring that the Macrosialin gene completely loses its function, and is conducive to the detection and identification of the Macrosialin genotype of offspring mice.

[0053] Optionally, in step S11, the sgRNA is synthesized by in vitro transcription technology, specifically, the following steps: designing primers IVT-1, IVT-2, IVT-3 and IVT-4 for amplifying sgRNA, using pX330 plasmid as a template, pairing primers IVT-1, IVT-2 and IVT-3 with primer IVT-4 respectively, amplifying the corresponding DNA products by PCR reaction, using the aforementioned DNA products as templates, in vitro transcription and purification to obtain Macrosialin-sgRNA1, Macrosialin-sgRNA2 and Macrosialin-sgRNA3. The DNA sequences of the primers for amplifying sgRNA are as follows;

[0054] IVT-1:

[0055] 5'-TTCTAATACGACTCACTATAGGTGGGCCTGTGGCTGGTCGTAGGGGTTTTAGAGCTAGA-3' (see SEQ ID NO. 4);

[0056] IVT-2:

[0057] 5'-TTCTAATACGACTCACTATAGGATGAGTGACAGTTGTGGGTCCGGGTTTTTAGAGCTAGA-3' (see SEQ ID NO. 5);

[0058] IVT-3:

[0059] 5'-TTCTAATACGACTCACTATAGGAGGGGTGAGGGCCAACAGTGGAGGGTTTTAGAGCTAGA-3' (see SEQ ID NO. 6);

[0060] IVT-4:

[0061] 5'-AAAAAAGCACCGACTCGGTGCC-3' (see SEQ ID NO. 7).

[0062] Optionally, in step S12, the Cas9 mRNA is synthesized by in vitro transcription technology, including the following steps: using the linearized pST1374-Cas9 plasmid as a template, in vitro transcription and purification to obtain the Cas9 mRNA.

[0063] In order to improve the efficiency of gene knockout, in step S12, the Macrosialin-sgRNA1, the Macrosialin-sgRNA2, the Macrosialin-sgRNA3 and the Cas9 mRNA are injected into the fertilized egg cell in equal proportions, i.e., equal amounts. Generally speaking, the injection concentrations of the Macrosialin-sgRNA1, the Macrosialin-sgRNA2, the Macrosialin-sgRNA3 and the Cas9 mRNA are all 10-100 ng / μL, and the four with the same final concentration are mixed evenly, and then microinjection is performed to ensure that the four are present in equal proportions in the fertilized egg cell.

[0064] Based on the same inventive concept, another embodiment of the present invention provides the application of the atherosclerosis mouse model constructed by the construction method of the Macrosialin gene-deficient atherosclerosis mouse model as described above in studying the effects and mechanisms related to Macrosialin gene and atherosclerosis disease. Specifically, it is used in basic research on atherosclerosis, or in studying the application of Macrosialin in the occurrence, development and screening of atherosclerosis drugs. More specifically, the present invention has confirmed that systemic knockout of the Macrosialin gene can slow down the occurrence and development of atherosclerosis. Based on this model, it can be studied whether the Macrosialin gene affects the production of reactive oxygen species, the activation of inflammatory signaling pathways, cell apoptosis and other basic mechanism studies; in addition, for atherosclerosis drug screening, on the one hand, the expression of the gene is inhibited or the protein function is inhibited by Macrosialin inhibitors, such as the development of antibodies and interfering RNAs for Macrosialin; on the other hand, the specific mechanism of Macrosialin slowing down atherosclerosis is indirectly provided to provide the direction of treatment and drug development.

[0065] The application of the Macrosialin gene-deficient atherosclerosis mouse model and the method for constructing the Macrosialin gene-deficient atherosclerosis mouse model as described above have the same advantages over the prior art, which will not be described in detail here.

[0066] In addition, the present invention successfully deleted the Macrosialin gene in mice, and explored the relationship between the expression of the gene and the occurrence and development of AS disease through in-depth research on the above-mentioned Macrosialin gene-deficient atherosclerosis mouse model, and determined that the Macrosialin gene deletion has the effect of inhibiting the formation of AS plaques, which is mainly reflected in the significant reduction of atherosclerotic plaques and the significant alleviation of atherosclerosis. This suggests that the expression of the Macrosialin gene can promote the occurrence and development of AS, and provides a theoretical basis and clinical foundation for studying new targets and new strategies for the prevention and treatment of AS. It has certain originality, practicality and inspiration for basic research on AS.

[0067] Based on the above characteristics and functions of the Macrosialin gene, the Macrosialin gene can be used as a drug target to construct an in vitro cell model or animal model with Macrosialin gene overexpression or silencing, which can be used to screen drugs for preventing, alleviating and treating AS. For example, by screening, molecules that can specifically inhibit Macrosialin can be found, thereby providing new therapeutic molecules for the treatment of AS. The Macrosialin gene can also be used as a target gene in gene therapy to design and prepare drugs or biological reagents for preventing, alleviating and treating AS, and achieve the purpose of preventing, alleviating and treating AS through genetic engineering technology. For example, with the Macrosialin gene as the target gene, siRNA that can interfere with the expression of Macrosialin is designed. After being synthesized by chemical methods, it is injected into the experimental body to silence the Macrosialin gene by RNA interference to treat atherosclerosis; mutants of Macrosialin can also be designed and constructed, and after injection, they enter the cell to compete for the substrate of wild-type Macrosialin, thereby inhibiting the function of Macrosialin and achieving the purpose of treatment.

[0068] Based on the above-mentioned inventive concept, another embodiment of the present invention provides the use of Macrosialin gene as a drug target in screening drugs for treating atherosclerotic diseases.

[0069] Based on the above-mentioned inventive concept, another embodiment of the present invention provides the use of a Macrosialin inhibitor in the preparation of a drug for treating atherosclerotic diseases.

[0070] The present invention is further described below in conjunction with specific embodiments.

[0071] It should be noted that in the following examples, ApoE knockout mice (genotype ApoE - / - ) was purchased from Jackson Laboratory in the United States. The mice developed atherosclerosis after being fed a high-fat diet for several weeks. The high-fat diet was from Research Diets, catalog number D12108C. pX330 plasmid was purchased from Addgene; pT7-3×Flag-hCas9 plasmid was a gift plasmid.

[0072] In addition, the experimental methods in the following examples without specifying specific conditions are usually based on the conditions recommended by the manufacturer; other experimental supplies are commercially available unless otherwise specified.

[0073] Example 1

[0074] A method for constructing a Macrosialin gene-deficient atherosclerosis mouse model comprises the following steps:

[0075] S1. ApoE - / - Macrosialin knockout in mice with ApoE - / + Macrosialin - / + Genotypes of F0 mice.

[0076] Wherein, obtaining F0 generation mice specifically includes the following steps:

[0077] S11. The Macrosialin gene sequence was obtained from the mouse genome database MGI (http: / / www.informatics.jax.org / ). According to the Macrosialin gene structure and the principle of the CRISPR / Cas9 system, the exon 2 region (Exon 2, Exon ID: ENSMUSE00000329550) of the Macrosialin gene was set as the knockout region. Three specific sites were designed as the target sequences of sgRNA using the CRISPOR online design software (http: / / crispor.tefor.net / crispor.cgi). The three specific sites were located at 95-117 bp, 157-179 bp and 271-293 bp in the Exon 2 region. Three sgRNAs were designed to target these three specific sites respectively. The DNA sequences of the Exon 2 region targeted by the sgRNAs are shown below:

[0078] Macrosialin-sgRNA1: 5'-TGGGCCTGTGGCTGGTCGTAGGG-3' (see SEQ ID NO. 1);

[0079] Macrosialin-sgRNA2: 5′-ATGAGTGACAGTTGTGGGTCCGG-3′ (see SEQ ID NO. 2);

[0080] Macrosialin-sgRNA3: 5′-AGGGTGAGGGCCAACAGTGGAGG-3′ (see SEQ ID NO. 3).

[0081] Then, four primers were designed according to the DNA sequence of sgRNA and synthesized by Shanghai Bio-Tech Co., Ltd. The primer sequences are shown below, where the underlined part is the T7 promoter sequence and the shaded part is the Cas9 recognition site:

[0082] IVT-1: 5'- TTCTAATACGACTCACTATAGGTGGGCCTGTGGCTGGTCGTAGGGGTTTTAGAGCTAGA-3' (see SEQ ID NO. 4);

[0083] IVT-2: 5'- TTCTAATACGACTCACTATAGG ATGAGTGACAGTTGTGGGTCCGGGTTTTTAGAGCTAGA-3' (see SEQ ID NO. 5);

[0084] IVT-3: 5'- TTCTAATACGACTCACTATAGG AGGGTGAGGGCCAACAGTGGAGGGTTTTAGAGCTAGA-3' (see SEQ ID NO. 6);

[0085] IVT-4: 5'-AAAAAAGCACCGACTCGGTGCC-3' (see SEQ ID NO. 7);

[0086] The above primers containing T7 promoter sequence at the 5' end were used for PCR amplification reaction. The reaction system and PCR program are shown in Table 1-2:

[0087] Table 1 PCR amplification reaction system

[0088]

[0089] Table 2 PCR amplification reaction program

[0090]

[0091] After the PCR reaction was completed, the PCR reaction product was separated and purified using the Invitrogen PCR recovery kit (Invitrogen, K220001) to obtain three double-stranded DNA fragments containing the T7 promoter.

[0092] Afterwards, in vitro transcription was performed using a kit (NEB, E2050S), and each substance was added according to the reaction system shown in Table 3, mixed thoroughly, and placed at 37°C for 4 hours to obtain an in vitro transcription product. The in vitro transcription product was recovered and purified using an Ambion RNA purification kit (Ambion, AM1909) to obtain Macrosialin-sgRNA1, Macrosialin-sgRNA2, and Macrosialin-sgRNA3.

[0093] Table 3 sgRNA in vitro transcription system

[0094]

[0095]

[0096] S12. Obtain Cas9 mRNA, dilute Cas9 mRNA and Macrosialin-sgRNA1, Macrosialin-sgRNA2 and Macrosialin-sgRNA3 with RNase-free ultrapure water (Invitrogen, 10977015) to a final concentration of 50 ng / μL, mix thoroughly, and inject into the prepared fertilized oocytes through a microinjection system. Place in a 37°C, 5% carbon dioxide incubator to recover for 1 hour, select the surviving fertilized oocytes, and transplant them into pseudopregnant C57BL / 6 female mice for gestation. ApoE was selected from the born mice. - / + Macrosialin - / + Genotypes of F0 mice.

[0097] Among them, Cas9 mRNA was obtained by in vitro transcription, specifically, including the following steps: using a high-purity plasmid extraction kit (Tiangen Biochemical Technology Co., Ltd., DP116) to extract Cas9 vector plasmid DNA (pST1374-Cas9), and then using AgeI restriction endonuclease to treat to obtain linearized pST1374-Cas9, the enzyme digestion reaction system is shown in Table 4, and placed in a 37°C incubator for 12 hours. Afterwards, the aforementioned enzyme digestion product was subjected to DNA agarose gel electrophoresis. If the product presents a single band and is larger than the undigested Cas9 plasmid, it indicates that the vector plasmid has been successfully linearized.

[0098] Table 4 Plasmid pST1374-Cas9 restriction enzyme reaction system

[0099]

[0100] The linearized plasmid was separated and purified using a DNA recovery kit (Tiangen Biochemical Technology Co., Ltd., DP205) to obtain the Cas9 DNA in vitro transcription template.

[0101] Afterwards, in vitro transcription was performed using the Invitrogen kit (Invitrogen, AMB1345-5), and each substance was added according to the reaction system shown in Table 5. After being fully mixed, the reaction was placed at 37°C for 2 hours. 1 μL of TURBODNase was added to the above product and mixed thoroughly, and the reaction was continued at 37°C for 15 minutes. After that, the tailing reaction was performed, and each substance was added according to the reaction system shown in Table 6. After being fully mixed, the reaction was placed at 37°C for 45 minutes. The above product was recovered using the Ambion RNA purification kit (Ambion, AM1909) to obtain Cas9 mRNA.

[0102] Table 5 Cas9 mRNA in vitro transcription reaction system

[0103]

[0104] Table 6 Cas9 mRNA tailing reaction system

[0105]

[0106] The method for preparing fertilized oocytes includes: injecting pregnant mare serum and human chorionic gonadotropin into two 8-week-old C57BL / 6 female mice to put them in a superovulation state, and then inoculating them with an ApoE - / - Male mice of different genotype backgrounds were cultured together. C57BL / 6 female mice with 0.5-day thrombosis were selected and killed with CO2. The clumps of eggs were removed from the oviduct with microtweezers and digested with hyaluronidase. High-quality single embryos were selected and cultured in M16 medium for later use.

[0107] Among them, ApoE was screened from newborn mice. - / + Macrosialin - / + The genotyping of F0 generation mice specifically includes: selecting healthy F0 generation mice one week old, extracting mouse tail DNA as template DNA, and performing genotyping through PCR reaction. The PCR reaction system and procedure are shown in Tables 7-8 respectively.

[0108] Table 7 Reaction system for genotype identification by PCR reaction

[0109]

[0110] Table 8 Reaction procedure for genotyping by PCR reaction

[0111]

[0112] The sequences of the upstream primer and downstream primer used above are as follows:

[0113] GeneTy-F: 5'-TCTCCTGCCATCCTTCACGAT-3' (see SEQ ID NO. 8, the 5' end is labeled with FAM fluorescence);

[0114] GeneTy-R: 5'-TTCCTCTTCCCTGCTGAACGA-3' (see SEQ ID NO. 9).

[0115] Capillary electrophoresis detection: Take 10 μL of the above PCR product for agarose electrophoresis to detect the genotype. If obvious bands are present, dilute the PCR product 200 times and mix it with formamide and standard molecular weight internal reference DNA. After denaturation, place it on a sequencer for capillary electrophoresis. Use Genemapper software to analyze the electrophoresis results and obtain the size of the PCR product. Compared with the PCR product size of 459 bp of the wild-type Macrosialin mouse tail (DNA sequence see SEQ ID NO.10), the number of bases in the amplified fragment of the F0 generation mouse DNA is missing. The results are as follows: Figure 2 As shown, the F0 generation mice were heterozygous, with one chromosome being wild type (WT) and the other chromosome lacking 190 bp (KO).

[0116] The mouse genotype was further detected by TA cloning: the PCR amplification product of the mouse tail of the F0 generation of mice was subjected to TA cloning enzyme ligation reaction (Tiangen Biochemical Technology Co., Ltd., DP205) to obtain an enzyme ligation product containing the PCR amplification product. The enzyme ligation product was transformed with DH5α competent cells, and the transformed bacterial solution was spread on a culture dish and placed in a 37°C incubator for overnight culture. The monoclonal colony in the culture dish was picked for amplification and culture, and its genotype was identified by Sanger sequencing after small extraction. Figure 3 is the genotype of Macrosialin knockout mice, Figure 2 The capillary electrophoresis results were consistent, confirming that the present invention obtained ApoE - / + Macrosialin - / + Genotypes of F0 mice.

[0117] S2. ApoE - / + Macrosialin - / + Genotype of F0 mice and ApoE - / - Mice with the same genotype were backcrossed and screened for ApoE - / - Macrosialin - / + Genotype of F1 mice;

[0118] S3. ApoE - / - Macrosialin - / + The F1 generation mice with the same genotype were self-fertilized, and the homozygous mice with double knockout of Macrosialin gene and ApoE gene were screened out from the F2 generation mice by genotyping (ApoE - / - Macrosialin - / - The AS mouse model was obtained by inducing a high-fat diet. The homozygous mice obtained in the F2 generation were retained for subsequent breeding.

[0119] Example 2

[0120] The Macrosialin gene-deficient AS mouse model (genotype ApoE - / - Macrosialin - / - ) and control mice (genotype ApoE - / - ) were fed a high-fat diet for 12 weeks, and their body weight was recorded regularly every week. Figure 4 The horizontal axis is the feeding time, and the vertical axis is the body weight percentage. Data analysis showed that there was no significant difference in body weight between Macrosialin gene-deficient AS model mice and control mice.

[0121] In the high-fat fed Macrosialin gene-deficient AS mouse model (genotype ApoE - / - Macrosialin - / - ) and control mice (genotype ApoE - / - ) After 12 weeks, blood was collected from the inner canthus and centrifuged at 3000 rpm for 5 min to obtain mouse serum. The four biochemical indicators of serum total cholesterol (TC), triglycerides (TG), high-density lipoprotein (HDL) and low-density lipoprotein (LDL) were tested using an automatic biochemical analyzer (ADVIA2400, SIEMENS). The results are shown in Figure 5 , the horizontal axis is the detection index, and the vertical axis is the concentration (unit: mmol / L). Statistical analysis of the data showed that there was no statistical difference in the blood lipid biochemical indexes of the AS model mice with Macrosialin gene deletion compared with the control group.

[0122] In the high-fat fed Macrosialin gene-deficient AS mouse model (genotype ApoE - / - Macrosialin - / - ) and control mice (genotype ApoE - / - ) After 12 weeks, the mice were unfolded in a supine position and fixed to a foam operating table with needles so that the mouse body formed a "big" shape. The chest and abdominal cavities were cut open with sterile scissors, and the heart was pumped with 0.9% saline to empty the blood. The heart was removed and placed in 4% paraformaldehyde for overnight storage and embedded in OCT. The aortic root was selected to make 10μm frozen sections, which were then stained with Oil Red O. The Oil Red O staining solution was prepared as follows: the Oil Red O storage solution used was made of 100mL 100% isopropanol and 0.5g Oil Red O and stored in a refrigerator at 4 degrees. Before use, the storage solution and distilled water were diluted in a ratio of 3:2 to prepare the Oil Red O working solution and filtered in the dark to obtain a wine red and precipitate-free Oil Red working solution. Figure 6As shown by Oil Red O staining of the aortic root, the lesion area (% of arotic root) of the AS model mice with Macrosialin gene deletion was significantly reduced compared with the control group. The above experimental results indicate that Macrosialin deletion reduces the severity of AS lesions.

[0123] In the high-fat fed Macrosialin gene-deficient AS mouse model (genotype ApoE - / - Macrosialin - / - ) and control mice (genotype ApoE - / - ) After 12 or 18 weeks, the redundant internal organs were removed, the entire aorta was taken out, the aorta was unfolded along the midline and fixed with 4% paraformaldehyde, and the results of oil red staining analysis showed that the plaque area (plaque area / aorta area) in the whole aorta of the Macrosialin gene-deficient AS model mice was significantly reduced compared with the control mice (see Figure 7 ).

[0124] Comprehensive analysis of the above experimental results showed that compared with the control ApoE - / - Compared with mice with ApoE genotype, the Macrosialin gene is missing (genotype ApoE - / - Macrosialin - / - ) will cause a significant reduction in atherosclerosis and a significant alleviation of atherosclerosis, which indicates that the present invention utilizes the CRISPR / Cas9 system to treat ApoE - / - The knockout of Macrosialin gene in genotype background mice and the construction of Macrosialin gene-deficient atherosclerosis model mice were successful, providing a stable, convenient and efficient model mouse for the treatment research of AS-related diseases, saving economic and time costs for related research, and playing a very important role in the animal model of AS drug development and clinical scientific research. On the other hand, it reflects that the expression of Macrosialin gene is closely related to the occurrence and development of AS. This gene is expected to be used as a new drug target or to prevent, improve or treat AS symptoms by developing inhibitors that inhibit the expression of this gene, such as siRNA.

[0125] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for constructing a Macrosialin gene-deficient atherosclerosis mouse model, characterized in that: The following steps are involved: S1. ApoE - / - Macrosialin knockout in genotyped mice, ApoE - / + Macrosialin - / + Genotype of F0 generation mice; S2. The F0 generation mice were cultured with ApoE - / - Genotype mice were backcrossed and screened to obtain ApoE - / - Macrosialin - / + Genotype of F1 mice; S3, self-fertilizing the F1 generation mice and screening for ApoE - / - Macrosialin - / - The F2 generation mice of the same genotype were induced with a high-fat diet to obtain an atherosclerosis mouse model; Wherein, in step S1, obtaining the F0 generation mice specifically comprises the following steps: S11, designing the exon 2 region of the Macrosialin gene as a knockout region, and designing and synthesizing three sgRNAs targeting the upper, middle and downstream of the exon 2 region respectively; S12, injecting Cas9 mRNA and the three sgRNAs into fertilized oocytes, screening the surviving fertilized oocytes and transplanting them into pseudo-pregnant female mice for gestation, and screening ApoE from the born mice - / + Macrosialin - / + The F0 generation mouse of the genotype; wherein the fertilized egg is composed of ApoE - / - Genotypes of mouse sperm and C57BL / 6 mouse oocytes formed by in vitro fertilization.

2. The method for constructing a Macrosialin gene-deficient atherosclerosis mouse model according to claim 1, characterized in that: In step S11, the three sgRNAs target 95-117bp, 157-179bp and 271-293bp of exon 2 of the Macrosialin gene, respectively.

3. The method for constructing a Macrosialin gene-deficient atherosclerosis mouse model according to claim 2, characterized in that: In step S11, the DNA sequences targeted by the three sgRNAs are shown as SEQ ID NO.1-3 respectively.

4. The method for constructing a Macrosialin gene-deficient atherosclerosis mouse model according to claim 3, characterized in that: In step S11, the sgRNA is synthesized by in vitro transcription technology, including the following steps: designing primers IVT-1, IVT-2, IVT-3 and IVT-4 for amplifying the sgRNA, using the pX330 plasmid as a template, pairing the primers IVT-1, IVT-2 and IVT-3 with the primer IVT-4, respectively, amplifying the corresponding DNA products by PCR reaction, using the DNA products as templates, respectively, and obtaining the sgRNA by in vitro transcription and purification; Among them, the DNA sequence of the primer used to amplify the sgRNA is shown in SEQ ID NO.4-7.

5. The method for constructing a Macrosialin gene-deficient atherosclerosis mouse model according to claim 1, characterized in that: In step S12, the Cas9 mRNA is synthesized by in vitro transcription technology, including the following steps: using the linearized pST1374-Cas9 plasmid as a template, in vitro transcription and purification to obtain the Cas9 mRNA.

6. The method for constructing a Macrosialin gene-deficient atherosclerosis mouse model according to claim 1, characterized in that: In step S12, each of the sgRNA and the Cas9 mRNA is injected into the fertilized egg cell in equal proportions.

7. The method for constructing a Macrosialin gene-deficient atherosclerosis mouse model according to any one of claims 1 to 6, and the use of the atherosclerosis mouse model constructed in studying the effects and mechanisms associated with the Macrosialin gene and atherosclerosis disease, and in studying the occurrence and development of atherosclerosis and screening of atherosclerosis drugs.

Images