A method for promoting crop seed germination under waterlogging stress

Abstract

The present invention discloses a method for promoting the germination of crop seeds under waterlogging stress, and belongs to the technical field of seed treatment. The method comprises the step of priming crop seeds with a melatonin aqueous solution before sowing; the concentration of the melatonin aqueous solution is 10-50 μM, and the priming time is 1-6 hours. The present invention uses melatonin to prime crop seeds, which can promote the germination ability of seeds under waterlogging, has the advantages of fast timeliness, low cost and good effect, and provides a new idea for crop seeds to resist waterlogging stress and promote germination and growth.

Description

Technical Field

[0001] The invention relates to the technical field of seed treatment, in particular to a method for promoting crop seed germination under waterlogging stress. Background Art

[0002] At present, in terms of plant seed priming technology, the main method is to use some chemical reagent aqueous solutions to prime the seeds. For example, plant hormones and their analogs, potassium permanganate, hydrogen peroxide, calcium chloride, potassium nitrate, polyethylene glycol (PEG) and other substances are used to soak the seeds, which can improve the vitality and water absorption capacity of the seeds, promote the germination and emergence of the seeds, and thus achieve the effect of increasing production.

[0003] Although these existing priming methods can enhance the germination ability of seeds to a certain extent, and improve the resistance of plants to abiotic and biotic stresses during the germination stage. However, these methods still have shortcomings. For example, salt reagents such as calcium chloride and potassium nitrate are substances that can stress seed germination. If the dosage is not well controlled, it will inhibit the subsequent growth of plants; chemical reagents such as hydrogen peroxide and potassium permanganate have strong oxidizing properties. Although they can be decomposed in a short time, their oxidizing ability when applied may cause irreversible damage to seeds; commonly used plant hormones such as gibberellic acid, although they have the characteristics of trace efficiency, are not often used in agricultural production due to their complex chemical structure and high synthesis cost.

[0004] Chemical control technology has time and space limitations. The same chemical control means have different or even completely opposite effects on different plant growth stages: for example, if the plant growth is poor, auxin chemicals can promote growth, while the application of auxin chemicals during germination inhibits germination and growth; gibberellin chemicals promote seed germination, but inhibit flower bud differentiation, delaying the flowering time. The above examples have the same treatment, but the results are completely opposite. Therefore, technicians in this field will not rashly test existing chemical control technologies in other growth stages. The existing published technical patent document "CN105076136B New Application of Melatonin in Improving Plant Resistance to Waterlogging Stress" and the journal document "The Effect of Melatonin Seed Soaking on Rice Seedling Growth under Flooding Stress" describe the application of melatonin in resisting waterlogging during seedling growth. However, in view of the significant decrease in the germination rate of seeds after flooding, there is little existing research on how to induce the treatment of seeds to quickly and efficiently restore their phenotypes.

[0005] In addition, the above-mentioned related public document technology also has certain defects and shortcomings: the public patent requires a technical treatment every two days, and a total of 5-10 treatments are required, that is, the total treatment time is at least 10 days, and can be as long as 20 days. Objectively, flooding will cause irreversible damage to plants in a short period of time (several hours to several days), and the disclosed patents cannot save the damage caused by flooding in a short period of time. For the sowing period, when encountering unforeseen flooding disasters (such as heavy rains, damage to water conservancy facilities, and man-made accidents), technical personnel in this field need to complete sowing preparations within a few hours or just a few days, and there is no time required for advance preparations required by the public technology; furthermore, since technical means such as drainage cannot eliminate flooding caused by accumulated water, and objective climate, especially temperature changes, cause sowing to be carried out in a short period of time, under objective conditions, technical personnel in this field cannot postpone the sowing time until the treatment is completed according to the public patent technology. Therefore, the existing technology has certain defects and limitations. Summary of the invention

[0006] The purpose of the present invention is to provide a method for promoting the germination of crop seeds under waterlogging stress to solve the problems existing in the above-mentioned prior art. The present invention uses a melatonin aqueous solution to initiate crop seeds, which has the advantages of fast timeliness, low cost and good effect, and provides a new idea for crop seeds to resist waterlogging stress and promote germination and growth.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The invention provides a method for promoting the germination of crop seeds under waterlogging stress, comprising the step of using a melatonin aqueous solution to prime the crop seeds before sowing.

[0009] Furthermore, the concentration of the melatonin aqueous solution is 10-50 μM, and the initiation time is 1-6 hours.

[0010] Furthermore, the concentration of the melatonin aqueous solution is 30 μM, and the initiation time is 6 hours.

[0011] Furthermore, the triggering operation is: the melatonin aqueous solution completely submerges the crop seeds, and the liquid level is 1-3 cm above the crop seeds.

[0012] Furthermore, the crop seeds are normally harvested, naturally air-dried, uniform in size, full in grains and free of disease.

[0013] Furthermore, the crop seeds include soybean seeds.

[0014] The present invention discloses the following technical effects:

[0015] Most of the existing priming technologies for promoting germination and seedlings require additional operations such as drying after priming, which may take several days or hours. In actual agricultural production, it still takes a long time to wait when "rushing to plant" and other time-sensitive operations are needed. However, the present invention found that soybean seeds primed with melatonin do not need to undergo drying and other treatments, and can directly resist flooding stress and promote the germination ability of soybean seeds under flooding.

[0016] Compared with the initiation methods such as salt and potassium permanganate, melatonin initiation has the advantages of wide application dosage and no obvious damage to plants in the seed and seedling stage. In addition, according to the optimal concentration explored by the present invention, the cost of melatonin initiation solution is low (about 4 yuan for preparing 100L of melatonin solution (excluding water cost)), which has the advantages of low cost and good effect.

[0017] The present invention also explored the mechanism of melatonin in the seed germination process. The study found that melatonin increased the vitality of soybean seeds under waterlogging; at the molecular level, melatonin induced and increased the synthesis of endogenous melatonin in soybean seeds; the synthesis of abscisic acid was inhibited and the synthesis of gibberellins was promoted in the germination process of seeds induced by melatonin; at the same time, the melatonin induced process reduced the damage of cell membranes, which was reflected in the lower enzyme activities of peroxidase and catalase in the seed germination process than that of soybean seeds treated with waterlogging without initiation, and the lower malondialdehyde content in soybean seeds treated with waterlogging without initiation. Multiple factors jointly promoted the germination of soybean seeds under waterlogging stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0019] Figure 1 is a schematic diagram of sample processing in Example 1;

[0020] Figure 2 It is the statistical result of germination rate of seeds under different treatments; A: phenotype diagram; B: statistical data;

[0021] Figure 3 Melatonin triggers the promotion of soybean seed vitality; A: phenotype diagram; B: radicle length data statistics; C: radicle fresh weight data statistics;

[0022] Figure 4 Melatonin triggers and promotes the synthesis of endogenous melatonin in soybean seeds; A: GmCOMT; B: GmASMT;

[0023] Figure 5 is the expression level of hormone-related genes during seed germination; A: GmNCED5; B: GmNCED9; C: GmABI5; D: GmRGL1; E: GmKAO; F: GmGA3ox1;

[0024] Figure 6 It is the determination of physiological indicators related to cell membrane damage during seed germination; A: catalase; B: peroxidase; C: malondialdehyde. DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0027] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0028] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0029] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0030] Example 1

[0031] The present invention uses a method of priming seeds with aqueous solution to increase the germination rate of seeds under flooding conditions. The main operation process is as follows:

[0032] Select soybean seeds that are harvested normally, dried naturally and stored with uniform size, full grains and no diseases. Figure 1 As shown, the following processing methods are performed:

[0033] 1. Dry seeds were germinated directly in a petri dish containing 20 mL of water (the water level was about 1 / 2 of the seeds), recorded as CK20;

[0034] 2. Dry seeds were germinated directly in a petri dish containing 45 mL of water (at this point, the water completely submerged the seeds), recorded as CK45;

[0035] After the dry seeds were primed in water, they were fished out and placed directly in 20 mL of water for germination, which was recorded as H20; after the dry seeds were primed in water, they were fished out and placed directly in 45 mL of water for germination, which was recorded as H45; after the dry seeds were primed in an aqueous solution containing melatonin, they were fished out and placed directly in 45 mL of water for germination, which was recorded as MT45. Among them, the priming operation is: place the selected seeds in a beaker with a volume of 250 mL, add distilled water or an aqueous solution containing melatonin until the liquid level completely covers the upper part of the seeds and is at least 1 cm higher than the top of the seeds. According to previous research, 6 hours of melatonin induction is the best, and the optimal concentration is 30 μM. The following content is all presented based on 6 hours of melatonin induction.

[0036] Soybean seeds primed with aqueous solution (pure water, melatonin aqueous solution) and normal soybean seeds that have not been primed are germinated in different water. The specific operation is to select 20 normal soybean seeds that have not been primed and 20 soybean seeds that have been primed with water, place them in a 9 cm culture dish covered with double-layer filter paper, and add different amounts of water (20 mL per dish for normal germination and 45 mL for flooding stress). The germination rate is counted during the process of seed imbibition.

[0037] The results are as follows Figure 2 As shown, the germination rate of normal soybean seeds decreased significantly and almost could not germinate under waterlogging (CK45); water priming could not restore the phenotype of seeds that could not germinate under waterlogging (H45); melatonin priming could significantly increase the germination rate of soybean seeds under waterlogging (MT45). Figure 2 A is the phenotype of soybean seeds germinating at different water contents and after different treatments, and B is the statistical data. This experiment was conducted in a 9 cm culture dish. 20 soybean seeds of uniform size and without obvious pests and diseases were selected from each culture dish. After different pretreatments, different water was added. After the germination was completed (120 hours after imbibition), the statistics were counted and photos were taken.

[0038] Example 2

[0039] The relevant principles and mechanisms are as follows:

[0040] 1. Experimental process:

[0041] The soybeans that had been treated in various ways were germinated for 6 hours in normal water or flooding. The intact soybeans were selected and cut along the hilum. A 1% (w / v) TTC (2,3,5-triphenyltetrazolium chloride, CAS No.: 298-96-4, purchased from Shanghai Yuanye Biological, Product No. S19026) aqueous solution (pH = 7.4) was added to completely cover the seeds. The seeds were treated in the dark at 25°C for 12 hours. After absorbing the liquid with paper, the seeds were rinsed with sterile water until the red color did not change. The photos were taken with a SLR camera (Nikon D3500) ( Figure 3 (A).

[0042] After the germination was completed (120 hours of imbibition), the length of the radicle was counted. Figure 3 Middle B): Use a scalpel to peel off the radicles of all germinated seeds, use a SLR camera to photograph the length of the radicles, and use the "Analyze" option in the "ImageJ" software to count the length of each radicle. After completion, use Excel to process the data, including the mean value of the radicle length, the standard error of the radicle length, etc., and perform significance analysis using SPSS software. Similarly, the radicles of all germinated seeds were weighed using a precision balance (Sartorius, BSA223S) to obtain the radicle weight of the sample ( Figure 3 C), and data processing and analysis were performed using Excel and SPSS software. The above "radicle length" and "radicle weight" refer to germinated seeds, and ungerminated seeds are not included. All ungerminated seeds have their length or weight recorded as "0".

[0043] Subsequently, the seeds were subjected to gene expression analysis. First, eight dry seeds, eight seeds at the third hour after melatonin induction, and eight seeds at the sixth hour after melatonin induction were selected (selection criteria: seeds without mechanical damage, full seeds, and seeds with representative appearance at that time), ground into fine powder in liquid nitrogen, and then precipitated using the “ Plant RNAKit" kit (Cat. No.: ER311) was used to extract total RNA from soybean seeds. The extraction method was completely in accordance with the kit instructions. One-Step gDNARemoval and cDNA Synthesis SuperMix" kit (Cat. No.: AT311) was used for genome removal and reverse transcription. The operation method was completely in accordance with the instructions of the kit. After completion, a fluorescence quantitative PCR experiment was performed. The internal reference gene was GmACT11, and the primer sequences were: F: ATCTTGACTGAGCGTGGTTATTCC; R: GCTGGTCCTGGCTGTCTCC. For the quantitative gene GmCOMT, the primer F: CTTCTGTCCTTCCAATGATCCTCA; the primer R: ACGGTCCAACATAACGGGTG. For the quantitative gene GmASMT, the primer F: AATGTGCGATTGAGCTGGC; the primer R: TTGAGAATAGCCCCTGCTGC. The enzyme used for the fluorescence quantitative PCR was the " GreenqPCR SuperMix" (Cat. No.: AQ601), the method of use was carried out in full accordance with the instructions. The instrument was the StepOnePlus from Applied Biosystems TM Real-Time PCR System. The experimental results are shown in Figure 4 Middle AB.

[0044] Then, soybean seeds at 0, 3, 6, and 9 hours of seed germination were selected to detect changes in gene expression during germination ( Figure 5 ). RNA extraction, genomic DNA removal, reverse transcription, and qPCR operations were the same as described above. The internal reference gene was still GmACT11, and the internal reference primer sequence was the same as before. The other primer sequences are detailed in Table 1.

[0045] Table 1 Primers used in the experiment

[0046]

[0047]

[0048] Finally, the content of malondialdehyde, the active agent of peroxidase and catalase, during the germination process was determined ( Figure 6 ). The experiments were all performed using kits from Beijing Solebow Technology Co., Ltd. The experimental methods were carried out in full accordance with the instructions of the peroxidase kit (Cat. No. BC0090), catalase kit (Cat. No. BC0205), and malondialdehyde (MDA) kit (Cat. No. BC0025). The quantitative microplate reader was the Synergy Neo2 from BioTek. The results are shown in Figure 6 Medium AC.

[0049] 2. Experimental results

[0050] like Figure 2-Figure 3 As shown in Figure 2, the germination rate and seed vigor of normal soybean seeds under waterlogging were significantly improved after being primed with melatonin. Figure 2 It can be seen that the germination rate of seeds primed by water was significantly increased under flooding conditions, and the root length and fresh weight were significantly increased ( Figure 3 In this experiment, 9 cm culture dishes were used. Twenty healthy seeds without obvious diseases and insect pests were selected from each dish. Different water was added and the germination rate was counted during the germination process. Figure 2 A in the middle shows the phenotypic photos of old seeds after germination in different waters with and without priming treatment, among which "CK20" and "H20" are the phenotypes of normal seeds after germination in 20 mL of water with and without priming treatment, respectively, "CK45" is the phenotype of unprimed soybean seeds germinating in 45 mL of water, "H45" is the phenotype of primed soybean seeds germinating in 45 mL of water, and "MT45" is the phenotype of soybean seeds primed with melatonin germinating in 45 mL of water. Figure 3 Medium B and Figure 3 Middle C is the statistical data of radicle length and radicle weight after seeds with different treatments germinated in different water.

[0051] like Figure 4 As shown, in soybean seeds primed with melatonin, the expression of endogenous melatonin synthesis genes GmCOMT and GmASMT was upregulated. This result indicates that melatonin priming can induce the synthesis of endogenous melatonin in plants, further increasing the melatonin content available to plants and enabling soybean seeds to further proceed with the seed germination process.

[0052] like Figure 5 As shown in the figure, during the germination process of soybean seeds under different treatments, the genes related to the synthesis and signal of the negative regulatory hormone abscisic acid, and the negative regulatory hormone gibberellin, synthesis and other related genes of seed germination changed. Specifically, in the untreated materials under flooding stress, the expression of abscisic acid synthesis and signal-related genes was upregulated compared with the control group; the abscisic acid synthesis (GmNCED5, GmNCED9) and signal-related genes (GmABI5) of soybean seeds induced by melatonin were downregulated compared with the control group. Among the gibberellin-related genes, the melatonin-induced treatment upregulated the expression of gibberellin synthesis genes (GmKAO, GmGA3ox1 genes) and downregulated the expression of gibberellin negative regulatory transcription factor genes (GmRGL1 gene). This result shows that after normal soybeans are treated with melatonin, the synthesis of gibberellin is promoted, the synthesis of abscisic acid is inhibited, and the biological process of seed germination is promoted at the hormone level.

[0053] Figure 6As shown, the biofilm damage of soybean seeds triggered by melatonin is lower. Compared with normal soybeans under flooding stress, the enzyme activities of peroxidase and catalase in soybean seeds triggered by melatonin are lower than those of soybean seeds that are not triggered and water-triggered and germinated under flooding stress, indicating that the seeds themselves have less peroxides under flooding stress. Peroxides can oxidize and destroy cell membranes, while malondialdehyde is an indicator of the degree of cell membrane damage. The higher the malondialdehyde content, the greater the cell membrane damage. The present invention further tested the malondialdehyde content and found that seeds triggered by melatonin had less cell damage under flooding stress. This shows that melatonin reduces the damage to the cell membrane caused by flooding stress, maintains the integrity of the cell membrane, and further promotes the process of seed germination.

[0054] In summary, soybean seeds primed with melatonin can resist flooding stress and promote the germination ability of soybean seeds under flooding ( Figure 2 ), which is due to the fact that melatonin improves the vigor of soybean seeds under water ( Figure 3 ). At the molecular level, melatonin triggers soybean seeds to improve germination under waterlogging stress because melatonin triggers and increases the synthesis of endogenous melatonin in soybean seeds ( Figure 4 ); During the germination process of seeds primed with melatonin, the synthesis of abscisic acid was inhibited, while the synthesis of gibberellins was promoted ( Figure 5 ); at the same time, the melatonin-primed process reduced the damage to the cell membrane, which was reflected in the lower enzyme activities of peroxidase and catalase in the germination process than those in the soybean seeds that were not primed and flooded, and the lower malondialdehyde content in the soybean seeds primed with melatonin than that in the soybean seeds that were not primed and flooded ( Figure 6 ). Multiple factors jointly promoted the germination of soybean seeds under waterlogging stress.

[0055] In this embodiment, soybean seeds are selected as seed materials, and other crop seeds, such as cucumber, wheat, and Lathyrus can also be selected as seed materials.

[0056] The method of using melatonin to trigger plant seed germination in the present invention is inconsistent with the existing public technology, and the plant growth period used is inconsistent. The technicians in this field cannot make associations or routine adjustments based on previous experimental experience and public technology to obtain the technical operation of the present invention. There are unpredictable risks (such as reduced production, crop failure, etc.) when adjusting and using according to existing results, experimental experience and public technology. Therefore, the technical solution of the present invention should be protected by patent technology.

[0057] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for promoting crop seed germination under waterlogging stress, characterized in that: It includes the steps of priming crop seeds with an aqueous solution of melatonin before sowing; Wherein, the concentration of the melatonin aqueous solution is 30 μM, and the initiation time is 6 hours; The crop seeds are soybean seeds; The soybean seeds are normally harvested, naturally air-dried, uniform in size, full in grains, and free of disease; The triggering operation is: the melatonin aqueous solution is completely submerged in the crop seeds, and the liquid level is 1-3 cm above the crop seeds.

Images