Cell culture container, cell culture device, and cell culture method

Abstract

This application relates to the field of cell nucleus detection technology, specifically to a cell culture container, a cell culture device, and a cell culture method. The cell culture container includes a microcavity array, a substrate, an inlet, and an outlet. The microcavity array has a plurality of microcavities, and each microcavity has a first opening, a second opening, and a first side wall. The first opening has a first width, and the second opening has a second width. The first width is greater than the second width to confine cells within the microcavities. Through this cell culture container, cell culture device, and cell culture method, a better growth environment and conditions are provided for three-dimensional cell spheroids, making them closer to their in-vivo three-dimensional growth environment, with better cell growth states. Especially when culturing stem cells, the "stemness" of the stem cells can be maximally maintained, that is, the tendency of "spontaneous" differentiation can be reduced.

Description

Technical Field

[0001] This application relates to the field of nucleus detection technology, and specifically relates to a cell culture container, a cell culture device, and a cell culture method. Background Art

[0002] Cell culture containers (such as cell culture flasks, 25 cm 2 , 75 cm 2 , 175 cm 2 and 225 cm 2 ) can provide a sterile microchamber for culturing cells. In some embodiments, culturing cells can provide information regarding disease and toxicology research, the efficacy of pharmaceuticals and treatments, tumor characteristics, organisms, genetics, and other scientific, biological, and chemical principles related to cells and cell-related matters. During culturing, the cell culture container provides a sterile, liquid-impermeable microchamber to hold the cells.

[0003] The microchamber or cell growth chamber may include a bottom surface, a top surface, and side walls having surfaces. At least one of these surfaces may be adapted for cell growth. For example, to establish the basis for culturing spherical cells, the cell growth surface may include a plurality of microchambers (e.g., micron-sized holes, sub-millimeter-sized cavities), which are arranged in an array, for example. The cell growth surface may be integral with the cell culture flask or may be a separate substrate placed in or fixed to the cell growth chamber. The top surface, bottom surface, one or more side surfaces, or a combination thereof may include microchambers in an array. For example, the microchambers may be formed in a wavy or sinusoidal shape, thereby forming microchambers or micropores with rounded tops and rounded bottoms. In some embodiments, the cell culture flask may be filled with a material (e.g., culture medium, solid, liquid, gas) that promotes the growth of three-dimensional cell cultures (e.g., cell aggregates, spheres). For example, a culture medium containing cells and in which the cells are suspended may be added to the cell culture chamber. The suspended cells may be aggregated in the plurality of microchambers and may form (e.g., grow) into cell groups or cell clusters. The grouped or clustered cells grow in three dimensions to form three-dimensional cells or cell aggregates or cell bodies, which can be generally spherical in shape and thus may be referred to herein as spheres or organoids.

[0004] In some existing technologies, a cell culture chamber with a microcavity array provided on the cell culture surface can be used to culture an array of spheres, and each sphere is located in its own microcavity. For example, CN111094535A8 discloses a cell culture container having side walls and a bottom surface. In an embodiment, the bottom surface is a cell culture surface having a plurality of microcavities. In an embodiment, the cell culture surface is a substrate attached to the side walls. In an embodiment, the side walls are attached to the substrate such that there is no flat surface around the cell culture surface. Its specification discloses that each of the plurality of microcavities 320, such as 320a, 320b, 320c, may include a concave surface 321a, 321b, 321c defining a cavity 322a, 322b, 322c and openings 323a, 323b, 323c. Liquid enters and exits the microcavity through the openings 323a, 323b, 323c. There is no flat area in the cell culture chamber for cells to settle on. This is important for ensuring that cells do not settle outside the microcavities in the cell culture chamber. When cells settle on a flat area outside the cell culture surface outside the microcavities, the cells can grow into irregular cell aggregates 801 (see FIGS. 35A and 35B, 36A and 36B), and an uneven population of multicellular three-dimensional structures is produced in the container. In an embodiment, the cell culture surface consists essentially of a plurality of microcavities. Thus, it discloses a method of avoiding the formation of irregular cell aggregates by providing a non-flat area on the cell culture surface, which is more conducive to three-dimensional cell growth.

[0005] However, when some stem cells are cultured on the cell culture surface of these non-flat areas, the stem cells are prone to losing their self-renewal ability, being prone to aging, or "spontaneously" differentiating into osteocytes, stromal cells or adipocytes, which is not conducive to the long-term in vitro culture of stem cells. For example, Kim J, Jin W K, Park J H, et al. also found in Biological characterization of long-term cultured human mesenchymal stem cells [J]. Archives of Pharmacal Research, 2009, 32(1):117-126.). Summary of the Invention

[0006] The inventors of the present application creatively found that forming a closed culture space in the culture container that can breathe but not permeate liquids, and forming an array of microcavities with a first opening and a second opening inside can effectively inhibit the "spontaneous" differentiation of stem cells, improve cell stemness, and have very significant positive application prospects for the in vitro culture of stem cells.

[0007] To this end, the embodiments of the present application at least disclose the following technical solutions:

[0008] In a first aspect, the embodiments of the present application disclose a cell culture container, including:

[0009] At least one microchamber array having a plurality of microchambers, each microchamber having a first opening, a second opening, and a first sidewall extending between the first opening and the second opening, the first opening having a first width, the second opening having a second width, and the first width being greater than the second width to confine cells in the microchamber;

[0010] A substrate providing a structural basis for forming the microchamber array;

[0011] An inlet providing an opening to the microchamber on one side of the cell culture container;

[0012] An outlet providing an opening to the microchamber on the opposite side of the cell culture container;

[0013] Wherein, the substrate includes:

[0014] A first support member having a plurality of through-holes and two parallel surfaces, the through-holes penetrating through the two surfaces of the first support member to form the microchamber array;

[0015] A second support member connecting the first support member and enclosing with the first support member to form at least one culture space.

[0016] In the embodiments of the present application, the size of the first width is from 100 μm to about 5000 μm, and the size of the second width is from 15 μm to about 50 μm.

[0017] In the embodiments of the present application, the second support member is made of a gas-permeable and liquid-impermeable material, the second support member seals both ends of the through-hole and forms a culture space in the through-hole, and the microchamber is wrapped in the culture space.

[0018] In the embodiments of the present application, the first support member includes through-hole walls for enclosing to form the through-holes, and the through-hole walls include the first sidewall and the second sidewall;

[0019] The first sidewall extends and narrows from the first opening towards the second opening, and the second sidewall connects the first sidewall;

[0020] Non-sticky coatings are formed on the surfaces of both the first sidewall and the second sidewall.

[0021] In the embodiment of the present application, a step is formed at the outer periphery of the first opening. The step adapts to the shape of the first opening in the thickness direction of the first support, and the size of the step is larger than the size of the first opening.

[0022] In the embodiment of the present application, it includes a plurality of micro - cavity arrays stacked in the vertical direction. The second opening of the upper - layer micro - cavity corresponds to the first opening of the lower - layer micro - cavity in the vertical direction.

[0023] In the embodiment of the present application, the cell - culture container further includes:

[0024] A third support member, which connects the culture space and forms at least one of the inlets and at least one of the outlets for pouring into and / or out of the culture space cells and / or cell culture medium.

[0025] In the embodiment of the present application, the third support member is formed by extending from the outer peripheral edge of the first support member and is hollow inside.

[0026] In a second aspect, the embodiment of the present application discloses a cell - culture device, including:

[0027] At least one cell - culture container according to the first aspect; and

[0028] At least two riser - pipe assemblies, the riser - pipe assemblies having at least one connecting portion for connecting the inlets and / or outlets formed by the third support member to the riser - pipe assemblies.

[0029] In a third aspect, the embodiment of the present application discloses a three - dimensional culture method for human placenta mesenchymal stem cells, which is cultured using the cell - culture container according to the first aspect or the cell - culture device according to the second aspect. The three - dimensional culture method includes:

[0030] Introducing a liquid containing cells and culture medium into the cell - culture chamber through the inlet;

[0031] Allowing the cells to settle into the micro - cavities; and

[0032] Culturing the cells.

[0033] Compared with the prior art, the present application has at least one of the following beneficial effects:

[0034] The cell culture container provided by the embodiment of the present application uses a microchamber having a first opening, a second opening, and a first side wall extending between the first and second openings to accommodate three-dimensional cell spheroids. This is equivalent to forming channels at both ends of the three-dimensional cell spheroids for the inflow and outflow of liquid into and out of the microchamber. Thus, three-dimensional cell cultures (such as cell clusters, spheroids) or cell culture media can be injected into the culture space through the inlet, and cell metabolites or culture waste liquids can be discharged from the culture space through the outlet. This cell culture container provides a better growth environment and conditions for three-dimensional cell spheroids, making them closer to their in-vivo three-dimensional growth environment, with better cell growth states. Especially when culturing stem cells, it can maximize the maintenance of the "stemness" of stem cells, that is, reduce their "spontaneous" differentiation tendency. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Schematic structural diagram of a cell culture container provided by the prior art (the lower figure is an enlarged view of the circled part in the upper figure).

[0036] Figure 2 Schematic plan view of the cell culture container provided by the embodiment of the present application.

[0037] Figure 3 For Figure 2 A schematic structural diagram of part A in

[0038] Figure 4 For Figure 2 A schematic structural diagram of part A in

[0039] Figure 5 Schematic plan view of the cell culture container provided by the embodiment of the present application.

[0040] Figure 6 For Figure 5 A schematic structural diagram of part B in

[0041] Figure 7 Schematic three-dimensional view of the cell culture container provided by the embodiment of the present application. The dashed structure in the figure is the structure of a microchamber array.

[0042] Figure 8 Schematic three-dimensional view of a microchamber array provided by the embodiment of the present application.

[0043] Figure 9 Schematic three-dimensional view of a microchamber array provided by the embodiment of the present application.

[0044] Figure 10 Schematic plan view of the cell culture device provided by the embodiment of the present application.

[0045] Figure 11Schematic diagram of the valve plane structure provided by the embodiment of the present application (closed state).

[0046] Figure 12 Schematic diagram of the valve plane structure provided by the embodiment of the present application (open state).

[0047] Figure 13 Graph showing the relative expression levels of dryness transcription factor mRNAs after culturing human placenta mesenchymal stem cells in cell culture containers provided by Examples 1-2 and Comparative Examples 1-4 of the present application, respectively.

[0048] Reference numerals:

[0049] Cell culture container 100, cell culture chamber 103, microcavity 160 ( Figure 1 inside);

[0050] Microcavity array 110, microcavity 111, first opening 112, first width 112a, second opening 113, second width 113a, first side wall 114, thickness dimension 114a of the first side wall, second side wall 115, thickness dimension 115a / 115c of the second side wall, width dimension 115b / 115d of the second side wall, step 1150, maximum width dimension 1150a of the step, base 120, first support member 122, through hole 1200, surface 122b, culture space 1201, through hole wall 1220, cuboid 1202, second support member 123, third support member 124, hollow housing 1240, partition chamber 1241, inlet 130, outlet 140, riser assembly 200, connecting portion 201, tube cavity 202, connection port 203, pump 300, valve 400, valve nut 401, connecting sleeve 402, valve space 4020, protruding portion 4021, valve ball 403, sealing ring 404, connecting nut 405, hose 500, three-dimensional cell sphere 600, cell culture device 800. Detailed implementation manners

[0051] In order to make the objectives, technical solutions and advantages of the present application clearer and more understandable, the present application will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0052] It should be understood that when an element is referred to as being "connected" to another element, it can be directly connected or coupled to the other element or there may be intermediate elements. In contrast, when an element is referred to as being "directly connected" to another element, there are no intermediate elements. Other expressions used to describe the relationship between elements can be interpreted in a similar manner (for example, "between" and "directly between", "adjacent" and "directly adjacent", etc.).

[0053] The terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the exemplary embodiments. As used herein, the singular forms "a", "an" and "the" are also intended to include the plural forms unless the context clearly dictates otherwise. It should also be understood that the terms "comprises", "comprising" when used herein specify the presence of the stated features, integers, steps, operations, elements and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components and / or groups thereof.

[0054] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the exemplary embodiments belong. It should also be understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and should not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

[0055] Those skilled in the art should understand that the term "and / or" used herein is merely a description of an association relationship between associated objects, indicating that three relationships may exist. For example, A and / or B may represent: A exists alone, A and B exist simultaneously, and B exists alone. In addition, the character " / " herein generally represents an "or" relationship between the associated objects before and after.

[0056] It should be noted that the orientation terms such as "upper", "lower", "left", "right" described in the embodiments of the present application are described from the angles shown in the drawings and should not be construed as a limitation on the embodiments of the present application. In addition, in the context, it should also be understood that when it is mentioned that one element is connected "above" or "below" another element, it can not only be directly connected "above" or "below" another element, but also be indirectly connected "above" or "below" another element through an intermediate element. In the description of the embodiments of the present application, it should be understood that the terms "first", "second", "third", "fourth", "fifth", etc. are only used for distinguishing descriptions and cannot be construed as indicating or implying relative importance.

[0057] The exemplary embodiments will now be described more fully with reference to the accompanying drawings, in which some exemplary embodiments are illustrated. In the drawings, for clarity, the thickness of lines, layers and / or regions may be exaggerated. Thus, although the exemplary embodiments may take various modifications and alternative forms, embodiments thereof are shown by way of example in the drawings and will be described in detail herein. However, those skilled in the art should understand that the exemplary embodiments are not intended to be limited to the particular forms disclosed, but on the contrary, the exemplary embodiments are intended to cover all modifications, equivalents and alternatives falling within the scope of the present invention. Throughout the description of the drawings, like reference numerals refer to like or similar elements.

[0058] Compared with two-dimensional culture methods (such as cell culture dishes, 96-well plates, etc.), three-dimensional cell culture methods can generate multicellular structures that are physiologically more precise and represent more realistically the environment in which cells can exist and grow in actual life applications compared to the simulated conditions in the laboratory. For example, three-dimensional cell cultures are found to provide a more realistic environment that mimics "in vivo" (i.e., in the living body, in the real environment) cell growth; while two-dimensional cell cultures are found to provide an environment that mimics "in vitro" (i.e., in glass, in the laboratory environment) cell growth, which does not represent as well the real environment that occurs outside the laboratory. Through interaction with three-dimensional cell cultures and observation of their properties and behaviors, progress in cell understanding can be achieved in aspects such as disease and toxicology research, the efficacy of pharmaceuticals and treatments, tumor characteristics, organisms, genetics, and other cell- and cell-related scientific, biological, and chemical principles.

[0059] Figure 1 The structure of the microcavities in the microcavity array in the existing cell culture container is shown, which results in an uneven cell culture method. For example, the three-dimensional cell sphere 600 accommodated in the cell culture chamber 103 can settle and be in the microcavity 160. However, due to the pore structure of the microcavity 160, when the three-dimensional cell sphere 600 settles in the microcavity 160, the three-dimensional cell sphere 600 almost fills the pore-structured microcavity 160, and the liquid can only flow into or out of the microcavity 160 from the upper end of the microcavity 160. The flow of the liquid inside the microcavity 160 (such as the gap between the three-dimensional cell sphere 600 or the liquid required by the three-dimensional cell sphere 600 or the liquid generated by metabolism) is blocked from flowing out of the microcavity 160. Through the liquid flow or perturbation above the microcavity array 160 formed in the microcavity 160, the intervention on the liquid flow inside the microcavity 160 is relatively small, so when it is necessary to provide fresh culture medium for the three-dimensional cell sphere 600 or to remove the waste liquid generated by its metabolism, it is not conducive to the liquid flow.

[0060] Therefore, as Figures 2 - 9As shown, an embodiment of the present application discloses a cell culture container 100, which includes at least one microchamber array 110, a substrate 120, an inlet 130, and an outlet 140. The microchamber array 110 has a plurality of microchambers 111. Each microchamber 111 has a first opening 112, a second opening 113, and a first sidewall 114 extending between the first opening 112 and the second opening 113. The first opening 112 has a first width 112a, and the second opening 113 has a second width 113a. The first width 112a is greater than the second width 113a to confine cells within the microchamber 111. The substrate 120 provides a structural basis for forming the microchamber array 110. The inlet 130 provides an opening to the microchambers 111 on one side of the cell culture container 100. The outlet 140 provides an opening to the microchambers 111 on the opposite side of the cell culture container 100. Among them, the substrate 120 includes a first support member 122 and a second support member 123. The first support member 122 has a plurality of through-holes 1200 and two parallel surfaces 122b. The plurality of through-holes 1200 penetrate through the two parallel surfaces 122b of the first support member 122 to form the microchamber array 110. The second support member 123 is connected to the first support member 122 and encloses with the first support member 122 to form at least one culture space 1201.

[0061] The cell culture container 100 provided by the embodiment of the present application uses the microchamber 111 having a first opening 112, a second opening 113, and a first sidewall 114 extending between the first opening 112 and the second opening 113 to accommodate the three-dimensional cell spheroid 600. It is equivalent to forming channels at both ends of the three-dimensional cell spheroid 600 for the liquid to flow into or out of the microchamber 111. Thus, a three-dimensional cell culture (such as cell clusters, spheroids) or cell culture medium is injected into the culture space 1201 through the inlet 130, and cell metabolites or culture waste liquid are exported from the culture space 1201 through the outlet 140. The cell culture container 100 provides a better growth environment and conditions for the three-dimensional cell spheroid 600, making it closer to its in-vivo three-dimensional growth environment, and the growth state of the cells is better. Especially when culturing stem cells, it can maximize the maintenance of the "stemness" of the stem cells, that is, reduce their "spontaneous" differentiation tendency. As Figure 13 shown, Figure 1 in the manner of Figure 1 providing the microchamber 160 structure for culturing human placenta mesenchymal stem cells, the cell self-renewal ability is weakened, there is a tendency of "spontaneous" differentiation into adipocytes, and moreover, the relative expression levels of the stem cell transcription factors Nanog, Sox2, and Oct4 are all lower than those in Examples 1 and 2, and the cell stemness is reduced. And by using Figure 2The provided microchamber 111 structure (Examples 1-2) is used for culturing human placenta mesenchymal stem cells. The cells can self-renew for a long time, have normal metabolic functions, and a weakened differentiation trend, which is beneficial for the long-term culture of these stem cells and has significant advantages for in vitro stem cell culture.

[0062] In some embodiments, the first opening 112 refers to the open part at one end of the microchamber 111, rather than a closed structure. The first width 112a of the first opening 112 refers to the minimum width near one end of the microchamber 111. For example, as Figures 2 - 4 shown, the first width 112a can be the minimum width of the edge of the first opening 112 of the microchamber 111, or the minimum width inside the first opening 112 near the first sidewall 114. Similarly, the second opening 113 refers to the open part at the opposite end of the microchamber 111, rather than a closed structure. The second width 113a of the second opening 113 can be the minimum width near the opposite end of the microchamber 111 (for example, the second opening 113 is generally rectangular), as Figure 3 、 4 shown. The second width 113a can also be the general width of the edge of the second opening 113 of the microchamber 111 (for example, the second opening 113 is generally circular). In some embodiments, the second width 113a should have a certain limit to facilitate retaining the three-dimensional cell culture (such as cell aggregates, spheres) within the microchamber 111.

[0063] Since when culturing cells, the container can be filled with materials (such as culture medium, solid, liquid, gas) that promote the growth of three-dimensional cell cultures (such as cell aggregates, spheres). For example, a culture medium containing cells suspended in a liquid can be added to the cell culture chamber of the container. The suspended cells can be aggregated in multiple microchambers and can form (such as grow) into cell groups or clusters, forming three-dimensional cell spheres 600. These three-dimensional cell spheres 600 can have dimensions (such as diameter) ranging from about 50 μm to about 5000 μm, as well as any dimension or range of dimensions within the range of about 50 μm to about 5000 μm. In some embodiments, dimensions larger or smaller than the exact dimensions disclosed can be provided. Therefore, unless otherwise specified, dimensions larger or smaller than the exact dimensions disclosed are considered to be within the scope of the present disclosure. In some embodiments, the dimensions (such as diameter) of the three-dimensional cell spheres 600 formed by human placenta mesenchymal stem cells are between 50 and 200 μm.

[0064] In some embodiments, to accommodate the size of these spheres or spheroid organoids, the size of the first width 112a should be greater than the size of the spheres, and the size of the second width 113a should be less than the size of the spheres. For example, the second width 113a can be a size of about 15 μm to about 50 μm, such as 15 μm, 20 μm, 25 μm, 30 μm, 35 μm, 40 μm, 45 μm, 50 μm, any size or size range covered within the range of 10 μm to 50 μm. The first width 112a can be a size including about 100 micrometers (μm) to about 5000 μm. In some embodiments, the first width 112a can include the following sizes: 100 μm, 150 μm, 200 μm, 250 μm, 300 μm, 350 μm, 400 μm, 450 μm, 500 μm, 550 μm, 600 μm, 650 μm, 700 μm, 750 μm, 800 μm, 850 μm, 900 μm, 950 μm, 1000 μm, 1500 μm, 2000 μm, 2500 μm, 3000 μm, 3500 μm, 4000 μm, 4500 μm, 5000 μm, any size or size range covered within the range of about 100 μm to about 5000 μm.

[0065] In some comparative examples, the size of the second width 113a is about 10 - 20 μm. For example (Comparative Example 2), a cell culture container 100 constructed with a microchamber 111 having a second width 113a with a size of 10 μm is used to culture three-dimensional cell spheres 600 formed from human placenta mesenchymal stem cells. As a result, the growth and renewal rate of the cells is limited, and the relative expression levels of the cell stemness transcription factors Nanog, Sox2, and Oct4 are all lower than those in Examples 1 and 2, and the cell stemness decreases. In some comparative examples, the size of the second width 113a is about 70 μm - 200 μm. For example (Comparative Example 3), a cell culture container 100 constructed with a microchamber 111 having a second width 113a with a size of 70 μm is used to culture three-dimensional cell spheres 600 formed from human placenta mesenchymal stem cells. As a result, the three-dimensional cell spheres 600 are deformed 2 hours after being injected into the microchamber 111, and a part of the spheres overflows from the second opening 113 due to gravity, cell growth and migration, or other reasons. Moreover, the relative expression levels of the cell stemness transcription factors Nanog, Sox2, and Oct4 are all lower than those in Examples 1 and 2, and the cell stemness decreases.

[0066] In some embodiments, such as Figure 3 , 4As shown, the second support member 123 seals both ends of the through-hole 1200 to form a culture space 1201 within the through-hole 1200, and the microchamber 111 is wrapped within the culture space 1201. Thus, by injecting the three-dimensional cell spheroid 600 or culture medium into the culture space 1201, the three-dimensional cell spheroid 600 can be injected and retained in the microchamber 111, making it easier for the cells to access the nutrient solution in the culture space 1201 and also facilitating the removal of waste liquid. The second support member 123 is made of a gas-permeable and liquid-impermeable material. Using such a material increases the gas exchange by allowing gas to enter the microchamber 111 containing the spheroid through the gas-permeable and liquid-impermeable material. This gas-permeable material makes the container more versatile. For example, if used in a non-perfusion mode, the cells are exposed to oxygen in the absence of a perfused medium. However, if the perfusion system is in operation, oxygen can be delivered to the cells dissolved in the circulating medium. Thus, the container can be used both as a perfusion system and as a static system.

[0067] The gas-permeable and liquid-impermeable second support member 123 can be composed of one or more membranes known in the art. Suitable materials for use as membranes include, for example: polystyrene, polyethylene, polycarbonate, polyolefin, ethylene vinyl acetate, polypropylene, polysulfone, polytetrafluoroethylene (PTFE) or compatible fluoropolymers, silicone rubber or copolymers, poly(styrene-butadiene-styrene) or combinations of these materials. The membrane can have any thickness, preferably between about 25 μm and 250 μm, but ideally between about 25 μm and 125 μm. The membrane allows free exchange of gas between the interior of the culture space 1201 and the external environment and can be of any size or shape as long as the membrane supports cell growth.

[0068] In some embodiments, the first support member 122 includes a through-hole wall 1220 for enclosing and forming the through-hole 1200. The through-hole wall 1220 includes a first side wall 114 and a second side wall 115. The first side wall 114 extends and narrows from the first opening 112 towards the second opening 113. The second side wall 115 connects to the first side wall 114. In some embodiments, the first side wall 114 encloses and forms the microchamber 111, with the first end of the first side wall 114 forming the first opening 112 and the other end forming the second opening 113. There are two second side walls 115, one extending from the first opening 112 to one end of the through-hole 1200 and the other extending from the second opening 113 to the other end of the through-hole 1200. Thus, the microchamber 111 is wrapped in the center of the culture space 1201, providing good protection for the cells in the microchamber 111 and also reducing interference with cell culture.

[0069] In some embodiments, the first sidewall 114 extends and narrows from the first opening 112 to the second opening 113, such that the formed microchamber is generally trapezoidal. The depth dimension 114a of the first sidewall 114 from the first opening 112 to the second opening 113 is approximately 1.5 to 5 times the dimension (e.g., diameter) of the three-dimensional cell sphere 600.

[0070] In some embodiments, the thickness dimension (such as 115a in the figure) of the second sidewall 115 extending from the first opening 112 to one end of the through-hole 1200 is approximately in the range of about 1000 micrometers (μm) to about 10000 μm, and its width dimension (such as 115b in the figure) is approximately in the range of about 3000 micrometers (μm) to about 10000 μm. The thickness dimension 115a and the width dimension 115b can be arbitrarily selected within the above-defined ranges. Similarly, the thickness dimension 115c of the second sidewall 115 extending from the second opening 113 to the other end of the through-hole 1200 is approximately in the range of about 2000 micrometers (μm) to about 5000 μm, and its width dimension 115d is approximately in the range of about 3000 micrometers (μm) to about 10000 μm. The thickness dimension 115c and the width dimension 115d can be arbitrarily selected within the above-defined ranges. In these embodiments, the thickness dimension 115c of the second sidewall 115 extending from the second opening 113 to the other end of the through-hole 1200 is approximately 1.5 to 2 times the thickness dimension 115a of the second sidewall 115 extending from the first opening 112 to one end of the through-hole 1200.

[0071] In some comparative example 4, the thickness dimension 115c of the second sidewall 115 extending from the second opening 113 to the other end of the through-hole 1200 is equal to the thickness dimension 115a of the second sidewall 115 extending from the first opening 112 to one end of the through-hole 1200. For example, as Figure 13 shown, both the thickness dimensions 115a and 115c are 1000 μm. The second sidewall 115 with such a thickness dimension is used to construct the first support member 122, form the cell culture container 100, and culture the three-dimensional cell sphere 600 formed by human placenta mesenchymal stem cells. As a result, the self-renewal ability of the cells is inferior to that of the cell culture container provided in Example 1, and the relative expression levels of the stem cell transcription factors Nanog, Sox2, and Oct4 are lower than those in Example 1 and 2, showing an inevitable tendency of "spontaneous" differentiation into adipocytes.

[0072] In some embodiments, the cross-sectional shape formed by the second sidewall 115 extending from the first opening 112 to one end of the through-hole 1200 and the cross-sectional shape formed by the second sidewall 115 extending from the second opening 113 to the other end of the through-hole 1200 are both substantially trapezoidal or trumpet-shaped. In some embodiments, the first sidewall 114 enclosing the microchamber 111 is substantially circular, elliptical, parabolic, hyperbolic, chevron-shaped, inclined, or has one or more of other cross-sectional profile shapes with two notches (i.e., the first opening 112 and the second opening 113). In some embodiments, the second sidewall 115 includes a step 1150 formed on the outer periphery of the first opening 112, which blocks the three-dimensional cell spheroids 600 that do not fall into the microchamber 111, so as to ensure that only one or a small number of three-dimensional cell spheroids 600 fall into the microchamber 111 and reduce the accumulation of the three-dimensional cell spheroids 600 in the microchamber 111.

[0073] In some embodiments, as Figure 8 , 9 shown, a microchamber array 110 surrounds the culture space of the microchamber array 1201 and is distributed in a substantially elongated shape, and is embedded in the Figure 8 , 9 cuboid. Thus, when three-dimensional cell spheroids or culture medium are injected into one end of the culture space 1201 in the cuboid 1202, the cells or the culture medium can fill the culture space 1201 and each microchamber 111, and the three-dimensional cell spheroids 600 can automatically fall into and remain in the microchamber 111.

[0074] In some embodiments, non-stick coatings are formed on the surfaces of the first sidewall 114 and the second sidewall 115. These coatings have ultra-low binding properties to cells, can avoid cell adhesion, and form a repulsive effect on cells. The materials of the non-stick coatings can be selected from perfluoropolymers, olefins, agarose, non-ionic hydrogels such as polyacrylamide, polyethers such as polyethylene oxide, polyols such as polyvinyl alcohol, or mixtures thereof.

[0075] In some embodiment modes, in the Figure 8 , 9 shown cuboid 1202, a microchamber array 110 is generally arranged, which includes a linear array, a diagonal array, a rectangular array, a circular array, etc. In some embodiments, as Figure 5 , 6As shown in FIGS. 9, a step 1150 is formed at the outer periphery of each first opening 112. In some embodiments, the step 1150 is adapted to the shape of the first opening 112 in the thickness direction of the first support member 122 and is slightly larger than the size of the first opening 112. For example, the size (first width 112a) of the first opening 112 is about 200 μm, and the maximum width dimension 1150a (e.g., diameter) of the step 1150 is 250 μm.

[0076] In some embodiments, the cell culture container 100 includes a plurality of microchamber arrays 110 stacked in the vertical direction. The second openings 113 of the upper microchambers 111 correspond to the first openings 112 of the lower microchambers 111 in the vertical direction. The multi-layer microchamber array 110 formed in this way can increase the cell culture volume and perform high-throughput three-dimensional culture. In these embodiments, the second support member 123 can cover the upper surface of the uppermost microchamber array 110 and the lower surface of the lowermost microchamber array 110, thus wrapping the multi-layer microchamber array 110 in the middle to form a culture space 1201 wrapping the multi-layer microchamber array 110. Such a setting can not only increase the culture volume of the three-dimensional cell spheres 600, but also facilitate injecting or expelling the three-dimensional cell spheres 600 and their culture solutions from the side of the cell culture container 100.

[0077] Furthermore, in some embodiments, the cell culture container 100 further includes a third support member 124. The third support member 124 is connected to the culture space 1201 and forms at least one inlet 130 and at least one outlet 140 for pouring in and / or pouring out cells and / or cell culture solutions into the culture space 1201.

[0078] In some embodiments, the third support member 124 is formed by extending from the outer peripheral edge of the first support member 122 and is hollow inside. Preferably, as Figure 7 shown, the third support member 124 extends from the outer peripheral edges of the two sides of the first support member 122 to form a hollow housing structure, and after being closed on both sides respectively, at least one inlet 130 and at least one outlet 140 are formed. The inlet 130 is bent vertically upward, and the outlet 140 is bent vertically downward. Preferably, as Figure 7 shown, the third support member 124 forms each substantially rectangular parallelepiped 1202 (substantially in the shape of a rectangular parallelepiped, as Figure 8 、 9The side peripheral edge of the one shown extends to form a hollow housing 1240, and is bent upward from one side thereof to form an inlet 130. The side peripheral edge of the other side extends to form another hollow housing, and is bent downward from the other side to form an outlet 140. Preferably, as shown in the figure, the third support member 124 extends from the side peripheral edge of one side of the first support member 122 to form a hollow housing 1240. The third support member 124 further includes partition cavities 1241 formed inside the hollow housing 1240 corresponding to the sides of each substantially rectangular parallelepiped 1202. Thus, when injecting or draining the three-dimensional cell spheres 600 or liquid into or from the third support member 124, these liquids can be evenly distributed from these partition cavities 1241 into the corresponding culture spaces 1201 of each substantially rectangular parallelepiped 1202, so as to facilitate uniformly injecting the liquid or the three-dimensional cell spheres 600 into the microchamber array 110 in the culture space 1201.

[0079] In this article, the first support member 122 and the third support member 124 in the cell culture container 100 can be integrally formed by a certain material, and the material includes but is not limited to polystyrene, polymethyl methacrylate, polyvinyl chloride, polycarbonate, polysulfone, polystyrene copolymer, fluoropolymer, polyester, polyamide, polystyrene-butadiene copolymer, fully hydrogenated styrenic polymer, polycarbonate-PDMS copolymer, and polyolefins such as polyethylene, polypropylene, polymethylpentene, polypropylene copolymer, and cycloolefin copolymer. In the drawings, the first support member 122, the second support member 123, and the third support member 124 are illustrated as being made of a clear (e.g., transparent) material. The first support member 122 and the third support member 124 can be first cast and molded, and then the second support member 122 made of a transparent or semi-transparent film material is adhesively bonded to form the cell culture container, so as to facilitate observing and photographing the cell culture state in the cell culture container 100.

[0080] The first opening 112, the second opening 113, the first side wall 114, the second side wall 115, the step 1150 and other microscopic cell culture surfaces of the microcavity array 110 can be combined with the wall of the cell culture container by, for example, gluing, laser etching, ultrasonic welding, 3D printing or some other method. For example, by irradiating and scanning in the thickness direction of a flat substrate (the precursor of the first support member 122), the substrate is laser-etched to form the culture space 1201 as shown above at equal intervals (for example, 5000 μm), then the step 1150 is formed, and then the regular microcavities 111 are formed by gradually scanning and laser-irradiating at the center of the step 1150, and finally the microcavities 111 are formed. Finally, the existing second support member 123 (for example, a transparent polypropylene template) is glued to the two surfaces of the first support member 122, thereby completing the construction process of the cell culture container 100. In this embodiment, when using a laser to form the first opening 112, the second opening 113, the first side wall 114, the second side wall 115, the step 1150 and other microscopic cell culture surfaces, a CO2 laser is used as the laser light source, and the laser is pulsed-irradiated at an output of 10 W and an irradiation speed of 6100 mm / min. In addition, by adjusting the irradiation conditions such as the irradiation position and output of the laser, the dimensions of the adjacent microscopic cell culture surfaces can be adjusted. For example, the first width 112a, the second width 113a, the thickness dimension 114a of the first side wall 114, the thickness dimension 115c of the second side wall 115, etc.

[0081] In addition, as Figure 10 , the embodiment of the present application also provides a cell culture device 800, which includes the cell culture container 100 provided in the above embodiment and at least two riser assemblies 200. Each riser assembly 200 has at least one connecting portion 201 for connecting the inlet 130 or the outlet 140 of the third support member 124 to the riser assembly 200. In some embodiments, the riser assembly 200 further includes a vertical tube cavity 202, and a plurality of connecting portions 201 are uniformly distributed along the vertical direction of the tube cavity 202, which is convenient for connecting and stacking a plurality of cell culture containers 100 between the two riser assemblies 200 to assemble a cell culture device 800. As Figure 10 shown, the cell culture device 800 may further include a pump 300, a valve 400 and a hose 500, so as to form a connected cell culture system with the cell culture container 100 and the riser assembly 200, and be able to continuously pour or pump out liquid into the cell culture container 100.

[0082] In some embodiments, as Figure 7, a tubular body is formed at both the inlet 130 and the outlet 140 by the third support member 124. The connecting portion 201 includes a plurality of connecting ports 203 uniformly formed in the vertical direction on the tube cavity 201. The tubular body formed at the inlet 130 or the outlet 140 is tightly connected through the sealing ring 404 and the connecting nut 405 that covers the connecting port 203 and the tubular body formed at the inlet 130 or the outlet 140, and at the same time, it is also convenient to disassemble the cell culture container 100.

[0083] In some embodiments, as Figure 11 , 12 shown, the valve 400 further includes a valve nut 401, a connecting sleeve 402, and a valve ball 403 provided on the connecting portion 201. The connecting sleeve 402 is in a sleeve shape, with external threads formed on the outer walls at both ends, and a valve space 4020 is formed on the inner wall, which can limit the valve ball 403 therein and enable the valve ball 403 to move along its central axis. And the diameter of the valve ball 403 is smaller than the radial diameter of the valve space 4020, so that when the valve ball 403 moves to the center of the valve space 4020, the pores between it and the inner wall of the valve space 4020 can allow liquid to flow. For example, protruding portions 4021 are formed at both ends on the inner wall of the connecting sleeve 4020 to limit the valve ball 403 in the valve space 4020. Among them, the valve ball 403 is made of a permanent magnet, and part or all of the valve nut 401 is made of a permanent magnet. The valve nut 401 is threadedly connected to the middle part of the outer wall of the connecting sleeve 402. The valve nut 401 makes the valve ball 403 move in the valve space 4020 through its magnetic repulsive interaction with the valve ball 403, such as abutting against the protruding portion 4021 to cut off the liquid flow.

[0084] In some embodiments, a plurality of cell culture containers 100 are connected to the riser assembly through the structure as Figure 10 or 11 shown, so that these cell culture containers 100 can be individually controlled. For example, cells or culture medium can be filled separately, which can make high-throughput cell culture more convenient. Also, during the culture process of other cell culture containers 100, a certain cell culture container 100 can be taken out from the cell culture device 800, which is convenient for activities such as cell collection, cell observation, and detection.

[0085] In addition, the embodiment of the present application also provides a method for culturing cells in the described cell culture container, including introducing a liquid containing cells and a culture medium into the cell culture chamber through the inlet 130; allowing the cells to settle to the microcavity 111 by gravity; and culturing the cells.

[0086] Below, the above-mentioned cell culture container 100 and cell culture device 800 will be used for culturing human placenta mesenchymal stem cells.

[0087] (Example 1)

[0088] By laser etching asFigure 2 The shown cell culture container 100 has the first width 112a of the first opening 112 sized at 250 μm, the second width 113a of the second opening 113 sized at 40 μm, the maximum width size 1150a of the step 1150 sized at 350 μm, and the thickness size 114a of the first sidewall 114 sized at 250 μm. The thickness size 115a of the second sidewall 115 extending from the first opening 112 to one end of the through hole 1200 is 1500 μm, and its width size 115b is 5000 μm. The thickness size 115c of the second sidewall 115 extending from the second opening 113 to the other end of the through hole 1200 is 2000 μm, and its width size 115d is 7000 μm.

[0089] Human umbilical cord mesenchymal stem cells were purchased from Wuhan Procell Life Science & Technology Co., Ltd., product number: CP-H204, specification: 5×10 5 Cells / T25 culture flask. They were cultured using a human mesenchymal stem cell serum-free medium (product number: CM-SC01, Wuhan Procell Life Science & Technology Co., Ltd.).

[0090] First, the cell solution in the T25 culture flask was poured into the culture space 1201 of the cell culture container 100 from the inlet 130 until liquid flowed out of the outlet 140. For example, the cell culture container 100, the riser pipe assembly 200, the pump 300, the valve 400, and the hose 500 can be assembled into a cell culture device 800 to facilitate aseptic filling. After the cell solution was poured in, the cell culture container 100 was placed on a horizontal tabletop and cultured in an environment of 95% air and 5% CO2. During this period, the fresh medium could be replaced every 2 - 3 days. After continuous culture for 8 days, the cells were harvested and the cell stemness was examined.

[0091] Among them, the cell stemness was evaluated by the expression level of its stemness transcription factors, and the expression levels of its stemness transcription factors Nanog, Sox2 and Oct4 were detected by RT-PCR method. It was carried out using the PrimeScriptTM RT reagent Kit (TransGen Biotech, Beijing). Among them, GAPDH was used as an internal reference, and the relative expression levels of genes in each group were calculated by 2-ΔΔCT. Each experiment was repeated 5 times. Among them, the primers for detecting GAPDH were F1: GGAAAGCTGTGGCGTGAT, shown in SEQ ID NO.1, and R1: AAGGTGGAAGAATGGGAGTT, shown in SEQ ID NO.2. The primers for detecting Nanog were F2: AAAGAATCTTCACCTATGCC, shown in SEQ ID NO.3, and R2: GAAGGAAGAGGAGAGACAGT, shown in SEQ ID NO.4. The primers for detecting Sox2 were F3: TTGCTGCCTCTTTAAGACTAGGA, shown in SEQ ID NO.5, and R3: CTGGGGCTCAAACTTCTCTC, shown in SEQ ID NO.6. The primers for detecting Oct4 were F4: CCCCTGGTGCCGTGAA, shown in SEQ ID NO.7, and R4: GCAAATTGCTCGAGTTCTTTCTG, shown in SEQ ID NO.8. The results are as Figure 13 shown, and the relative expression levels of Nanog, Sox2 and Oct4 are approximately 1650, 1200 and 93 respectively.

[0092] (Example 2)

[0093] By laser etching the cell culture container 100 as Figure 1 shown, the size of the first width 112a of the first opening 112 is 250 μm, the size of the second width 113a of the second opening 113 is 50 μm, the maximum width size of the step 1150 is 350 μm, and the depth size 114a of the first side wall 114 is 350 μm. The thickness size 115a of the second side wall 115 extending from the first opening 112 to one end of the through hole 1200 is 1000 μm, and its width size 115b is 5000 μm. The thickness size 115c of the second side wall 115 extending from the second opening 113 to the other end of the through hole 1200 is 1500 μm, and its width size 115d is 5000 μm.

[0094] Using this cell culture container 100 to assemble a cell culture device 800, the human placenta mesenchymal stem cells were cultured by the same method process as in Example 1, and the expression levels of cell stemness transcription factors were detected. The results are as Figure 13As shown, the relative expression levels of Nanog, Sox2, and Oct4 are approximately 1730, 116, and 106, respectively.

[0095] (Comparative Example 1)

[0096] The human placenta mesenchymal stem cells were cultured using the cell culture container as Figure 1 shown, and the expression levels of cell stemness transcription factors were detected. The results are as Figure 13 shown, and the relative expression levels of Nanog, Sox2, and Oct4 are approximately 175, 123, and 23, respectively.

[0097] (Comparative Example 2)

[0098] A cell culture container 100 was laser-etched as Figure 1 shown. The first width 112a of the first opening 112 was 250 μm, the second width 113a of the second opening 113 was 10 μm, the maximum width of the step 1150 was 350 μm, and the depth dimension 114a of the first sidewall 114 was 350 μm. The thickness dimension 115a of the second sidewall 115 extending from the first opening 112 to one end of the through hole 1200 was 1500 μm, and its width dimension 115b was 5000 μm. The thickness dimension 115c of the second sidewall 115 extending from the second opening 113 to the other end of the through hole 1200 was 2000 μm, and its width dimension 115d was 7000 μm.

[0099] The human placenta mesenchymal stem cells were cultured using the same method as in Example 1, and the expression levels of cell stemness transcription factors were detected. The results are as Figure 13 shown, and the relative expression levels of Nanog, Sox2, and Oct4 are approximately 206, 142, and 29, respectively.

[0100] (Comparative Example 3)

[0101] A cell culture container 100 was laser-etched as Figure 1 shown. The first width 112a of the first opening 112 was 250 μm, the second width 113a of the second opening 113 was 70 μm, the maximum width of the step 1150 was 350 μm, and the depth dimension 114a of the first sidewall 114 was 350 μm. The thickness dimension 115a of the second sidewall 115 extending from the first opening 112 to one end of the through hole 1200 was 1500 μm, and its width dimension 115b was 5000 μm. The thickness dimension 115c of the second sidewall 115 extending from the second opening 113 to the other end of the through hole 1200 was 2000 μm, and its width dimension 115d was 7000 μm.

[0102] The human placenta mesenchymal stem cells were cultured using the same method flow as in Example 1, and the expression levels of cell stemness transcription factors were detected. The results are as Figure 13 shown. The relative expression levels of Nanog, Sox2, and Oct4 were approximately 300, 260, and 37, respectively.

[0103] (Comparative Example 4)

[0104] The cell culture container 100 as shown in Figure 1 was laser-etched. The size of the first width 112a of the first opening 112 was 250 μm, the size of the second width 113a of the second opening 113 was 50 μm, the maximum width size of the step 1150 was 350 μm, and the depth size 114a of the first side wall 114 was 350 μm. The thickness size 115a of the second side wall 115 extending from the first opening 112 to one end of the through hole 1200 was 1000 μm, and its width size 115b was 5000 μm. The thickness size 115c of the second side wall 115 extending from the second opening 113 to the other end of the through hole 1200 was 1000 μm, and its width size 115d was 5000 μm.

[0105] The cell culture device 800 was assembled using the cell culture container 100. The human placenta mesenchymal stem cells were cultured using the same method flow as in Example 1, and the expression levels of cell stemness transcription factors were detected. The results are as Figure 13 shown. The relative expression levels of Nanog, Sox2, and Oct4 were approximately 1200, 704, and 58, respectively.

[0106] As described above, the above are only the preferred specific embodiments of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. A cell culture container, characterized in that, Comprising: At least one microchamber array having a plurality of microchambers, each microchamber having a first opening, a second opening, and a first sidewall extending between the first opening and the second opening. The first opening has a first width, and the second opening has a second width, with the first width being greater than the second width to confine cells within the microchamber. The size of the first width is from 100 μm to about 5000 μm, and the size of the second width is from 15 μm to about 50 μm; A substrate providing a structural basis for forming the microchamber array; An inlet providing an opening to the microchamber on one side of the cell culture container; An outlet providing an opening to the microchamber on the opposite side of the cell culture container; Wherein the substrate comprises: A first support member having a plurality of through-holes and two parallel surfaces. The through-holes penetrate through the two surfaces of the first support member to form the microchamber array. The first support member includes through-hole walls for enclosing the through-holes. The through-hole walls include the first sidewall and the second sidewall. The first sidewall extends and narrows from the first opening towards the second opening, and the second sidewall connects to the first sidewall. Non-stick coatings are formed on the surfaces of both the first sidewall and the second sidewall. The thickness dimension of the second sidewall extending from the second opening to the end of the through-hole is 1.5 - 2 times the thickness dimension of the second sidewall extending from the first opening to the end of the through-hole; A second support member connecting to the first support member and enclosing with the first support member to form at least one culture space. The second support member is made of a gas-permeable and liquid-impermeable material. The second support member seals both ends of the through-hole and forms a culture space within the through-hole, with the microchamber being wrapped within the culture space.

2. The cell culture container according to claim 1, characterized in that, A step is formed at the outer periphery of the first opening. The step adapts to the shape of the first opening in the thickness direction of the first support member, and the size of the step is greater than the size of the first opening.

3. The cell culture container according to claim 1, wherein Comprising a plurality of vertically stacked microchamber arrays, where the second opening of the upper microchamber corresponds vertically to the first opening of the lower microchamber.

4. The cell culture container according to claim 3, wherein Further comprising: a third support member connecting to the culture space and forming at least one of the inlet and at least one of the outlet for introducing and / or discharging cells and / or cell culture medium into the culture space.

5. The cell culture container according to claim 4, characterized in that, The third support member extends from the outer peripheral edge of the first support member and is hollow inside.

6. A cell culture device, characterized in that, Comprising: At least one cell culture container as claimed in any one of claims 1 - 5; And At least two riser pipe assemblies having at least one connecting portion for connecting the inlet and / or the outlet formed by the third support member to the riser pipe assemblies; and A pump, valves, and hoses, which together with the cell culture container and the riser pipe assemblies form a connected cell culture system; Wherein, the valve further includes a valve nut, a connecting sleeve and a valve ball disposed on the connecting portion. The connecting sleeve is in a sleeve shape, with external threads formed on the outer walls at both ends and a valve space formed on the inner wall to confine the valve ball therein and enable the valve ball to move along its central axis. Moreover, the diameter of the valve ball is smaller than the radial diameter of the valve space, such that when the valve ball moves to the center of the valve space, the pore formed between the valve ball and the inner wall of the valve space can allow liquid to flow through.

7. A three-dimensional culture method for human placenta mesenchymal stem cells, characterized in that, Cultured using the cell culture container according to any one of claims 1-5 or the cell culture device according to claim 6, the three-dimensional culture method includes: introducing a liquid containing cells and a culture medium into the cell culture chamber through the inlet; allowing the cells to settle into the microchambers; and culturing the cells.

Images