A method for constructing a glaucoma disease intervention model

By inhibiting MAdCAM expression in non-human target mammals, a glaucoma intervention disease model was constructed, which solved the problem of the inadequacy of existing models, reduced retinal ganglion cell damage and loss, and provided a new tool for glaucoma research.

CN116548384BActive Publication Date: 2026-02-13UNIV OF ELECTRONICS SCI & TECH OF CHINA
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310390499.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-04-12
Publication Date
2026-02-13
Estimated Expiration
2043-04-12

AI Technical Summary

Technical Problem

Most existing animal models of glaucoma are related to intraocular pressure, and there is a lack of models that can be used for glaucoma intervention research, resulting in insufficient research on the pathogenesis and treatment of the disease.

Method used

A glaucoma intervention model was constructed by suppressing or eliminating the expression of mucosal addressing cell adhesion molecule (MAdCAM) in non-human target mammals. A new animal model was obtained by inducing high intraocular pressure to reduce retinal ganglion cell damage and loss.

Benefits of technology

The constructed animal model of glaucoma showed reduced damage to retinal ganglion cells and decreased ganglion cell loss under high intraocular pressure, thus alleviating glaucoma symptoms and providing a research basis for the pathogenesis and intervention strategies of glaucoma.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116548384B_ABST
    Figure CN116548384B_ABST
Patent Text Reader

Abstract

The application discloses a method for constructing a glaucoma intervention disease model, and relates to the field of glaucoma research. The MAdCAM of a non-human target mammal is not expressed or is inhibited, and thus the animal model constructed does not itself show glaucoma phenotypes such as damage or loss of ganglion cells. A new glaucoma animal model can be obtained by inducing high intraocular pressure of the animal. Compared with a wild-type high intraocular pressure model, the new glaucoma animal model has reduced damage of retinal ganglion cells, and the loss of ganglion cells in different regions of the retina is obviously reduced, the glaucoma symptoms are relieved, and the glaucoma course is delayed. It is indicated that the model can be used for related research on glaucoma diseases, and especially provides an animal model basis and research reference for research on the pathogenesis and intervention strategies of glaucoma. In addition, the glaucoma intervention animal model provided by the application can be used for research on retinal ganglion cell nerve damage.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of glaucoma research, in particular, to a method for constructing a glaucoma intervention disease model. BACKGROUND

[0002] Glaucoma is a retinal neurodegenerative disease, mainly leading to chronic neurodegenerative changes of the optic nerve, such as retinal ganglion cell apoptosis, progressive loss of optic nerve axons, visual field defects, etc. It is the world's first irreversible blinding eye disease and one of the main causes of blindness worldwide. According to the latest report of WHO, there are about 95.4 million glaucoma patients in the world by 2030, of which the number of glaucoma patients in Asia is the largest, reaching 47 million. In the past five years, the number of glaucoma patients has not only increased, but also shown a trend of becoming younger.

[0003] The pathogenesis of glaucoma is not clear, although elevated intraocular pressure is generally considered to be the most important risk factor for glaucoma, but several non-intraocular pressure-related factors have also been confirmed to induce glaucoma and nerve damage. More and more literature suggests that metabolic factors, immune response, intestinal flora, etc. play an important role in the pathogenesis of glaucoma. However, it is not yet clear how these factors specifically regulate the pathogenesis of glaucoma and retinal neurodegenerative changes. However, in any case, retinal ganglion cell damage or loss is an important cause of glaucoma. Exploring the pathological mechanism of ganglion cell damage and the corresponding intervention means is of great significance to alleviate the disease progression of glaucoma patients.

[0004] At present, there is no effective treatment for ganglion cell loss in clinical practice, and reducing intraocular pressure through drugs and surgery is a necessary measure for the current treatment of glaucoma. However, simply reducing intraocular pressure cannot completely stop the progression of glaucoma. In clinical observation, the damage to retinal ganglion cells has not stopped after the intraocular pressure of some glaucoma patients has been reduced to normal. Therefore, more detailed pathogenesis research is still needed.

[0005] In the field of glaucoma research, animal models have become an important research tool. However, most existing animal models are related to intraocular pressure, and there are few glaucoma intervention animal models. Glaucoma intervention animal models can enrich people's understanding of the pathogenesis of glaucoma and treatment methods, and can verify the achievements made from multiple angles. At present, there is still a lack of relevant animal models that can be used for glaucoma intervention research.

[0006] In view of this, the present application is proposed. SUMMARY

[0007] The purpose of the present application is to provide a method for constructing a glaucoma intervention disease model that can be used for glaucoma intervention research, thereby filling the gap in existing glaucoma intervention animal models, so as to study the pathogenesis of glaucoma and intervention strategies.

[0008] The present application is implemented as follows:

[0009] In a first aspect, the present application provides a method for constructing a glaucoma intervention animal model, comprising the following steps: making a mucosal addressin cell adhesion molecule (MAdCAM) of a non-human target mammal not expressed or expressed in a suppressed manner.

[0010] The inventors found that making a mucosal addressin cell adhesion molecule (MAdCAM) of a non-human target mammal not expressed or expressed in a suppressed manner, the animal model thus constructed does not show glaucoma phenotypes such as damage or loss of ganglion cells, and a new glaucoma animal model can be obtained by inducing high intraocular pressure in the animal. Compared with a wild-type high intraocular pressure model, the new glaucoma animal model has reduced damage to retinal ganglion cells, significantly reduced loss of ganglion cells in different regions of the retina, alleviated glaucoma symptoms, and delayed glaucoma progression. It is indicated that the model can be used for related research on glaucoma, and in particular provides an animal model basis and research reference for research on the pathogenesis and intervention strategies of glaucoma. In addition, the glaucoma intervention animal model provided by the present application can be used for research on retinal ganglion cell nerve damage.

[0011] MAdCAM not expressed or expressed in a suppressed manner means that the protein encoded by the MAdCAM gene is functionally deficient (such as a frameshift mutation leading to a change in the structure and folding of the translated protein, resulting in reduced activity or functional deficiency), expression is blocked, etc.

[0012] In a preferred embodiment of the present application, the MAdCAM-1 gene of the non-human target mammal is made not to be expressed or expressed in a suppressed manner. For example, the MAdCAM-1 gene of the non-human target mammal is made not to be expressed by gene knockout; for example, the MAdCAM-1 gene of the non-human target mammal is made not to be expressed or expressed in a suppressed manner by gene silencing (RNAi) or hybridization of the non-human target mammal.

[0013] In a preferred embodiment of the present application, the MAdCAM-1 gene of the non-human target mammal is made not to be expressed or expressed in a suppressed manner by gene knockout and hybridization of the non-human target mammal.

[0014] In a preferred embodiment of the present application, the 2nd-5th exon of the MAdCAM-1 gene of the non-human target mammal is made not to be expressed or expressed in a suppressed manner by gene knockout and / or hybridization of the non-human target mammal.

[0015] The above-mentioned hybridization embodiments include but are not limited to hybridization of animals with the MAdCAM-1 gene knocked out or hybridization of animals with the gene knocked out with wild-type animals.

[0016] In a preferred embodiment of the application, the gene knockout is a complete gene knockout or a conditional gene knockout.

[0017] In a preferred embodiment of the application, the complete gene knockout is a knockout of the MAdCAM-1 gene using a positive-negative selection (PNS) method.

[0018] The conditional gene knockout is a knockout of the MAdCAM-1 gene using a CRISPR / Cas9 system and / or a Cre / loxp technique.

[0019] In a preferred embodiment of the application, when the CRISPR / Cas9 system is used to knockout the MAdCAM-1 gene, the sequence of the designed sgRNA is shown in SEQ ID NO. 1-2.

[0020]

[0021] In a preferred embodiment of the application, the non-human target mammal includes, but is not limited to, a mouse, a rat, a monkey, or a rabbit.

[0022] In one embodiment, the Cas9 mRNA and gRNA are obtained by in vitro transcription, and the Cas9 mRNA and gRNA are microinjected into the fertilized eggs of C57BL / 6J mice to obtain F0 mice. The positive F0 mice are identified by PCR amplification and sequencing, and the positive F0 mice are mated with C57BL / 6J mice to obtain positive F1 mice. The F1 mice are crossed, and the MAdCAM-1 knockout mice are screened and obtained.

[0023] In a second aspect, the application further provides a method for constructing a glaucoma disease model.

[0024] Compared with the wild-type high intraocular pressure model, the new glaucoma animal model constructed by the above method has reduced retinal ganglion cell damage, significantly reduced ganglion cell loss in different regions of the retina, relieved glaucoma symptoms, and delayed glaucoma progression. It is suggested that this model can be used for related research on glaucoma disease, especially to provide an animal model basis and research reference for the study of glaucoma pathogenesis and intervention strategies.

[0025] In a preferred embodiment of the application, the induction method is selected from the group consisting of: cauterizing the aqueous outflow vein on the scleral surface, injecting hypertonic saline into the suprachoroidal vein, and injecting microbeads (MB) into the anterior chamber (the microbeads are small spherical balls with a certain diameter, the microbeads used by the inventors are 15 pm fluorescent labeled microbeads, and 5*106 Microbeads / eye, so as to block the angle of the chamber, form high intraocular pressure glaucoma) or laser photocoagulation of the method of inducing the trabecular meshwork.

[0026] The glaucoma disease model provided by the application has the following phenotypes: reduced damage of retinal ganglion cells in different regions of the retina, reduced loss of retinal ganglion cells in different regions of the retina, or alleviated glaucoma symptoms.

[0027] The application has the following beneficial effects:

[0028] The inventors found that the mucosal addressin cell adhesion molecules of non-human target mammals are not expressed or are inhibited, and thus the animal model constructed does not itself exhibit glaucoma phenotypes such as damage or loss of ganglion cells. A new glaucoma animal model can be obtained by inducing high intraocular pressure in the animal. Compared with wild-type high intraocular pressure models, the newly constructed glaucoma animal model has reduced damage of retinal ganglion cells, significantly reduced loss of ganglion cells in different regions of the retina, alleviated glaucoma symptoms, and delayed glaucoma progression. It is indicated that the model can be used for related research on glaucoma diseases, and in particular provides an animal model basis and research reference for research on the pathogenesis and intervention strategies of glaucoma. In addition, the glaucoma intervention animal model provided by the application can be used for research on damage of retinal ganglion cells. BRIEF DESCRIPTION OF DRAWINGS

[0029] In order to more clearly illustrate the technical solutions of the embodiments of the application, the drawings needed in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some of the embodiments of the application, and therefore should not be considered as limiting the scope. For those skilled in the art, other related drawings can also be obtained without creative labor on the basis of these drawings.

[0030] Figure 1 The flow chart for constructing the animal model of MAdCAM-1 knockout mice and the PCR identification result chart;

[0031] Figure 2 The MAdCAM-1 gene fluorescence quantitative PCR result chart and the immunofluorescence result chart of wild-type mice, heterozygous mice, and MAdCAM-1 KO mice;

[0032] Figure 3 The MAdCAM-1 expression amount result chart of retinal vascular endothelial cells of the high intraocular pressure mouse model after Microbeeds (MB) induction;

[0033] Figure 4 The immunofluorescence staining result chart of superficial blood vessels (Superficial), intermediate blood vessels (Intermediate), and deep blood vessels (Deep);

[0034] Figure 5 Figure 8 is a graph showing the results of immunofluorescent staining of the retina of MAdCAM-1 KO mice;

[0035] Figure 6 Figure 9 is a graph showing the results of statistical analysis of the total ganglion cell mean, central zone ganglion cell mean, intermediate zone ganglion cell mean, and peripheral zone ganglion cell mean of the glaucoma model superimposed on MAdCAM-1 KO mice. DETAILED DESCRIPTION

[0036] Reference will now be made in detail to embodiments of the application, one or more examples of which are set forth below. Each example is provided as an explanation and not as a limitation of the application. Indeed, it will be apparent to one of ordinary skill in the art that numerous modifications and variations of the present application are possible in light of the above teachings. For example, features described or illustrated as part of one embodiment can be used with another embodiment to yield still a further embodiment. Thus, it is intended that the present application encompass such modifications and variations of the embodiments described.

[0037] Laboratory Manual, 2nd Ed. (Sambrook et al., 1989); Oligonucleotide Synthesis (M. J. Gait, ed., 1984); Animal Cell Culture (R. I. Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D. M. Weir and C. C. Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (J. M. Miller and M. P. Calos, eds., 1987); Current Protocols in Molecular Biology (F. M. Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (Mullis et al., eds., 1994); and Current Protocols in Immunology (J. E. Coligan et al., eds., 1991), each of which is expressly incorporated herein by reference.

[0038] In order to make the purposes, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be clearly and completely described below. If the specific conditions are not indicated in the embodiments, the conventional conditions or the conditions suggested by the manufacturers are adopted. If the manufacturers of the reagents or instruments are not indicated, the conventional products that can be purchased in the market are adopted.

[0039] The features and properties of the present application are further described in detail below in combination with the embodiments.

[0040] Example 1

[0041] This embodiment takes mice as target animals as an example to illustrate the construction method of the glaucoma intervention animal model provided by the application. The specific model construction method is as follows.

[0042] 1. This embodiment uses CRISPR / Cas9 technology to cause a frame shift of Madcam1 gene protein reading frame and function loss by using a non-homologous recombination repair method to introduce mutations.

[0043] The construction process of the MAdCAM-1 knockout mouse is as follows: Cas9 mRNA and gRNA are obtained by in vitro transcription; the sequence of sgRNA is shown as SEQ ID NO. 1-2.

[0044]

[0045] Cas9 mRNA and gRNA are microinjected into fertilized eggs of C57BL / 6J mice to obtain F0 generation mice. PCR amplification and sequencing are used to identify positive F0 generation mice, which are mated with C57BL / 6J mice to obtain positive F1 generation mice. The F1 generation mice are crossed to obtain MAdCAM-1 knockout mice (referred to as MAdCAM-1 KO), and the flow chart of gene knockout is shown in Figure 1 A.

[0046] 2. Genotype identification is performed on the MAdCAM-1 knockout mouse constructed above.

[0047] (1) Disinfect the surface of the mouse with 75% alcohol, cut off a piece of mouse tail or toe about 2-3 mm, and put it into a 1.5 ml EP tube.

[0048] (2) Add 50 μl of NaOH-EDTA (40 mM) buffer to the EP tube, and place it in a 95℃ metal bath for 60 min. Shake the centrifuge tube every half hour to ensure that the tissue is immersed in the buffer.

[0049] (3) After the tissue is dispersed and evenly distributed in the solution, add 50 μl of Tris-HCl (pH = 8.0, 40 mM) buffer to the EP tube, and mix to stop the lysis.

[0050] (4) Centrifuge at 10,000 rpm for 1 min, and the unlysed tissue will settle at the bottom of the tube. The supernatant is used as the template for PCR reaction. The PCR reaction system is as follows:

[0051] ddH2O 6 μl 2 x Rapid Taq Master Mix 10 μl Forward primer 1 μl Reverse primer 1 μl Sample supernatant 3 μl

[0052] (5) Mix the sample evenly, centrifuge slightly, and place it in a PCR instrument. The program settings are as follows:

[0053]

[0054] (6) Weigh 2g of Agarose powder on an electronic balance, add to 100ml of 1xTAE to make a 2% Agarose solution.

[0055] (7) Heat in a microwave oven for 3-5 minutes, after complete dissolution, remove and cool to about 70 degrees.

[0056] (8) Add 5μl of Goldview dye, mix well.

[0057] (9) Pour the Agarose into the prepared gel plate, cool at room temperature for 20-30 minutes.

[0058] (10) After the Agarose solution is completely solidified, remove and place in a horizontal electrophoresis apparatus filled with 1xTAE, with the sample well facing the negative electrode.

[0059] (11) Add 10μl of PCR product to each sample well, run at a constant voltage of 120V for 30 minutes.

[0060] (12) Place the gel in a gel imaging system to image, take a photograph, and save.

[0061] The genotype of the MAdCAM-1 knockout mice was identified using the following primers.

[0062] The identification primers used in the identification process are as follows:

[0063] Primer Sequence (5'→ 3') Primer type P1 AGCTGCCGGCCCACTCTT Forward P2 GGCATCCATACCGCTCTT Reverse P3 AGCTGCCGGCCCACTCTT Forward P4 GGGCCTCACCATACACAA Reverse

[0064] Wild type: primers P1 and P2 PCR obtain a single 4225bp fragment; P3 and P4 can obtain a 641bp fragment;

[0065] Heterozygote: P1 and P2 PCR obtain two fragments of 640bp and 4225bp; P3 and P4 can obtain a 641bp fragment;

[0066] Homozygote: P1 and P2 PCR obtain a single 640bp fragment; P3 and P4 cannot obtain a band, the results are shown in Figure 1 B.

[0067] Figure 1 The results show (in the figure: WT represents wild type mice, Het represents MAdCAM-1 gene heterozygous mice, KO represents MAdCAM-1 gene homozygous mice). Thus, MAdcMA-1 gene knockout homozygous mice are obtained.

[0068] Example 2

[0069] This example verifies the RNA and protein expression of MAdCAM-1 gene in the MAdCAM-1 KO mice constructed in Example 1 by real-time fluorescent quantitative PCR and immunofluorescence staining (IF), respectively.

[0070] 1. Real-time fluorescent quantitative PCR:

[0071] ① The mice were intraperitoneally injected with 10% chloral hydrate, and then executed by cervical dislocation after the mice were unconscious. A small piece of colon was taken out, and the excess tissue was removed and placed in Trizol. The tissue was homogenized twice for 1 min each time using a homogenizer. Then, the sample was shaken on a shaker at room temperature for 15 min.

[0072] ②Chloroform was added at a volume of 1 / 5 times that of Trizol, and vortexed for 2-3 times. After standing at room temperature for 20 min, the sample was centrifuged at 4°C for 15-20 min when it was layered.

[0073] ③ The supernatant was taken into a new centrifuge tube, and an equal volume of isopropanol was added. The mixture was mixed gently and inverted, and then placed at -20°C for 30 min.

[0074] ④ The sample was centrifuged at 4°C for 30 min. The supernatant was discarded, and 1 ml of anhydrous ethanol was added and the tube was gently tapped to rinse.

[0075] ⑤ The sample was centrifuged at 4°C for 10 min. The supernatant was discarded, and 75% anhydrous ethanol was added.

[0076] ⑥ The liquid was discarded, and the water droplets on the inner wall of the tube were absorbed with a syringe tip. The sample was dried at room temperature for 5-10 min. When the white precipitate began to become transparent, 30-50 ul of DEPC water was added for dissolution.

[0077] ⑦ RNA quality and concentration determination: The concentration of RNA was determined using DL2000 software. A 1% agarose gel was prepared, 1 ul of RNA was mixed with 5 ul of 6x loading buffer, and an appropriate amount of the mixture was subjected to electrophoresis. After electrophoresis, the gel was imaged on a gel imager to determine the quality of the RNA.

[0078] ⑧ The reverse transcription reaction system was as follows:

[0079]

[0080]

[0081] The reverse transcription was performed at 42°C for 15 min and at 85°C for 5 s.

[0082] ⑨ The reaction system for fluorescent quantitative PCR was as follows:

[0083]

[0084] The primers for fluorescent quantitative PCR are as follows:

[0085] Primer Sequence (5'→ 3') Primer-F CCTGGCCCTAGTACCCTACC Primer-R CCGTACAGAGAGGATACTGCTG

[0086] The machine program is as follows:

[0087]

[0088] The fluorescent quantitative PCR results are shown in Figure 2 , in which WT represents wild type mice, Het represents MAdCAM-1 knockout heterozygous mice, and KO represents MAdCAM-1 KO mice. Figure 2 A shows that the RNA level of MAdCAM-1 gene in KO mice is specifically knocked out;

[0089] 2. Immunofluorescence staining:

[0090] (1) The mice were sacrificed by cervical dislocation, the mouse skin was treated with 75% alcohol, the peritoneum was opened, and the mouse colon was separated by cutting along the lower end of the mouse colon and the upper end of the ileocecal junction. A tissue block of about 3mm was cut along the lower end of the colon and placed in sterilized PBS for rinsing.

[0091] (2) The above tissue was fixed in 4% PFA, and the volume of the fixing solution was much larger than that of the tissue block. It was placed in a 4°C refrigerator for 48h.

[0092] (3) The fixed specimen was rinsed with 1xPBS for three times, 5 minutes each time.

[0093] (4) The rinsed tissue was placed in a 2ml EP tube containing 30% sucrose solution, and dehydrated on a 4°C shaking table for 24h. If the tissue block has completely sunk to the bottom of the tube, it means that the dehydration is complete.

[0094] (5) The dehydrated tissue block was taken out and placed in a dish, the surrounding sucrose solution was absorbed, OCT was dropped on the tissue block, and the inside of the intestinal cavity was repeatedly washed with it to expel the sucrose solution and moisture in the cavity. The tissue block was moved into an embedding box containing OCT, the position of the tissue block was adjusted, and it was placed in a-80°C refrigerator.

[0095] (6) The tissue was cut along the longitudinal axis of the intestine, and the section was adhered to a glass slide for subsequent immunofluorescence staining.

[0096] (7) The section was placed in a 60-degree oven, and the section was washed for 30min to remove excess OCT; then the blocking solution was blocked for 2 hours.

[0097] (8) The blocking solution was removed, and the prepared primary antibody (MAdCAM-1 antibody here) solution was added, and the staining was carried out at 4 degrees overnight.

[0098] (9) PBS wash away the primary antibody, 10 min once, a total of three times; then add the prepared secondary antibody solution, room temperature staining for 2 hours.

[0099] (10) PBS wash away the secondary antibody, 10 min once, a total of three times; remove the excess water around the tissue, drop the mounting medium, cover the cover glass. Observe and take pictures under confocal.

[0100] Results are shown in Figure 2 , in which WT represents wild-type mice, Het represents MAdCAM-1 knockout heterozygous mice, and KO represents MAdCAM-1 KO mice. Figure 2 B shows that the MAdCAM-1 protein level in KO mice is very low, indicating that the MAdCAM-1 gene is specifically knocked out.

[0101] The experimental results of this example prove that the MAdCAM-1 KO mouse model with the target genotype is successfully constructed in Example 1.

[0102] Example 3

[0103] This example provides a method for constructing a glaucoma disease model, which uses microbead injection to induce the MAdCAM-1 KO mouse model of Example 1 to have high intraocular pressure, thereby obtaining a glaucoma disease model.

[0104] Establishment of a microbead anterior chamber injection-induced glaucoma model:

[0105] (1) Measure the baseline intraocular pressure of both eyes and record it.

[0106] (2) Anesthetize the mice: anesthetize the mice by intraperitoneal injection of 1% sodium pentobarbital, and place them on the operating microscope operating table after they are deeply anesthetized.

[0107] (3) Apply topical anesthetic to the corneal surface, and after the anesthetic takes effect, fix the eyeball and use a microsyringe to aspirate 1-2 μl of microbeads (5*10 6 / eye, mixed evenly) and carefully inject them into the anterior chamber to avoid damaging the iris.

[0108] (4) Slowly push the microbeads into the anterior chamber to make them evenly dispersed and sink to the angle, and slowly withdraw the injection needle.

[0109] (5) Apply antibiotic ointment to the cornea, and be careful to move gently to avoid pressing on the anterior chamber and causing the microbeads to flow out.

[0110] (6) After the operation is completed, place the mice in a heated recovery box until they wake up and then return them to the feeding cage.

[0111] The control group was injected with the same volume of sterile PBS, and the rest of the operations were consistent.

[0112] Experimental Example 1

[0113] The method of constructing the glaucoma disease model according to the construction of Example 3 adopts microbead injection to induce wild-type mice to construct a high intraocular pressure mouse model for glaucoma mechanism and intervention research.

[0114] MAdCAM-1 is highly expressed in the mouse retina of the MB-induced high intraocular pressure mouse model.

[0115] At 37 days after MB induction, the mice were executed by cervical dislocation, the eyeballs were taken out, the corneas were cut open, and the eyeballs were fixed after adding a fixing solution, and then the eyeballs were unfolded into a clover shape. Isolectin was used to label the retinal blood vessels, and MAdCAM-1 antibody staining was performed at the same time.

[0116] The steps of retinal flat preparation and immunofluorescence staining are as follows:

[0117] (1) After the mice were executed by cervical dislocation, the eyeballs were taken out.

[0118] (2) The eyeballs were washed several times with PBS buffer, and then were fixed in 4% paraformaldehyde for about 5-10 min.

[0119] (3) Then, a hole was punched in the center of the cornea under a microscope, and a "V" shape was cut with a microscopical scissors, and the fixation was continued at 4°C for 30 min.

[0120] (4) The fixed eyeball was taken out and washed in PBS buffer for 10 min.

[0121] (5) Under a microscope, the bottom of the "V" shape was clamped with a sharp forceps, the cornea part was carefully cut along the limbus, then one hand fixed the eyeball by clamping the optic nerve with the forceps, and the other hand inserted the sharp forceps into the eyeball to quickly clamp out the lens.

[0122] (6) The retina was gently separated from the back part, a small hole was cut at different positions with a microscopical scissors to facilitate the peeling of the retina, then the retina was slowly squeezed out of the eye cup, and tools were avoided to contact the retina as much as possible. A small hole was cut at the corresponding position on the nasal side as a marker. The hole was cut to 1 / 2 length in the direction of the optic disc at 45° left and right of the marker position, and then the hole was cut to 1 / 2 at 90° outside the two openings, and the retina was slowly unfolded.

[0123] (7) Cold methanol was added to the unfolded retina to make it shape, and the retina was placed in a centrifugal tube containing methanol for fixation.

[0124] (8) The flat sheet was placed in the small holes of a 48-well plate, washed with PBS three times to remove methanol, then blocked with 5% NDS (containing 0.25% Triton) for 2 h, and the first antibody was incubated overnight at 4°C. The next day, the flat sheet was washed with PBS three times, the corresponding second antibody was incubated at room temperature for 2 h, then washed with PBS three times, and the flat sheet was sealed and observed for photography.

[0125] Figure 3 The results show that, at 37 days, the retinal vascular endothelial cells of the MB mice highly express MAdCAM-1, and the number of blood vessels increases by more than ten times compared with the control group of mice (MAdCAM-1 + (MAdCAM-1 + is the high expression of madcam caused by the modeling of wild-type mice) blood vessels. Figure 3

[0126] The blood vessels in the mouse retina have three layers, namely superficial blood vessels (Superficial), intermediate blood vessels (Intermediate), and deep blood vessels (Deep), among which the MAdCAM-1 coverage of the superficial blood vessels is higher, followed by the deep blood vessels. Figure 4

[0127] Experimental Example 2

[0128] In order to determine whether the retinal and even ganglion cells of the MAdCAM-1 KO mice constructed in Example 1 are damaged, the retinal sections of the knockout mice were subjected to immunofluorescence staining (Immunohistochemistry, IHC) in this experimental example.

[0129] The immunohistochemical method of the retinal section is as follows:

[0130] After the mice were executed by cervical dislocation, the eyeballs were quickly taken and placed in 4% PFA, fixed on ice for 15 min, then a hole was cut on the cornea, and then continued to be fixed on ice. After 2 h, the eyeballs were washed with PBS buffer for 3 times, and then placed in a 30% sucrose solution for 2 h, then the cornea and lens were cut off under a dissecting microscope, and OCT embedding was performed and quickly placed in a-80℃ refrigerator. After about 10 min, the OCT-embedded eyeball was taken out and placed in a cryostat at-25℃ for about 30 min before sectioning. The section thickness was 12 μm.

[0131] After the sectioning was completed, the high-quality slices were selected and placed in a 37℃ oven for 30 min, then the immunohistochemical pen was used to draw a circle on the retinal tissue, and then PBS was used to wash three times to remove OCT, then 5% NDS (containing 0.25% Triton) was used for blocking and permeation for 2 h, and the first antibody was incubated overnight at 4℃. The next day, after washing with PBS for two times, the corresponding fluorescent secondary antibody was incubated, then PBS was washed for two times, the slice was sealed, and then observed.

[0132] The experimental results show that the retinal structure of the knockout mice is complete, and there is no obvious damage to the neurons in each layer Figure 5 A, in the figure: WT refers to the wild-type control, KO refers to the MAdCAM-1 knockout homozygous mouse; RGL refers to the ganglion cell layer, INL refers to the inner nuclear layer, and ONL refers to the outer nuclear layer).​​

[0133] To further detect whether the ganglion cells related to glaucoma are damaged, the experiment example cuts 0.1 mm 2 square area, and counts the ganglion cell loss of the retinal smear of the knockout mouse. As shown in Fig. 2B, the results show that the average of the ganglion cells in the central region, the middle region or the edge region of the KO mouse retinas, or the total average of the smear ganglion cells, is not significantly reduced Figure 5 Figure 5 C: Avg: total average of smear ganglion cells; Center: average of ganglion cells in the central region; Mid-Periph: average of ganglion cells in the middle region; Periph: average of ganglion cells in the edge region; Brn3a is a ganglion cell marker protein.

[0134] As can be seen from the above, the MAdCAM-1 KO mouse constructed in the example has normal retinal structure, and no obvious loss of ganglion cells Figure 5 The retinal structure is complete, and the ganglion cells are not obviously damaged.

[0135] Experiment Example 3

[0136] The above proves that the MAdCAM-1 KO mouse itself does not have ganglion cell damage, so the experiment example uses the MAdCAM-1 KO mouse constructed in Example 3 to superimpose the MB glaucoma model (i.e. glaucoma disease model) to observe the ganglion cell damage.

[0137] The immunohistochemical method of the retinal section is the same as that of Example 2. Compared with the MB model of the wild-type mouse, the ganglion cell damage of the MAdCAM-1 KO mouse superimposed with MB is obviously relieved. After statistics, the total average of the ganglion cells, the average of the ganglion cells in the central region, the average of the ganglion cells in the middle region, and the average of the ganglion cells in the edge region of the MAdCAM-1 KO mouse are significantly reduced Figure 6 .

[0138] The above experimental results show that the MAdCAM-1 KO mouse constructed in Example 3 superimposed with the MB glaucoma model (i.e. glaucoma disease model) can relieve the ganglion cell damage.

[0139] In summary, the MAdCAM-1 gene knockout mouse model is constructed for the first time in the present application, and the animal model shows the typical characteristics of glaucoma intervention: the ganglion cell loss in different regions of the retinal induced by the mouse is significantly reduced, the glaucoma symptoms are relieved, which indicates that the model can be used for the research of glaucoma disease, and provides a basis for the exploration of the pathological mechanism and intervention strategy.

[0140] ​The above merely provides the preferred embodiments of the present application, and is not used to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the principles and technical scope of the present application shall fall into the scope of the present application.

Claims

1. A method for constructing a glaucoma intervention disease model, characterized in that, This includes methods such as gene knockout, gene silencing, or mouse hybridization to suppress or prevent the expression of the MAdCAM-1 gene in mice.

2. The method for constructing a glaucoma intervention disease model according to claim 1, characterized in that, Gene knockout and / or mouse hybridization can be used to suppress or eliminate the expression of exons 2-5 of the MAdCAM-1 gene in mice.

3. The method for constructing a glaucoma intervention disease model according to claim 2, characterized in that, The gene knockout is either a complete gene knockout or a conditional gene knockout.

4. The method for constructing a glaucoma intervention disease model according to claim 3, characterized in that, The complete gene knockout is performed by knocking out the MAdCAM-1 gene using a positive-negative selection method; The conditional gene knockout is performed by knocking out the MAdCAM-1 gene using the CRISPR / Cas9 system and / or Cre / loxp technology.

5. The method for constructing a glaucoma intervention disease model according to claim 4, characterized in that, When knocking out the MAdCAM-1 gene using the CRISPR / Cas9 system, the sequence of the designed sgRNA is shown in SEQ ID NO.1-2.

6. A method for constructing a glaucoma disease model, characterized in that, The glaucoma intervention disease model constructed by the method of any one of claims 1-5 induces high intraocular pressure in the glaucoma intervention disease model.

7. The method for constructing a glaucoma disease model according to claim 6, characterized in that, The glaucoma disease model exhibits the following phenotypes: reduced ganglion cell damage in different regions of the retina, reduced ganglion cell loss in different regions of the retina, or relief of glaucoma symptoms.

Citation Information

Patent Citations

  • Application of CD146 as medicine target for preventing and / or treating ischemic eye diseases

    CN104288764A

  • Method for treating oculopathy

    CN104857526A