A composition, its preparation method, preparation and application

Abstract

The present invention relates to the field of biological agents, and specifically, to a composition, a preparation method thereof, a preparation and an application. The composition of the present invention contains a plasmid for inhibiting the expression of matrix metalloproteinase and a vector for delivering the plasmid into skin cells; the plasmid and the vector combine to form nanoparticles; the vector is preferably a chitosan transdermal vector. The composition of the present invention can deliver the plasmid into skin cells by means of skin application, and the plasmid is expressed in skin dermal cells and achieves the purpose of protecting skin collagen and resisting photoaging by inhibiting the expression and translation of matrix metalloproteinase protein.

Description

Technical Field

[0001] The present invention relates to the field of biological agents, and more specifically, to a composition, a preparation method thereof, a preparation and an application thereof. Background Art

[0002] The physiological structures for transdermal absorption of cosmetics mainly include the stratum corneum, hair follicles, sebaceous glands and sweat duct orifices. The penetration pathways through the stratum corneum can be divided into two types: ① Intercellular pathway: Chemical substances bypass the keratinocytes and penetrate into the subcutaneous layer through the continuously distributed intercellular matrix between the keratinocytes; ② Transcellular pathway: Chemical substances directly pass through the keratinocytes and the intercellular matrix, and alternately diffuse in the aqueous and lipid phases. The transdermal pathway by which chemical substances directly enter the dermis layer through skin appendages such as hair follicles, sebaceous glands and sweat duct orifices is also called the bypass pathway. Macromolecular substances and ionic substances are difficult to pass through the lipid-rich stratum corneum and may enter the skin through this pathway.

[0003] A plasmid is an extrachromosomal (or nucleoid) DNA molecule in organisms such as bacteria, yeasts and actinomycetes, which exists in the cytoplasm (except for yeasts, where the 2μm plasmid of yeasts exists in the nucleus). It has the ability of autonomous replication, enabling it to maintain a constant copy number in daughter cells and express the genetic information it carries. It is a closed circular double-stranded DNA molecule. A plasmid is not an essential substance for the growth and reproduction of bacteria and can be lost spontaneously or eliminated by artificial treatment, such as high temperature, ultraviolet light, etc. The genetic information carried by the plasmid can endow the host bacteria with certain biological characteristics, which is beneficial for the bacteria to survive under specific environmental conditions.

[0004] miRNA genes are usually transcribed in the nucleus by RNA polymerase II (pol II). The initial product is a large pri-miRNA with a cap structure (7MGpppG) and a polyadenylate tail (AAAAA). The pri-miRNA is processed into a pre-miRNA consisting of 70 nucleotides under the action of the nuclease Drosha and its cofactor Pasha. RNA-GTP and exportin 5 transport the pre-miRNA into the cytoplasm. Subsequently, another nuclease Dicer cleaves it to generate an miRNA:miRNA duplex with a length of about 22 nucleotides. This duplex is quickly guided into the RNA-induced silencing complex (RISC) complex, and one mature single-stranded miRNA remains in this complex. The mature miRNA binds to the site of its complementary mRNA to regulate gene expression through base pairing.

[0005] There is currently no relevant report on the combination of plasmids and transdermal systems. In view of this, the present invention is specifically proposed. Summary of the Invention

[0006] The primary object of the present invention is to provide a composition which has the effect of inhibiting and / or delaying skin aging.

[0007] The second object of the present invention is to provide a preparation method of the composition.

[0008] The third object of the present invention is to provide a preparation of the composition.

[0009] The fourth object of the present invention is to provide the application of the composition in the preparation of a drug or skin care product for inhibiting and / or delaying skin aging.

[0010] In order to achieve the object of the present invention, the technical solution adopted is as follows:

[0011] The present invention provides a composition which contains a plasmid for inhibiting the expression of matrix metalloproteinase and a carrier for delivering the plasmid into skin cells; the plasmid and the carrier are combined to obtain nanoparticles; preferably, the carrier is selected from chitosan transdermal carriers, and the skin cells are more preferably skin dermal cells.

[0012] Optionally, the plasmid is used to inhibit the expression of MMP1 or MMP1a; preferably, the nucleotide sequence length of the target fragment in the plasmid is 20-25 bases; more preferably, the nucleotide sequence of the target fragment is a nucleotide sequence having 80% homology with SEQ ID NO:1.

[0013] Optionally, the chitosan transdermal carrier contains at least one of chitosan, sodium sulfate, acetic acid or its salt, a pH regulator and a solvent; more preferably, the mass ratio of the plasmid to chitosan is 1:0.1-10, preferably 1:0.5-2; the deacetylation degree of chitosan is 80%-95%.

[0014] Optionally, the concentration of chitosan in the chitosan transdermal carrier is 0.001%-0.01%, preferably 0.01%; more preferably, the pH value of the chitosan transdermal carrier is 5-5.8, preferably 5.5; even more preferably, the average particle size of the nanoparticles is 100-200nm.

[0015] The present invention also relates to a preparation method of the above composition, which at least includes the following steps:

[0016] S1. Prepare a plasmid for inhibiting the expression of matrix metalloproteinase;

[0017] S2. Prepare a chitosan solution and a plasmid solution respectively, and heat them to 50-60°C respectively;

[0018] Preferably, the preparation method of the chitosan solution includes: preparing a solution with a mass percentage concentration of 0.01% - 0.05%, preferably 0.02%, by using chitosan and sodium acetate solution, and adjusting the pH to 5 - 6, preferably 5.5;

[0019] More preferably, the preparation method of the plasmid solution includes: dissolving the plasmid with sodium sulfate solution to prepare a solution with a mass percentage concentration of 50 - 500 μg / mL, preferably 100 - 200 μg / mL;

[0020] S3. Mix equal volumes of the chitosan solution and the plasmid solution to obtain the solution of the nanoparticles.

[0021] Optionally, in S2, the concentration of the sodium acetate solution is 0.4 - 0.6 mol / L, preferably 0.5 mol / L; the concentration of the sodium sulfate solution is 4 - 6 mmol / L, preferably 5 mmol / L.

[0022] Optionally, in S2, the heating is to place the chitosan solution and the plasmid solution in different containers and perform a water bath at 50 - 60 °C for 5 - 15 min; preferably, perform a water bath at 55 °C for 10 min.

[0023] Optionally, in S3, the mixing is to perform oscillation on a vortex shaker for 15 - 30 seconds.

[0024] The present invention also relates to a preparation containing the above composition, and the preparation is a liquid preparation or a freeze-dried preparation.

[0025] The present invention also relates to the application of the above composition in the preparation of a drug or skin care product for inhibiting and / or delaying skin aging, or protecting skin collagen; preferably, the aging is photoaging.

[0026] The present invention has at least the following beneficial effects:

[0027] The composition of the present invention contains a plasmid for inhibiting the expression of matrix metalloproteinase and a carrier for delivering the plasmid into skin cells, so that the plasmid can be delivered into skin cells by skin application. The plasmid is expressed in skin dermal cells and protects skin collagen and resists photoaging by inhibiting the expression and translation of matrix metalloproteinase protein.

[0028] In the preferred technical solution, the carrier system selects a chitosan transdermal carrier system. The advantages of this carrier system are: chitosan is the only natural cationic polysaccharide existing in nature, with good biocompatibility, biodegradability, low toxicity, no irritation, no sensitization, no antigenicity, and can form a polyelectrolyte polymer with DNA and adsorb on the cell surface to improve the targeting and slow-release DNA. Description of the Drawings

[0029] Figure 1 Schematic diagram of the in - cell expression of the target fragment sequence

[0030] Figure 2 Result graph of gel electrophoresis, where: 1 is Maker, 2 is chitosan solution, 3 is plasmid DNA, 4 is chitosan - DNA nanoparticle solution, 5 is the precipitate of chitosan - DNA nanoparticle solution, 6 is the supernatant of chitosan - DNA nanoparticle solution, 7 is Maker

[0031] Figure 3 Photographs of the appearance of mouse skin in animal experiments

[0032] Figure 4 Results of HE staining

[0033] Figure 5 Results of immunohistochemistry

[0034] In Figures 3 - 5 Group 1: NC - blank control, Group 2: UVB - mock - photoaging model control, Group 3: UVB - CS - applying chitosan solution to photoaging model, Group 4: UVB - miMMP1aplasmid - applying plasmid solution to photoaging model, Group 5: applying composition solution to photoaging model

[0035] Figure 6 And Figure 7 Results of q - PCR Detailed implementation manners

[0036] It should be noted that the following detailed description is exemplary and is intended to provide further illustration of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs

[0037] It should be noted that the terms used herein are only for describing specific implementation manners and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form also includes the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof

[0038] The technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention

[0039] An embodiment of the present invention provides a composition, which contains a plasmid for inhibiting the expression of MMP-1 (matrix metalloproteinase-1) and a vector for delivering the plasmid into skin cells. This gene is called MMP1 in the human genome, but there are two subtypes, MMP1a and MMP1b, in the murine gene, and MMP1a is homologous to human MMP1. The plasmid can be designed as a vector carrying the corresponding subtype gene according to the different objects to be administered. MMP (matrix metalloproteinase) can degrade a variety of extracellular matrices, and MMP-1 mainly acts on collagen, reducing the collagen content. Under normal circumstances, the positive rate of MMP-1 is very low, and ultraviolet rays can cause skin tissue aging by inducing the expression of MMP-1. Therefore, inhibiting the expression of MMP-1 (matrix metalloproteinase-1) can inhibit skin aging caused by ultraviolet rays and protect skin collagen. In the composition of the embodiment of the present invention, the plasmid and the vector combine to form nanoparticles; the particle size of the nanoparticles is 100-200 nm. Encapsulating the plasmid into nanoparticles can protect the plasmid from being degraded by enzymes in tissues; the DNA nanoparticles formed by binding with chitosan can adsorb electrostatically on the cell surface and slowly release DNA into the cells. Further optionally, the plasmid is used to inhibit the expression of MMP1 or MMP1a.

[0040] Through screening, the embodiment of the present invention determines that the target gene sequence in the above plasmid is as shown in SEQ ID NO:1, which inhibits the translation of the mRNA of the MMP1a gene in mouse cells into protein, playing a role in downregulating gene expression. The nucleotide sequence length of the target fragment in the plasmid is 20-25 bases, and the target fragment is a miRNA sequence for base complementary pairing with the target gene; the nucleotide sequence of the target fragment is a nucleotide sequence having 80% homology with SEQ ID NO:1, further preferably a nucleotide sequence having 85% homology with SEQ ID NO:1, more preferably a nucleotide sequence having 90% homology with SEQ ID NO:1, and most preferably a nucleotide sequence having 90% homology with SEQ ID NO:1. The miRNA sequences of different species will have several base changes, which are all within the protection scope of the present invention. The plasmid can be prepared by using commonly used plasmids in the art, and specifically, it can be selected from pcDNA3.1.

[0041] The nucleotide sequence of SEQ ID NO:1 is:

[0042] TGGAGGCTTGCTGAAGGCTGTATGCTG TTGTTCTATGTTACGGCTCAT GTTTTGGCCACTGACTGAC AT GAGCCGACATAGAACAA CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCC

[0043] In a preferred embodiment of the present invention, the carrier can be selected from chitosan transdermal carriers. Chitosan is the only natural cationic polysaccharide existing in nature, having good biocompatibility, biodegradability, low toxicity, no irritation, no sensitization, no antigenicity, and can form a polyelectrolyte polymer with DNA and adsorb on the cell surface to improve the targeting property and slowly release DNA.

[0044] In a preferred embodiment of the present invention, the chitosan transdermal carrier contains at least one of chitosan, sodium sulfate, acetic acid or its salt, a pH regulator and a solvent; wherein the role of acetic acid or its salt is to dissolve chitosan, and the acetate is preferably a monovalent salt of acetic acid, more preferably sodium acetate or potassium acetate. The role of the pH regulator is to further adjust the pH of the transdermal carrier, and sodium hydroxide is preferred. The sodium sulfate-induced co-precipitation method is used to prepare the nanoparticles of the chitosan and DNA complex, and the role of the sodium sulfate solution lies in its stronger water adsorption force to form a stable water film, thereby playing an anti-dissolution role in the sedimentation process. Water is selected as the solvent in the examples of the present invention. In order to further improve the performance of the chitosan transdermal carrier, other additives can be further added, and the specific addition can be carried out according to the conventional selection in the art.

[0045] In a preferred embodiment of the present invention, the mass ratio of the plasmid to chitosan is 1:0.1 - 10, preferably 1:0.5 - 2, and most preferably 1:1; if the proportion of the plasmid is too large, the binding rate of the plasmid to chitosan will decrease.

[0046] In a preferred embodiment of the present invention, the deacetylation degree of chitosan is 80% - 95%, and the molecular weight is in the medium molecular weight range.

[0047] In a preferred embodiment of the present invention, the mass percentage concentration of chitosan in the chitosan transdermal carrier is 0.001% - 0.01%, preferably 0.01%.

[0048] In a preferred embodiment of the present invention, the pH value of the chitosan transdermal carrier is 5 - 5.8, preferably 5.5.

[0049] The embodiment of the present invention also relates to a preparation method of the composition, which at least includes the following steps:

[0050] S1. Prepare a plasmid for inhibiting matrix metalloproteinase expression;

[0051] S2. Respectively prepare a chitosan solution and a plasmid solution, and heat them to 50 - 60 °C respectively;

[0052] S3. Mix the equal-volume chitosan solution and plasmid solution to obtain a solution of nanoparticles.

[0053] Specifically, the plasmid for inhibiting matrix metalloproteinase expression is prepared by using known techniques.

[0054] Specifically, the preparation method of the chitosan solution includes: preparing a solution with a mass percentage concentration of 0.01% to 0.05%, preferably 0.02%, by using sodium acetate solution to dissolve chitosan, adjusting the pH to 5 to 5.8, preferably 5.5; the concentration of the sodium acetate solution is 0.4 to 0.6 mol / L, preferably 0.5 mol / L. When chitosan dissolves in water, it behaves as a polymeric polyelectrolyte and forms multiple N-deacetylated subunits. After dissolving in acid, it can also combine with hydrogen ions to form a strong positively charged ion group. The high-density positive electron groups formed by these multiple N-deacetylated subunits enable chitosan to combine with negatively charged plasmid DNA and adsorb it onto cells with a negatively charged surface, thereby facilitating the transfection of the encapsulated plasmid DNA into the adsorbed cells and playing the role of a gene delivery vector.

[0055] Specifically, the preparation method of the plasmid solution includes: dissolving the plasmid with sodium sulfate solution to prepare a solution with a mass percentage concentration of 50 to 500 μg / mL, preferably 100 to 200 μg / mL; the concentration of the sodium sulfate solution is 4 to 6 mmol / L, preferably 5 mmol / L. The role of the sodium sulfate solution is that it has a stronger adsorption force for water, forms a stable water film, and thus plays an anti-dissolution role in the sedimentation process.

[0056] In S2, heating means placing the chitosan solution and the plasmid solution in different containers and performing a water bath at 50 to 60 °C for 5 to 15 min; preferably, the heating condition is a water bath at 55 °C for 10 min. When the solution temperature is higher than 50 °C, the aggregation degree of chitosan-DNA nanoparticles is the smallest. At a temperature of 55 °C and a pH of 5.5, it is detected that stable and uniform nanoparticles can be formed in the presence of 25 mM sodium sulfate.

[0057] In S3, mixing is performed by oscillating on a vortex shaker for 15 to 30 seconds; the advantage of mixing with a vortex shaker is high mixing efficiency, and the formed nanoparticles will be more uniform. The condition of the vortex shaker is vertical vortex.

[0058] The embodiment of the present invention also relates to a preparation of the composition, and the preparation is a liquid preparation or a freeze-dried preparation. The preparation in the embodiment of the present invention can be a liquid preparation. In order to further increase the storage period, it can also be prepared as a freeze-dried preparation. In order to prepare the above composition into various preparations, various excipients or additives can also be added, and specific addition can be carried out according to common knowledge in the art.

[0059] The embodiments of the present invention also relate to the application of the composition in the preparation of drugs or skin care products for inhibiting and / or delaying skin aging, or protecting skin collagen; preferably, the aging is photoaging. The composition of the embodiments of the present invention contains a plasmid for inhibiting the expression of matrix metalloproteinase, and the plasmid is delivered into dermal cells of the skin through a vector. The plasmid is expressed in the dermal cells of the skin and inhibits the expression and translation of matrix metalloproteinase protein. Inhibiting the expression of MMP-1 (type I matrix metalloproteinase) can inhibit skin aging caused by ultraviolet rays, thereby achieving the effects of protecting skin collagen and resisting photoaging.

[0060] The sources of the instruments and reagents used in the experiment are as follows:

[0061] I. Reagents

[0062] 1. Chitosan - Sinopharm Chemical Reagent Co., Ltd.;

[0063] 2. Acetic acid (Ethanoic acid) - Sinopharm Chemical Reagent Co., Ltd.;

[0064] 3. Sodium hydroxide - Sinopharm Chemical Reagent Co., Ltd.;

[0065] 4. Sodium sulfate - Guangdong Shantou Xilong Chemical Factory;

[0066] 5. Ampicillin - Beijing Solarbio Science & Technology Co., Ltd.;

[0067] 6. Plasmid large extraction kit - Beijing Tiangen Biochemical Technology Co., Ltd.;

[0068] 7. Yeast extract - OXOID Ltd., UK;

[0069] 8. Tryptone - OXOID Ltd., UK;

[0070] 9. Sodium chloride - Sinopharm Chemical Reagent Co., Ltd.;

[0071] 10. Competent DH5a - Nanjing Novoprotein Medical Technology Co., Ltd.;

[0072] 11. pcDNA3.1+ plasmid - Nanjing Genscript Biotech Co., Ltd.;

[0073] 12. Agar powder - Shanghai Yeasen Biotech Co., Ltd.;

[0074] 13. 10000x Gel-Red - Shanghai Beyotime Biotechnology Co., Ltd.;

[0075] 14. 50x TAE - Beijing Solarbio Science & Technology Co., Ltd.;

[0076] 15. DL10000 DNA marker - Nanjing Novoprotein Medical Technology Co., Ltd.;

[0077] 16. 6x DNA loading buffer - Shanghai Yisheng Biotechnology Co., Ltd.;

[0078] 17. Hematoxylin and Eosin (HE) staining kit - Shanghai Beyotime Biotechnology Co., Ltd.;

[0079] 18. Universal tissue fixative - Wuhan Servicebio Technology Co., Ltd.;

[0080] 19. PBS - Wuhan Servicebio Technology Co., Ltd.;

[0081] 20. Ethanol - Sinopharm Chemical Reagent Co., Ltd.;

[0082] 21. Xylene - Wuxi Yasheng Chemical Industry Co., Ltd.;

[0083] 22. Paraffin - Sinopharm Chemical Reagent Co., Ltd.;

[0084] 23. Hydrochloric acid - Sinopharm Chemical Reagent Co., Ltd.;

[0085] 24. 50x Sodium citrate antigen retrieval solution - Beijing Solarbio Science & Technology Co., Ltd.;

[0086] 25. Endogenous peroxidase blocking solution - Wuhan Boster Biological Engineering Co., Ltd.;

[0087] 26. Goat serum - Gibco, USA;

[0088] 27. MMP-1 Antibody - Wuhan Sanying Biotechnology Co., Ltd.;

[0089] 28. CoL-I Antibody - Wuhan Sanying Biotechnology Co., Ltd.;

[0090] 29. Elastin Antibody - Wuhan Sanying Biotechnology Co., Ltd.;

[0091] 30. Rabbit secondary antibody IgG - Santa Cruz Biotechnology, Inc., USA;

[0092] 31. DAB chromogenic reagent - Fuzhou Maixin Biotechnology Development Co., Ltd.;

[0093] 32. Ammonia water - Fuzhou Wenlai Biotechnology Co., Ltd.;

[0094] 33. DMEM high glucose medium - Gibco, USA;

[0095] 34. Fetal bovine serum - Gibco, USA;

[0096] 35. Double antibody - Gibco, USA;

[0097] 36. Plasmid miniprep kit - Tiangen Biochemical Technology (Beijing) Co., Ltd.;

[0098] 37. Lipo 2000 - Thermo Fisher Scientific, USA;

[0099] 38. TRIzol - Ambion, USA;

[0100] 39. Chloroform - Solarbio Science & Technology Co., Ltd., Beijing;

[0101] 40. Isopropanol - Solarbio Science & Technology Co., Ltd., Beijing;

[0102] 41. DEPC water - Beyotime Biotechnology Co., Ltd., Shanghai;

[0103] 42. 10x RT mix - Novoprotein Scientific Inc., Nanjing;

[0104] 43. HiScript II Enzyme - Novoprotein Scientific Inc., Nanjing;

[0105] 44. Specific primers - GenScript Biotech Corporation, Nanjing;

[0106] 45. 2x Mix - Novoprotein Scientific Inc., Nanjing;

[0107] 46. mQ Primer - Novoprotein Scientific Inc., Nanjing;

[0108] 47. 5x AMv buffer - Takara, Japan;

[0109] 48. AMvase - Takara, Japan;

[0110] 49. Oligo dT - Takara, Japan;

[0111] 50. dNTP Mixture - Takara, Japan;

[0112] 51. RRI - Takara, Japan;

[0113] 52. 10x buffer - Takara, Japan;

[0114] 53. Mg 2+ - Takara, Japan;

[0115] 54. rTaq - Takara Company, Japan;

[0116] 55. 20x Evagreen - Biotium Company, USA.

[0117] II. Instruments

[0118] 1. pH meter - Shanghai Youke Instrumentation Co., Ltd.;

[0119] 2. Electronic analytical balance - Precisa Company, Switzerland;

[0120] 3. Constant temperature digital display metal bath - Eppendorf Company, Germany;

[0121] 4. Pure water instrument - Nanjing Hanlong Experimental Equipment Co., Ltd.;

[0122] 5. High pressure sterilizer - Zealway Company, USA;

[0123] 6. 37°C incubator - Shanghai Xinmiao Medical Instrument Manufacturing Co., Ltd.;

[0124] 7. Vortex mixer - Scientific Industries Company, USA;

[0125] 8. Transmission electron microscope - Nanjing Aoli Scientific Instruments Co., Ltd.;

[0126] 9. Laminar flow hood - Shanghai Baosai Biotechnology Co., Ltd.;

[0127] 10. 37°C shaker (small) - Shanghai Zhicheng Technology Co., Ltd.;

[0128] 11. 37°C shaker (large) - Taicang Qiangle Experimental Equipment Co., Ltd.;

[0129] 12. Low temperature high speed centrifuge - Beckman Company, USA;

[0130] 13. Cell incubator - Shanghai Baosai Biotechnology Co., Ltd.;

[0131] 14. 2720 thermal cycler PCR instrument - Applied Biosystems Company, USA;

[0132] 15. 4°C refrigerator - Haier Group Corporation;

[0133] 16. -20°C refrigerator - Haier Group Corporation;

[0134] 17. -80°C refrigerator - Shanghai Baosai Biotechnology Co., Ltd.;

[0135] 18. Microwave oven - Guangdong Midea Kitchen Appliances Manufacturing Co., Ltd.;

[0136] 19. Ice maker - Nanjing Saibiaoao Biotechnology Co., Ltd.;

[0137] 20. Pipettes of various models - Eppendorf AG, Germany;

[0138] 21. High-speed centrifuge - Eppendorf AG, Germany;

[0139] 22. Embedding machine - Leica Microsystems Trading Co., Ltd.;

[0140] 23. Microtome - Leica Microsystems Trading Co., Ltd.;

[0141] 24. Automatic gel imaging system - Nanjing Maigaode Biotechnology Co., Ltd.;

[0142] 25. LightCycler 96 - Roche Diagnostics GmbH, Switzerland;

[0143] 26. Nucleic acid measurer - Shanghai Bioscience Co., Ltd.;

[0144] 27. Cryostat - Leica Microsystems Trading Co., Ltd.;

[0145] 28. UVB ultraviolet lamp - Philips Lighting Netherlands B.V.;

[0146] 29. Tissue disruptor - Shanghai Jingxin Industrial Development Co., Ltd.

[0147] Preparation of the plasmid in Example 1

[0148] I. Search for the complete mRNA sequence of the target gene (MMP1a)

[0149] The website used is: NCBI official website (URL: https: / / www.ncbi.nlm.nih.gov / ); II. Search for the miRNA sequence of the target gene

[0150] 1. Open the link:

[0151] https: / / rnaidesigner.thermofisher.com / rnaiexpress / setOption.do?designOption=mirna&pid=6857872465505400160

[0152] 2. Select miR RNAi in the Target Design Options box; then enter the complete mRNA sequence in the OR box and select the gene source. Select mouse for mouse origin and Human for human origin;

[0153] 3. Scroll down the interface and click RNAi Design to obtain the sequence:

[0154] Sense strand: TTGTTCTATGTTACGGCTCAT (SEQ ID NO:2);

[0155] Antisense strand: AACAAGATACAATGCCGAGTA (SEQ ID NO:3);

[0156] The entire sequence linked to the restriction enzyme sites at both ends is:

[0157] SEQ ID NO:1:

[0158] TGGAGGCTTGCTGAAGGCTGTATGCTG TTGTTCTATGTTACGGCTCAT GTTTTGGCCACTGACTGAC AT GAGCCGACATAGAACAA CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCC

[0159] This sequence is expressed in cells as shown in Figure 1 As shown in Figure 1 As shown, this is a hairpin-like structure, which is a miRNA precursor containing a stem-loop structure and is generated by the cleavage and processing of a series of nucleases. Subsequently, it is assembled into the RNA-induced silencing complex (miRISCs), recognizes the target mRNA through base complementary pairing, and guides the silencing complex to degrade the target mRNA or repress the translation of the target mRNA according to the degree of complementarity.

[0160] The miRNA sequence of the desired target gene can be obtained by the above method.

[0161] III. Vector

[0162] Use plasmid pcDNA3.1(+), select the restriction enzyme sites as BamH I - EcoR I, entrust GenScript Biotech Corporation, and synthesize the plasmid using existing technologies.

[0163] Preparation of the composition in Example 2

[0164] 1. The deacetylation degree of the chitosan used is 80-95%, and it is of medium molecular weight. After dissolving the chitosan in 0.5M NaAc solution, the pH is adjusted to 5.5 with NaOH, and the mass percentage concentration of chitosan is: 0.02%;

[0165] 2. The plasmid DNA is dissolved in 5mM Na2SO4 solution, and the plasmid concentration is: 100 μg / mL;

[0166] 3. Place equal volumes of the chitosan solution and the plasmid solution in different ep tubes and incubate in a water bath at 55°C for 10 min. Then mix the two solutions in one ep tube and mix well by shaking on a vortex shaker for 20 s.

[0167] Experimental Example 1 Gel Electrophoresis

[0168] 1. Preparation of samples:

[0169] 1.1 Preparation of plasmid DNA sample: The plasmid prepared in Example 1, with a concentration of 100 μg / mL;

[0170] 1.2 Preparation of chitosan-DNA nanoparticle solution sample: The composition prepared in Example 2;

[0171] 1.3 Preparation of chitosan-DNA nanoparticle solution-precipitate sample: The precipitate obtained by centrifuging the composition in a centrifuge at 16,000 g for 1 h;

[0172] 1.4 Preparation of chitosan-DNA nanoparticle solution-supernatant sample: The supernatant obtained by centrifuging the composition in a centrifuge at 16,000 g for 1 h;

[0173] 2. Electrophoresis:

[0174] 2.1 Prepare 1% agarose;

[0175] 2.2 Add 6xloading buffer to each sample for staining, load 10 μL per well, and run in the electrophoresis tank at 150 v for 30 min;

[0176] 2.3 Observe under an automatic exposure instrument after electrophoresis. The experimental results are as Figure 2 shown.

[0177] 3. Result description:

[0178] As Figure 2 shown, when the composition is placed in a centrifuge and centrifuged at 16,000 g for 1 h, it can be judged that the vast majority of plasmid DNA has been encapsulated in the nanoparticles by the comparable brightness of the uncentrifuged solution and the centrifuged precipitate in the tank, and the absence of visible brightness in the supernatant electrophoresis tank. It can be judged that the vast majority of plasmid DNA has been encapsulated in the nanoparticles.

[0179] Experimental Example 2 Skin Appearance

[0180] I. Experimental Procedure

[0181] 1. The mice for modeling were divided into five groups, all with an age of 10 - 12 weeks;

[0182] 2. The hair on the backs of the mice was removed, and they were given UVB ultraviolet irradiation at 25 mJ / cm 2 per day for one week;

[0183] 3. Immediately after each irradiation, the corresponding reagent was applied, and it was slowly applied until the liquid was completely absorbed by the skin. The plasmid concentration in the nanoparticle solution was 50 μg / mL, and the amount applied each time was 1 mL, that is, the amount of plasmid required each time was 50 μg. It was applied once a day for one week, a total of 7 times.

[0184] The reagents included:

[0185] a. Chitosan solution: The mass percentage concentration was: 0.02%;

[0186] b. Plasmid solution: The plasmid concentration was 100 μg / mL;

[0187] c. Composition solution: Prepared in Example 2;

[0188] The experimental results were obtained as Figure 3 shown: Among them, Group 1: NC - blank control, Group 2: UVB - mock - photoaging model control, Group 3: UVB - CS - photoaging model applied with chitosan solution, Group 4: UVB - miMMP1a plasmid - photoaging model applied with plasmid solution, Group 5: photoaging model applied with composition solution.

[0189] II. Result Explanation

[0190] 1. In the blank control (Group 1: NC), the skin appearance of normal mice was tender, delicate, fair, smooth, with an obvious luster, and no visible pores to the naked eye;

[0191] 2. Compared with the control group (Group 2: UVB - mock), the model mice showed obvious dullness, local melanin deposition, the skin surface became rough and accompanied by obvious wrinkles, the luster disappeared, there were visible pores to the naked eye, and the aging feeling was obvious. Applying 1 mL of chitosan solution without bound plasmid and plasmid solution without bound chitosan respectively in Group 3 and Group 4 showed no obvious improvement;

[0192] 3. In Group 5, applying 1 mL of the nanoparticle solution with chitosan - plasmid binding, that is, containing 50 μg of plasmid, showed some improvement compared to the second, third, and fourth groups. The skin was not significantly dull, the roughness and wrinkles were less, the skin retained a slightly delicate and shiny feeling, and the pore feeling was less.

[0193] Experimental Example 3, HE staining results

[0194] I. Experimental procedure

[0195] 1. The experimental animal mice in Experimental Example 2 were anesthetized and sacrificed, and the skin tissue was removed and placed in the fixing solution formalin to denature and solidify the proteins of the tissue and cells, preventing autolysis after cell death or decomposition by bacteria, thereby maintaining the original morphological structure of the cells;

[0196] 2. After successful fixation, trim, wash away the excess fixing solution with water, and then dehydrate with alcohol of different concentrations. Generally, soak in alcohol from low concentration to high concentration in turn to gradually remove the water in the tissue block. Then place the tissue block in xylene for clearing to replace the alcohol in the tissue block with xylene;

[0197] 3. Pour the melted paraffin into the dehydrated and cleared tissue, place it in a wax melting box and keep it warm for a period of time. Wait until the paraffin liquid completely penetrates into the tissue block, and then embed it with paraffin liquid (the volume of the paraffin liquid is preferably more than 10 times the volume of the tissue), and cool and solidify into a block for sectioning in the experiment;

[0198] 4. Sectioning, spreading, and baking: Fix the embedded wax block on a microtome and cut into thin slices, generally 5 - 8 microns thick. The cut thin slices are often wrinkled, and need to be flattened in heated water, then pasted on a glass slide and dried in an incubator at 45°C;

[0199] 5. Staining: Dewaxing - Hydration - Staining - Dehydration - Clearing - Sealing - Observation:

[0200] (1) Use xylene for dewaxing, and then use alcohol from low to high concentration for hydration so that the dye can enter the tissue;

[0201] (2) Stain with hematoxylin dye, wash away the dye slightly with running water, then differentiate with 0.1% hydrochloric acid ethanol, and then wash away the excess dye with water;

[0202] (3) Stain with eosin solution, and wash away the excess dye with running water after staining;

[0203] (4) Dehydration: After washing away the dye with water, perform alcohol washing and dehydration with alcohol from low to high concentration;

[0204] (5) Clearing and sealing: Clear with xylene, seal with resin, and then observe and take pictures.

[0205] The experimental results are as Figure 4 shown.

[0206] II. Result description

[0207] Collagen has eosinophilic staining property and can be stained red by eosin.Figure 4 In the visible skin tissue, there are epidermis, dermis, adipose tissue, and muscle tissue in sequence. Collagen is mainly distributed in the dermis. In the blank control group, there is more collagen staining, which is arranged orderly and densely; in the model control group, the collagen staining decreases, the arrangement is messy and loose, and the protein gap is larger; in the third and fourth groups, the situation does not improve compared with the model control group; in the fifth group, the situation improves compared with the model control group, the collagen staining becomes slightly darker, the arrangement is relatively orderly and dense, and the protein gap decreases.

[0208] Experimental Example 4, Immunohistochemical Results

[0209] I. Experimental Process

[0210] Take the experimental animals in Experimental Example 2. The steps before dewaxing are the same as those in the HE staining in Experimental Example 3;

[0211] 1. Dewaxing and Hydration: Place the sections on the section rack and sequentially put them into xylene I (10 min), xylene II (10 min), xylene III (10 min), 100% alcohol I (5 min), 100% alcohol II (5 min), 95% alcohol (3 min), 80% alcohol (3 min), 50% alcohol (3 min), and distilled water (3 min) for immersion dewaxing and gradient hydration. Immerse in PBS for 5 min;

[0212] 2. Antigen Retrieval:

[0213] Take an appropriate amount of citrate antigen retrieval solution diluted into a working solution in an immunohistochemistry cylinder. Place the sections on a heat-resistant staining rack, immerse them in the immunohistochemistry cylinder, place the immunohistochemistry cylinder in a pressure cooker, add water in the pot to cover the height of the retrieval solution in the cylinder, heat to boiling and maintain the pressure for 10 minutes, then stop heating, naturally cool to room temperature at room temperature and then take out the sections, and rinse them thoroughly with running water. Remove the moisture on the sections, draw a circle with an immunohistochemistry oil pen 3 mm away from the tissue, and rinse with PBS for 2 min × 3;

[0214] Add 1 drop or 50 μL of peroxidase blocking solution to each section and incubate at room temperature for 10 min, then rinse with PBS for 3 min × 3;

[0215] Remove PBS, add 1 drop or 50 μL of 5 - 10% normal goat serum for blocking (diluted 1:10 - 1:20 times) to each section, and incubate at room temperature for 10 min. Remove the serum.

[0216] 3. Immunohistochemical Staining (Antibody Incubation, Color Development)

[0217] 3.1 Add 100 μL of appropriately diluted primary antibody to each section, incubate overnight at 4°C, and rewarm at 37°C for 45 min after taking it out of the refrigerator. Rinse with PBS for 3 min × 3;

[0218] 3.2 Remove PBS, add 100 μL of rabbit secondary antibody IgG to the sections, and incubate at room temperature for 30 minutes. Rinse with PBS for 3 min × 3;

[0219] 3.3 Remove PBS, add 2 drops or 100 μL of freshly prepared DAB chromogenic reagent to the sections for color development, and control the staining time according to the development of the color. Generally, the staining time is about 3 - 10 min at room temperature or observe and control the staining time under the microscope; The experimental results are as Figure 5 shown.

[0220] Result description:

[0221] The production range of MMP-1 is relatively wide and can be produced by matrix fibroblasts, macrophages, endothelial cells, and epithelial cells. Under normal circumstances, the positive rate of MMP-1 is very low, but it can be highly expressed under various stimuli.

[0222] Figure 5 In the blank control group, the positive rate of MMP-1a is relatively low (stained brown), the positive rates of collagen (CoL-1) and elastin in the dermis are high, the staining is deeper, the collagen is arranged neatly, distributed evenly, and the gap is smaller; In the model control group compared with the blank control group, the positive rate of MMP-1a in epidermal cells increases, the staining becomes deeper, the arrangement of collagen (CoL-1) becomes disordered, the protein gap increases, and protein deposition appears, and the positive rate of elastin in the dermis decreases and the staining becomes lighter; The conditions of the third and fourth groups are not improved compared with the model control group; The condition of the fifth group is improved compared with the model control group. The positive rate of MMP-1a in epidermal cells decreases, the staining becomes lighter, the arrangement of collagen (CoL-1) becomes neater, the distribution becomes more uniform and the gap decreases, but the condition of elastin is not significantly improved.

[0223] Experimental example 5, q-PCR

[0224] Experimental procedure

[0225] I. Transfection

[0226] 1. Seed NIH-3T3 cells into six-well plates, divide them into four groups, repeat three wells for each group, and add 2 mL of DMEM cell culture medium containing 10% fetal bovine serum and 1% double antibiotics to each well;

[0227] 2. Transfect the cells when they grow to about 40 - 50%;

[0228] 3. The blank control group was not treated. The naked plasmid group was directly added with plasmid. The chitosan plasmid nanoparticle group was added with the prepared nano-solution. Lipo 2000 group: Prepare two sterile 1.5 mL ep tubes, each added with 100 μL of serum-free and antibiotic-free DMEM, 3 μL of lipo 2000 and 1 μg of plasmid were added respectively, after mixing, let it stand for about 5 minutes, suck out the culture solution mixed with lipo 2000 with a pipette, inject it into the culture solution containing plasmid, gently pipette and mix well, then let it stand for 15 - 20 minutes, and then add it dropwise to the cell culture solution. (The cell culture solution of the Lipo 2000 group needs to be changed to 2 mL of serum-free and antibiotic-free DMEM before adding dropwise, because the two may make lipo 2000 toxic to cells, and then change the culture solution to DMEM containing 10% fetal bovine serum and 1% double antibiotics after 6 h. The Lipo 2000 group is only for comparing the transfection efficiency with the nanoparticle group and does not serve the experimental purpose.)

[0229] 4. Except for the blank control group, the amount of transfected plasmid in the other groups was 1 μg. After the corresponding solution was added dropwise to the cell culture solution, gently shake the 6-well plate to mix the solution;

[0230] 5. After 48 h, aspirate the cell culture solution, wash the cells twice with PBS, and extract the cell RNA.

[0231] II. Extraction of cell RNA by Trizol method

[0232] 1. Aspirate the PBS in the cell well plate, and add 1 mL of Trizol to each well;

[0233] 2. Use a pipette to blow and detach the adherent cells, dissolve them in Trizol, transfer them into a labeled 1.5 mL ep tube, then immediately vortex on a vortex mixer and let it stand at room temperature for 5 min;

[0234] 3. Add 200 μL of chloroform to each tube. Vortex on a vortex mixer for 15 s, let it stand at room temperature for 15 - 20 min, after it is layered, centrifuge at 16000 g at 4 °C in a centrifuge for 20 min;

[0235] 4. Prepare a new 1.5 mL ep tube, make a label, and carefully aspirate the supernatant to the new corresponding ep tube with a 200 μL pipette;

[0236] 5. Add isopropanol with a volume 1.5 times that of the supernatant in the previous step, cover the lid and gently invert and mix well, and leave it overnight in a -20 °C refrigerator;

[0237] 6. After overnight, centrifuge the above centrifuge tubes at 16000 g at 4 °C in a centrifuge for 20 min;

[0238] 7. After centrifugation, small white precipitates can be seen. Discard the supernatant, add 1 mL of 75% ethanol prepared with DEPC water and absolute ethanol to each tube for washing, then gently invert the tube up and down several times with the lid on, and then centrifuge at 16,000 g at 4 °C for 20 min in the centrifuge.

[0239] 8. Discard the supernatant, invert the ep tube on the absorbent paper to dry. Do not over-dry or leave too much liquid residue. After drying, add 10 - 20 μL of DEPC water to dissolve the precipitate.

[0240] 9. When extracting RNA from skin tissue cells, the procedure is the same as above, but after adding Trizol, add 2 - 3 steel beads to the ep tube and grind the tissue with a tissue homogenizer.

[0241] III. q-PCR

[0242] 1. Reverse-transcribe the RNA of each sample into DNA according to the following system and machine program; (Adjust the concentration of all cell RNA samples to 100 μg / mL; Adjust the concentration of all skin tissue RNA samples to 500 μg / mL)

[0243] (1) The miRNA system (total 20 μL) is shown in Table 1:

[0244] Table 1

[0245] Preparation Volume 10xRTmix 2 μL HiScript II Enzyme 2 μL DEPC water 13 μL Specific primer (SEQ ID NO:4) (2 μM) 1 μL RNA 2 μL

[0246] SEQ ID NO:4:

[0247] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATGAGC

[0248] The machine (PCR instrument) program is shown in Table 2:

[0249] Table 2

[0250] Temperature Time 25℃ 5 min 55℃ 15 min 85℃ 5 min 4℃ 59 min

[0251] The messageRNA system (total 20 μL) is shown in Table 3:

[0252] Table 3

[0253] Preparation Volume 5x AMv buffer 4 μL AMvase 1 μL Oligo dT 1 μL dNTP 2 μL RRI 0.5 μL DEPC water 7.5 μL RNA 4 μL

[0254] The machine (PCR instrument) program is shown in Table 4:

[0255] Table 4

[0256] Temperature Time 16℃ 30 min 42℃ 60 min 85℃ 5 min 4℃ 59 min

[0257] 2. Prepare the mixed solution according to the following system, add it to the 96-well plate provided with the instrument at a volume of 20 μL per well for each sample in triplicate, and run it on the machine LightCycler 96 according to the following instrument program.

[0258] (1) The miRNA system (total 20 μL) is shown in Table 5:

[0259] Table 5

[0260] Preparation Volume 2x Mix 10 μL mQ Primer (10 μM) 0.4 μL DEPC water 7.2 μL Specific primer (SEQ ID NO:5) (10 μM) 0.4 μL cDNA 2 μL

[0261] SEQ ID NO:5: CGCGCGTTGTTCTATGTTACG

[0262] The instrument program is shown in Table 6:

[0263] Table 6

[0264]

[0265] (2) The messageRNA system (total 20 μL) is shown in Table 7:

[0266] Table 7

[0267]

[0268]

[0269] SEQ ID NO:6: CCTTGATGAGACGTGGACCAA

[0270] SEQ ID NO:7 ATGTGGTGTTGTTGCACCTGT

[0271] The instrument program is shown in Table 8:

[0272] Table 8

[0273]

[0274] The experimental results are as Figure 6 and Figure 7 shown:

[0275] 1. Transfect NIH-3T3 cells (the cells were not modeled, only the RNA level 48 h after transfection was detected, and the plasmid amount was 1 μg).

[0276] NC - blank control;

[0277] miMMP1a plasmid - naked plasmid;

[0278] CS-miMMP1a-NPs - Nanoparticles formed by the binding of chitosan and plasmid;

[0279] lipo 2000-miMMP1a-NPs - Nanoparticles formed by the binding of lipo 2000 and plasmid.

[0280] 2. Apply to the skin tissue (for one week of model establishment, UVB dose is 25 mJ / cm 2 , and immediately apply the corresponding solution to the irradiated area after each day of model establishment, with the plasmid amount being 50 μg each time.)

[0281] NC - Blank control;

[0282] UVB-mock - Control for the photoaging model;

[0283] UVB-CS - Apply chitosan solution without bound plasmid to the photoaging model;

[0284] UVB-miMMP1a - Apply plasmid solution without bound chitosan to the photoaging model;

[0285] UVB-CS-miMMP1a-NPs - Apply the nanoparticle solution formed by the binding of chitosan and plasmid to the photoaging model.

[0286] Results show:

[0287] 1. In the transfection experiment of cells, since naked plasmid will be degraded by enzymes in the serum, the expression of mi-MMP1a was not detected in the cells of the blank control and naked plasmid groups; the expression of mi-MMP1a was detected in both the third and fourth groups, and the transfection effect of lipo was better than that of the nanoparticles formed by the binding of chitosan and plasmid. When detecting the mRNA-MMP1a level of cell expression, it was found that the nanoparticles formed by the binding of chitosan and plasmid in the first and second groups could significantly inhibit the expression of this gene.

[0288] 2. In the animal tissue experiment, the expression of mi-MMP1a in the first to fourth groups was very low, and the expression of mi-MMP1a in the fifth group increased significantly, suggesting that the nanoparticles formed by the binding of chitosan and plasmid successfully delivered the plasmid into skin cells and made them express the corresponding gene. When detecting the mRNA-MMP1a level of cell expression, it was found that the mRNA-MMP1a level of cell expression in the blank control was relatively low, and the mRNA-MMP1a expression level increased significantly in the control of the photoaging model. There was no improvement in the third and fourth groups compared with the second group; while after applying the nanoparticle solution formed by the binding of chitosan and plasmid in the fifth group, the mRNA-MMP1a expression level decreased significantly, suggesting that the nanoparticles successfully delivered the plasmid into skin cells and played a role in inhibiting the expression of this gene.

[0289] Although the present application is disclosed above in preferred embodiments, it is not intended to limit the claims. Without departing from the concept of the present application, any person skilled in the art can make several possible changes and modifications. Therefore, the protection scope of the present application shall be subject to the scope defined by the claims of the present application.

Claims

1. A composition, characterized in that, The composition contains a plasmid for inhibiting the expression of matrix metalloproteinase MMP1 or MMP1a and a chitosan transdermal carrier for delivering the plasmid into skin cells; the plasmid and the chitosan transdermal carrier combine to form nanoparticles; The nucleotide sequence of the target fragment in the plasmid is the sequence shown in SEQ ID NO: 1; The chitosan transdermal carrier contains chitosan with a mass percentage concentration of 0.02%; the degree of deacetylation of the chitosan is 80% - 95%; The pH value of the chitosan transdermal carrier is 5.

5.

2. The composition according to claim 1, wherein The skin cells are selected as skin dermal cells.

3. The composition according to claim 1, wherein The mass ratio of the plasmid to chitosan is 1:0.1 - 10.

4. The composition according to claim 3, characterized in that, The mass ratio of the plasmid to chitosan is 1:0.5 - 2.

5. The composition according to claim 4, wherein The average particle size of the nanoparticles is 100 - 200 nm.

6. The preparation method of the composition according to any one of claims 1 to 5, characterized in that, At least includes the following steps: S1. Prepare a plasmid for inhibiting the expression of matrix metalloproteinase MMP1 or MMP1a; S2. Prepare a chitosan solution and a plasmid solution respectively, and heat them to 50 - 60 °C respectively; S3. Mix equal volumes of the chitosan solution and the plasmid solution to obtain a solution of the nanoparticles.

7. The preparation method according to claim 6, characterized in that, In S2, the preparation method of the chitosan solution includes: preparing a solution with a mass percentage concentration of 0.02% of chitosan with a sodium acetate solution, and adjusting the pH to 5.

5.

8. The preparation method according to claim 6, characterized in that, In S2, the preparation method of the plasmid solution includes: dissolving the plasmid with a sodium sulfate solution to prepare a solution with a mass percentage concentration of 100 μg / mL.

9. The preparation method according to claim 7, wherein In S2, The concentration of the sodium acetate solution is 0.5 mol / L.

10. The preparation method according to claim 8, characterized in that, In S2, The concentration of the sodium sulfate solution is 5 mmol / L.

11. The preparation method according to claim 10, characterized in that, In S2, the heating is to place the chitosan solution and the plasmid solution in different containers and water bath at 55 °C for 10 min.

12. The preparation method according to claim 11, characterized in that, In S3, the mixing is to shake on a vortex shaker for 15 - 30 seconds.

13. A preparation containing the composition according to any one of claims 1 to 5, characterized in that, The preparation is a liquid preparation or a freeze-dried preparation.

14. The application of the composition according to any one of claims 1 - 5 in the preparation of a drug or skin care product for inhibiting and / or delaying skin aging, or protecting skin collagen.

15. The application according to claim 14, characterized in that, The aging is photoaging.

Images