Use of cationic lipid analogs in intracellular delivery of gene editing ribonucleoprotein complexes

Abstract

The present application relates to the technical field of biotechnology, and particularly relates to a nanocomposite containing a cationic lipid analogue and application of the cationic lipid analogue in intracellular delivery of a gene editing ribonucleoprotein complex. The nanocomposite comprises the cationic lipid analogue and the ribonucleoprotein complex; the cationic lipid analogue has a structure as shown in formula (I). The nanocomposite has a high gene editing effect on different gene sites (AAVS1, HBB, EGFP and KRAS) in tumor tissues, which further indicates that the cationic lipid analogue delivering the ribonucleoprotein complex has a certain inhibitory effect on tumor growth; the gene editing ribonucleoprotein complex delivery carrier can achieve a high delivery efficiency in intracellular delivery and is safe and effective.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a nanocomplex containing a cationic lipid analogue and application of the cationic lipid analogue in intracellular delivery of gene editing ribonucleoprotein complex. BACKGROUND

[0002] The clustered regularly interspaced short palindromic repeats (CRISPR) system is derived from the adaptive immune system of bacteria and archaea, which is mainly used to resist the invasion of exogenous nucleic acids such as bacteriophages and plasmids. By utilizing this naturally occurring immune system, the CRISPR / Cas system has been developed into a new type of gene editing technology, which can target the target sequence of the genome or simultaneously target multiple target sequences of the genome for genome editing. The system has been widely used in the treatment of gene-related diseases, in vivo imaging of targeted detection of genomic regions, identification of disease-related new targets, identification of gene functions, and establishment of animal disease models.

[0003] Among the many CRISPR / Cas systems, CRISPR / Cas9, as the most representative gene editing system, mainly contains two core components: CRISPR / Cas9 endonuclease and single guided RNA (sgRNA). Since 2013, the CRISPR / Cas9-based gene editing technology has been successfully applied to mammalian genome editing. This technology has been applied to a series of intractable diseases, including malignant tumors, sickle cell anemia, I-H type mucopolysaccharidosis, Alzheimer's disease, glycogen storage disease, hemophilia, cystic fibrosis, Duchenne muscular dystrophy and other diseases.

[0004] Before the genome editing technology based on CRISPR / Cas9 system is applied to clinic, in addition to the complex technical challenges such as improving the specificity of gene editing, reducing off-target and genome mutation rate, on the other hand, how to safely and effectively introduce the CRISPR / Cas9 gene editing system into specific cells, tissues or organs to obtain the desired therapeutic effect is another key problem to be solved. However, due to the lack of efficient and safe CRISPR / Cas9 delivery vector system, the potential of CRISPR / Cas9 gene editing technology in clinical application is greatly limited. Therefore, developing efficient and low-toxic CRISPR / Cas9 delivery vector system has extremely important scientific value and research significance for promoting the transformation of CRISPR / Cas9 gene editing technology to clinical application, reducing toxic side effects and improving the safety of treatment. SUMMARY

[0005] The present application aims to overcome the deficiencies of the prior art and provide a kind of nanocomposite containing cationic lipid analogue, and the application of cationic lipid analogue in intracellular delivery of gene editing ribonucleoprotein complex. Cationic lipid analogue delivery ribonucleoprotein complex has higher gene editing efficiency.

[0006] To achieve the above object, the technical scheme adopted by the present application is:

[0007] A kind of nanocomposite, including cationic lipid analogue and ribonucleoprotein complex;

[0008] The cationic lipid analogue has the structure shown in formula (I):

[0009]

[0010] In formula (I), m1 is independently selected from hydrogen (H), linear alkyl, branched alkyl;

[0011] m2 is R1 is alkyl, R2 is alkyl, R3 is alkyl, or R1 and R2 are connected to form a cyclic group;

[0012] m3 is independently selected from linear alkyl, linear alkenyl;

[0013] m4 is independently selected from linear alkyl, linear alkyl containing ether bond.

[0014] The tertiary amine group contained in m2 in the cationic lipid analogues of the present application ensures that the material has pH sensitivity and positive charge adjustability; m3 contains a linear alkyl group and a linear alkenyl group, and by adjusting the chain length thereof, the hydrophobicity of the material can be adjusted. The cationic lipid analogues of the present application designed to combine with the ribonucleoprotein complex (Cas9 RNP protein) to form a nanocomposite, and the cationic lipid analogues deliver the ribonucleoprotein complex into cells with high gene editing efficiency, and the nanocomposite delivered into cells still has biological activity, and the nanocomposite itself and the delivery process have little toxicity to cells.

[0015] As a preferred embodiment of the nanocomposite of the present application, the mass ratio of the cationic lipid analogues to the ribonucleoprotein complex is (1-4):1. Preferably, the mass ratio of the cationic lipid analogues to the ribonucleoprotein complex is 2:1.

[0016] When the cationic lipid analogues and the ribonucleoprotein complex are matched in the above specific mass ratio, the delivery efficiency and the gene editing efficiency can be better improved, which is beneficial to the treatment of the corresponding diseases.

[0017] As a preferred embodiment of the nanocomposite of the present application, m1 is hydrogen (H), m2 is m3 is m4 is The obtained nanocomposite has high delivery efficiency for delivering the ribonucleoprotein complex into cells.

[0018] As a preferred embodiment of the nanocomposite of the present application, the cationic lipid analogues have any one of the following 36 structures:

[0019]

[0020]

[0021] The inventor found through experiments that the 36 small-molecule cationic lipid analogues screened above can be co-assembled with the ribonucleoprotein complex to form a nanocomposite with small size and stability, achieve intracellular delivery of various positive and negative proteins, and the proteins delivered into cells can maintain biological activity and have therapeutic effect.

[0022] As a preferred embodiment of the nanocomplexes of the present application, the cationic lipid analogues are at least one of A1I2R2C16, A1I2R2C18, A1I2R2C19, A1I2R2C20, A1I2R3C16, A1I2R3C18, A1I2R3C19, A1I2R3C20, A1I2R11C16, A1I2R11C18, A1I2R11C19, A1I2R11C20, A1I2-1R2C18, A1I2-1R2C19, A1I2-1R2C20, A1I2-3R2C18, A1I2-3R2C19, A1I2-3R2C20, more preferably, the cationic lipid analogues are A1I2R2C18, A1I2-1R2C18 or A1I2-3R2C18.

[0023] According to the experimental results of delivering the gene editing ribonucleoprotein complex into cells by the cationic lipid analogues, A1I2R2C18, A1I2-1R2C18 or A1I2-3R2C18 all have gene editing effects, wherein A1I2R2C18 has the highest gene editing efficiency, and the gene editing efficiency of the nanocomplex formed when the mass ratio of A1I2R2C18 and the ribonucleoprotein complex is 2:1 is the best when delivered into 293T cells. A12R2C18, A1I2-1R2C18 or A1I2-3R2C18 differ in the number of ethoxy repeating units at the linker position, wherein the gene editing efficiency of the carrier is general when there are 1 and 3 repeating units, and the gene editing efficiency of the carrier is the best when there are 2 repeating units.

[0024] Preferably, the ribonucleoprotein complex is a CRISPR-Cas9 ribonucleoprotein complex.

[0025] The present application also provides the nanocomplexes described above for use in gene editing and gene therapy.

[0026] As a preferred embodiment of the use of the present application, the site targeted by gene editing includes an AAVS1 site, an HBB site, an EGFP site or a KRAS site.

[0027] The present application also provides a modified nanocomplex comprising hyaluronic acid and the nanocomplex described above. Preferably, the concentration of hyaluronic acid is 0.1-2 mg / mL. More preferably, the concentration of hyaluronic acid is 0.2 mg / mL.

[0028] Since the nano-complex is positively charged and is rapidly removed by the reticuloendothelial system, the inventors of the present application have found, through a large number of researches and experiments, that the surface of the nano-complex is modified by a layer of hyaluronic acid, so that the nano-complex is coated with the anionic shell of hyaluronic acid by electrostatic interaction to generate a modified nano-complex. Hyaluronic acid (HA) is a negatively charged natural polysaccharide with excellent biocompatibility, which is used to shield the positive charge of the nano-complex to present long in vivo circulation and stealth properties.

[0029] The surface of the nano-complex is modified by hyaluronic acid at a preferred concentration, so that the zeta potential of the nano-complex changes from positive to negative. In addition, the modified nano-complex has the ability to resist serum, which can effectively prolong the in vivo blood circulation time.

[0030] The present application also provides the use of the above-mentioned nano-complex or the modified nano-complex in the preparation of an anti-tumor drug.

[0031] The present application provides a nano-complex, which has a high gene editing effect on the target mutant gene site in tumor tissue, further illustrating that the delivery of the ribonucleoprotein complex by the cationic lipid analog has a certain inhibitory effect on tumor growth.

[0032] The present application also provides a method for intracellular delivery of a gene editing ribonucleoprotein complex, which utilizes the cationic lipid analog to achieve intracellular delivery of the gene editing ribonucleoprotein complex.

[0033] The present application also provides the use of the cationic lipid analog in the above-mentioned nano-complex for intracellular delivery of a gene editing ribonucleoprotein complex.

[0034] The gene editing ribonucleoprotein complex is delivered to edit different genes in 293T cells, 293T-EGFP cells, SW-480 cells and other cell lines, and the experimental results show that the cationic lipid analog of the present application can achieve a high delivery efficiency in the intracellular delivery process; the cationic lipid analog of the present application can efficiently deliver the ribonucleoprotein complex to edit four gene sites (AAVS1, HBB, EGFP and KRAS) in the corresponding cells, and the efficiency is better than that of the commercial delivery reagent Lipofectamine CRISPRMAX (hereinafter referred to as CMAX).

[0035] It should be noted that the term "delivery" or "intracellular delivery" used herein refers to the process of making a drug enter from the outside of a cell to the inside of the cell, so as to be localized in the cytosol or in the organelle of the cell. The term "cell" or "intracellular" includes at least one of 293T cells, 293T-EGFP cells and SW-480 cells.

[0036] Compared with the prior art, the application has the following beneficial effects:

[0037] The application provides a nanocomposite containing a cationic lipid analogue, which has a high gene editing effect on different gene sites (AAVS1, HBB, EGFP and KRAS) in tumor tissues, and further illustrates that the cationic lipid analogue delivery of a ribonucleoprotein complex has a certain inhibitory effect on tumor growth; the gene editing ribonucleoprotein complex delivery carrier can achieve high delivery efficiency in the intracellular delivery process, is safe and effective, and does not require additional chemical modification, thereby saving production costs. BRIEF DESCRIPTION OF DRAWINGS

[0038] Figure 1 The mass spectrum (a) and the nuclear magnetic resonance hydrogen spectrum (b) of the cationic lipid analogue A1I2-1R2C18 are shown in the figure;

[0039] Figure 2 The mass spectrum (a) and the nuclear magnetic resonance hydrogen spectrum (b) of the cationic lipid analogue A1I2R2C18 are shown in the figure;

[0040] Figure 3 The mass spectrum (a) and the nuclear magnetic resonance hydrogen spectrum (b) of the cationic lipid analogue A1I2-3R2C18 are shown in the figure;

[0041] Figure 4 The figure shows the gene editing efficiency results of the cationic lipid analogues A1I2-1R2C18 (a), A1I2R2C18 (b) and A1I2-3R2C18 (c) in delivering a gene editing ribonucleoprotein complex (RNP) targeting the AAVS1 site;

[0042] Figure 5 The figure shows the particle size distribution of the nanocomposite formed in Example 3;

[0043] Figure 6 The figure shows the T7E1 enzyme cleavage experiment results of the cationic lipid analogue A1I2R2C18 in delivering Cas9 RNP protein on 293T cells (a and b), 293T-EGFP cells (c) and SW-480 cells (d), and the Sanger sequence results of T-A clones of four gene sites;

[0044] Figure 7 The figure shows the gene editing efficiency results of the cationic lipid analogue A1I2R2C18 on four gene sites (AAVS1, HBB, EGFP and KRAS) through T7E1 enzyme cleavage experiment and ImageJ software quantitative statistics, and comparison with the commercial delivery reagent CMAX;

[0045] Figure 8The fluorescence image (a, scale bar: 50 μm) and the relative mean fluorescence intensity (MFI) (b) of 293T-EGFP cells treated with RNP / A1I2R2C18 nanocomplex for 48 hours were detected by flow cytometry (FCM);

[0046] Figure 9 The particle size (a) and zeta potential (b) of a series of modified nanocomplexes (particles) obtained by modifying RNP / A1I2R2C18 nanocomplex with different concentrations of hyaluronic acid (HA);

[0047] Figure 10 The stability results of the modified nanocomplexes (particles) obtained by mixing hyaluronic acid with RNP / A1I2R2C18 nanocomplex in serum-free medium and serum medium containing 10% FBS;

[0048] Figure 11 The in vivo anti-tumor effect diagram mediated by RNP / A1I2R2C18 nanocomplex targeting the mutant KRAS site;

[0049] Figure 12 The T7E1 enzyme digestion experiment results diagram of the targeted mutant KRAS site in the tumor mediated by RNP / A1I2R2C18 nanocomplex by paratumor injection. DETAILED DESCRIPTION

[0050] In order to better illustrate the purpose, technical scheme and advantages of the present application, the present application will be further described below in combination with the drawings and specific examples.

[0051] In the following examples, the experimental methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are commercially available unless otherwise specified.

[0052] Example 1, synthesis and characterization of cationic lipid analogs

[0053] The synthesis route of the cationic lipid analogs of the present application is as follows:

[0054]

[0055] Among them, the amine compound m2 NH 2 is Carboxylic acid compound is Aldehyde compound is Isocyanide compound is

[0056] The specific preparation method of the cationic lipid analogues of the present embodiment is as follows: 1 mmol of isobutyraldehyde and 1 mmol of amine compound are added into 0.5 mL of methanol solution, respectively, and after reaction for 60 min, 1 mmol of carboxylic acid compound and 0.5 mmol of isocyanide are sequentially added, and reacted at 40℃ for 12 h. After the reaction is completed, the product is separated and purified by chromatographic column, wherein the mobile phase is a mixture of methanol and dichloromethane.

[0057] The raw materials used in the present embodiment and the structures of the synthesized cationic lipid analogues are shown in Table 1.

[0058] Table 1

[0059]

[0060] The cationic lipid analogues A1I2-1R2C18, A1I2R2C18 and A1I2-3R2C18 are selected as representative materials, and their structures are characterized. The mass spectrum and the nuclear magnetic resonance hydrogen spectrum of A1I2-1R2C18 are shown in Figure 1 The mass spectrum and the nuclear magnetic resonance hydrogen spectrum of A1I2R2C18 are shown in Figure 2 The mass spectrum and the nuclear magnetic resonance hydrogen spectrum of A1I2-3R2C18 are shown in Figure 3 The results of nuclear magnetic resonance hydrogen spectrum and mass spectrum are consistent with the structure of the expected cationic lipid analogue.

[0061] Example 2, intracellular effect of cationic lipid analogues A1I2-1R2C18, A1I2R2C18 and A1I2-3R2C18 on delivering gene editing ribonucleoprotein complex (RNP).

[0062] The specific operation method is as follows: first, an sgRNA (sgAAVS1) targeting AAVS1 (the target of AAVS1 is GGCTCCCTCCCAGGATCCTCTC, as shown in SEQ ID NO: 1) is prepared by the method of in vitro transcription IVT. 293T cells are inoculated into a 24-well plate overnight, and when the density of 293T cells reaches more than 75%, the Cas9 RNP protein delivery experiment is started.

[0063] Firstly, 1 μg of CRISPR-Cas9 protein was incubated with 0.5 μg of sgAAVS1 at 37 °C for 10 minutes to form a CRISPR-Cas9 / sgAAVS1 complex (Cas9 RNP), and then the CRISPR-Cas9 / sgAAVS1 complex was mixed with A1I2-1R2C18, A1I2R2C18 and A1I2-3R2C18, three cationic lipid analogues, respectively, and quickly mixed for 10-30 seconds, and then immediately diluted with 450 μL of serum-free DMEM medium to obtain a 500 μL system solution of Cas9 RNP / cationic lipid analogue. The dose of CRISPR-Cas9 was 1 μg per well, the dose of sgAAVS1 was 0.5 μg per well, and the doses of A1I2-1R2C18, A1I2R2C18 and A1I2-3R2C18 were 1, 2, 3 and 4 μg per well, respectively. After removing the cell culture medium and washing twice with PBS, 500 μL of the Cas9 RNP / cationic lipid analogue system solution was added, and incubated in a 37 °C incubator for 4 hours. The culture medium was removed, 500 μL of DMEM medium containing 10% serum was added, and incubated for another 48 hours. The total genomic DNA was extracted using a commercial kit, the target fragment (AAVS1-FP: CTATGTCCACTTCAGGACAGCATGT, AAVS1-RP: CCTCTTGGGAAGTGTAAGGAAGCTG, as shown in SEQ ID NO: 5-6) containing the mutation site was amplified by PCR, and then subjected to heating denaturation, annealing and renaturation treatment. Finally, 0.3 μL of T7E1 endonuclease was added, and the reaction was carried out at 37 °C for 30 minutes. Then, 2% agarose gel electrophoresis was performed to detect and analyze the enzyme digestion results.

[0064] Experimental results: from Figure 4The results show that the three cationic lipid analogues A1I2-1R2C18, A1I2R2C18 and A1I2-3R2C18 have gene editing efficiency in delivering Cas9 RNP protein. Among them, A1I2R2C18 has the highest gene editing delivery efficiency. At the same time, the results show that the nanocomposite formed by A1I2R2C18 at a dose of 2 μg and Cas9 RNP protein (the doses of CRISPR-Cas9 protein and sgAAVS1 are 1 μg and 0.5 μg, respectively) has the best gene editing efficiency in delivering to 293T cells. By comparing the structure of the similar molecules A1I2-1R2C18 and A1I2-3R2C18, the inventors found that A1I2R2C18 has better gene editing efficiency. The difference between the three molecules is the number of ethoxy repeating units in the linker position, and when there are 1 and 3 repeating units, the gene editing efficiency of the carrier material is general, and when there are 2 repeating units, the effect is the best, indicating that optimizing the structure of the linker is of great significance to improve the delivery and editing efficiency.

[0065] Example 3, Particle size distribution of the nanocomposite

[0066] The cationic lipid analogue A1I2R2C18 is complexed with a gene editing ribonucleoprotein complex (RNP) to form the RNP / A1I2R2C18 nanocomposite of the application, and dynamic light scattering (DLS) is used to characterize the size and surface potential of the nanocomposite.

[0067] The specific operation method is as follows: the ribonucleoprotein complex is quickly mixed with the A1I2R2C18 solution to be uniform, incubated at room temperature for 10-30 seconds, then 1 mL of deionized water is added for dilution, and then a laser nanoparticle size analyzer is used to detect the particle size distribution and surface potential of the nanoparticles in the solution.

[0068] Experimental results: from Figure 5 The results show that the nanocomposite formed by the A1I2R2C18 prepared by the application and the ribonucleoprotein complex has a particle diameter of about 460 nm as characterized by DLS.

[0069] Example 4, Gene editing experiment of cationic lipid analogue A1I2R2C18 delivering ribonucleoprotein complex (RNP) to different sites in different cells

[0070] Cationic lipid analogues A1I2R2C18 deliver Cas9 RNP proteins targeting AAVS1 and HBB sites into 293T cells, EGFP site into 293T-EGFP cells, and KRAS site into SW-480 cells, respectively. In addition, Sanger sequences of T-A clones of AAVS1 and HBB sites are obtained from 293T cells, Sanger sequences of T-A clones of EGFP site are obtained from 293T-EGFP cells, and Sanger sequences of T-A clones of KRAS site are obtained from SW-480 cells.

[0071] The specific operation method is as follows: first, target AAVS1 and HBB sgRNAs (sgAAVS1 and sgHBB) are prepared by in vitro transcription IVT method (the target of AAVS1 is GGCTCCCTCCCAGGATCCTCTC, as shown in SEQ ID NO: 1; the target of HBB is GGGTAACGGCAGACTTCTCCTC, as shown in SEQ ID NO: 2); target EGFP sgRNA (sgEGFP) (the target of EGFP is GTGAACCGCATCGAGCTGAA, as shown in SEQ ID NO: 3); target mutant KRAS gene sgRNA (sgKRAS) (the target of KRAS is GTTGGAGCTGATGGCGT, as shown in SEQ ID NO: 4). 293T cells, 293T-EGFP cells and SW-480 cells are inoculated into 24-well plates overnight, and when the cell density reaches more than 75%, the Cas9 RNP protein delivery experiment is started.

[0072] First, the CRISPR-Cas9 protein is incubated with sgAAVS1, sgHBB, sgEGFP and sgKRAS at 37°C for 10 minutes to form a CRISPR-Cas9 / sgRNA complex, and then the CRISPR-Cas9 / sgRNA complex is mixed with the cationic lipid analog A1I2R2C18, and after rapid mixing for 10-30 seconds, it is immediately diluted with 450 μL of serum-free DMEM medium, and finally 500 μL of the system solution of the RNP / A1I2R2C18 nanocomposite is obtained. The dose of CRISPR-Cas9 is 1 μg per well, the dose of sgRNA is 0.5 μg per well, and the dose of cationic lipid analog A1I2R2C18 is 2 μg. Remove the cell culture medium, wash twice with PBS, then add 500 μL of the system solution of the RNP / A1I2R2C18 nanocomposite, and incubate in a 37°C incubator for 4 hours. Remove the culture medium, add 500 μL of DMEM medium containing 10% serum, and continue to culture for 48 hours. Use a commercial kit to extract total genomic DNA, PCR amplify the target fragment with the mutation site, and the primers are shown in Table 2.

[0073] Table 2

[0074]

[0075] After heating denaturation, annealing and renaturation, 0.3 μL of T7E1 endonuclease is added, and after 37°C reaction for 30 minutes, 2% agarose gel electrophoresis is used to detect and analyze the enzyme cutting results.

[0076] The experimental steps of Sanger sequence detection of T-A cloning are as follows: Taq DNA polymerase is used for gene cloning, PCR amplification, and gel purification after running; connection reaction: connection with T vector and room temperature incubation for 5 minutes; next transformation: 100 μL of competent cells are added to the above-mentioned 10 μL of connection product, and then mixed and stirred by gently blowing; 5 minutes of ice incubation, 42°C heat shock for 45 seconds, and then quickly transferred to ice bath for 2 minutes; then plate culture overnight and sequencing.

[0077] The experimental results are as follows: Figure 6 The results of the T7E1 enzyme cutting experiment for gene editing effect of the cationic lipid analog A1I2R2C18 prepared in the application on 293T cells, 293T-EGFP cells and SW-480 cells, and the Sanger sequence results of T-A cloning of four gene sites show that the cationic lipid analog A1I2R2C18 prepared in the application can safely and efficiently deliver Cas9 RNP protein to the corresponding cells to edit the sites of related genes, and is superior to the commercial reagent Lipofectamine CRISPRMAX (CMAX).

[0078] Example 5, quantitatively statistics the gene editing efficiency of four gene sites (AAVS1, HBB, EGFP and KRAS) by T7E1 enzyme cutting experiment and ImageJ software.

[0079] The specific operation method is as follows:

[0080] Brief description of T7E1 enzyme cutting experiment: using commercial kit to extract total genomic DNA, PCR amplification of the target fragment with mutation site, heating denaturation, annealing and renaturation treatment, finally adding 0.3 μL of T7E1 endonuclease, 37℃ reaction for 30 minutes, running 2% agarose gel electrophoresis to detect and analyze the enzyme cutting results. The efficiency of the gene editing cutting band of four gene sites (AAVS1, HBB, EGFP and KRAS) is quantitatively statistical by ImageJ software as follows: first, open the gel image to be analyzed by File-Open to analyze the gray scale of the band, then convert the picture to an 8-bit gray scale image, then use the rectangle tool to frame an optional band, and then use the Analyze / gels / select first lane to number the band, and then use the Wand tool to click the middle area of each peak to calculate the area of each peak one by one. The calculation result is displayed in the Result window, which can be exported to an xls file by File. Finally, the Indel percentage calculation formula: [1-(1-cutting band intensity value)1 / 2]x100%, the cutting efficiency value can be obtained, and then the quantitative statistics can be obtained.

[0081] The experimental results are as follows: Figure 7 The results show that the cationic lipid analog A1I2R2C18 prepared in the application can safely and efficiently deliver Cas9 RNP protein into the corresponding cells to edit four gene sites (AAVS1, HBB, EGFP and KRAS), and is better than the commercial reagent Lipofectamine CRISPRMAX (CMAX).

[0082] The results show that the cationic lipid analog A1I2R2C18 prepared in the application can safely and efficiently deliver Cas9 RNP protein into the corresponding cells to edit four gene sites (AAVS1, HBB, EGFP and KRAS), and is better than the commercial reagent Lipofectamine CRISPRMAX (CMAX).

[0083] Example 6, effect of RNP / A1I2R2C18 nanocomposite on 293T-EGFP cells

[0084] The fluorescence intensity and distribution in the cells after 293T-EGFP cells were treated with RNP / A1I2R2C18 nanocomposites for 48 hours were observed by fluorescence microscopy. The relative average fluorescence intensity of 293T-EGFP cells treated with RNP / A1I2R2C18 nanocomposites for 48 hours was analyzed by flow cytometry.

[0085] The specific operation method is as follows: 293T-EGFP cells were inoculated into a 24-well plate overnight, and when the cell density reached more than 75%, the Cas9 RNP protein delivery experiment was started. First, the CRISPR-Cas9 protein was incubated with sgEGFP at 37°C for 10 minutes to form a CRISPR-Cas9 / sgRNA complex, and then the CRISPR-Cas9 / sgRNA complex was mixed with the cationic lipid analog A1I2R2C18. After rapid mixing for 10-30 seconds, 450 μL of serum-free DMEM medium was used for dilution, and finally 500 μL of system solution of Cas9 RNP / A1I2R2C18 (RNP / A1I2R2C18 nanocomposite) was obtained. The dose of CRISPR-Cas9 was 1 μg per well, the dose of sgRNA was 0.5 μg per well, and the optimal dose of cationic lipid analog A1I2R2C18 was 2 μg. The cell culture medium was removed, washed twice with PBS, and then 500 μL of system solution of RNP / A1I2R2C18 nanocomposite was added, and incubated in a 37°C incubator for 4 hours. The culture medium was removed, 500 μL of DMEM medium containing 10% serum was added, and the culture was continued for 48 hours. Then the fluorescence intensity and distribution in the cells were observed under a fluorescence microscope. The cells in the well plate were collected for flow cytometry analysis and detection of the relative average fluorescence intensity.

[0086] The experimental results are as follows: Figure 8 The results show that by observing the fluorescence intensity and distribution in the cells by fluorescence microscopy and flow cytometry analysis, compared with the commercial reagent CMAX positive control group, the RNP / A1I2R2C18 nanocomposite treatment group has lower fluorescence intensity, thereby indicating that the cationic lipid analog A1I2R2C18 can safely and efficiently deliver Cas9 RNP protein to 293T-EGFP cells for efficient gene editing at the EGFP site.

[0087] Example 7, preparation of modified RNP / A1I2R2C18 nanocomposite

[0088] A modified nanocomposite includes hyaluronic acid and RNP / A1I2R2C18 nanocomposite. The concentration of hyaluronic acid is 0.1-2 mg / mL.

[0089] Preparation of the above modified nanocomplex: Different concentrations of hyaluronic acid (0.1-2 mg / mL) were added dropwise to the RNP / A1I2R2C18 nanocomplex solution, and HA / RNP / A1I2R2C18 nanocomplexes (modified nanocomplexes) were obtained by electrostatic coating. Then, the solution mixture was gently stirred at room temperature for 30 minutes. The optimal concentration of hyaluronic acid in the preparation of HA / RNP / A1I2R2C18 nanocomplexes was determined by DLS.

[0090] Experimental results: From the results of Figure 9 The results show that DLS determination shows that the optimal concentration of hyaluronic acid for coating is 0.2 mg / mL. After modification of hyaluronic acid, the zeta potential of RNP / A1I2R2C18 nanocomplexes changes from positive (about +19 mV) to negative charge (about -31 mV).

[0091] Example 8, verification of the stability and serum resistance of HA / RNP / A1I2R2C18 nanocomplexes (modified nanocomplexes)

[0092] Serum resistance studies were carried out in serum-containing medium, and serum-free medium was used as a negative control group.

[0093] The specific operation method is as follows: the prepared HA / RNP / A1I2R2C18 nanocomplexes with HA concentration of 0.2 mg / mL were added to serum-free DMEM medium and DMEM medium containing 10% fetal bovine serum (FBS) for incubation for a period of time, and the particle size change of HA / RNP / A1I2R2C18 nanocomplexes was detected by dynamic light scattering instrument (DLS) at 0.5 h, 24 h, 36 h and 48 h, respectively, to obtain the stability results.

[0094] Experimental results: From the results of Figure 10 The results show that DLS analysis shows that the particle size of HA / RNP / A1I2R2C18 nanocomplexes incubated in medium containing 10% FBS for 0.5 h is only slightly larger than that in serum-free medium at the same incubation time, and further incubation does not cause a significant increase in particle size. Prolonged incubation time in serum-containing medium does not further cause significant changes in particle size. Therefore, the serum resistance of HA / RNP / A1I2R2C18 nanocomplexes will effectively prolong the circulation time in the blood stream in vivo.

[0095] Example 9, in vivo anti-tumor effect mediated by RNP / A1I2R2C18 nanocomplexes targeting mutant KRAS sites

[0096] The administration route was peritumoral injection of the RNP / A1I2R2C18 nanocomposite. The mean tumor growth volume changes in different treatment groups were monitored and recorded three weeks after treatment.

[0097] The specific operation method is as follows: In the SW-480 xenograft primary tumor model, SW-480 cells (1×10⁻⁶) were... 6 The tumor was subcutaneously injected into the right side of BALB / c nude mice. Seven days later, when the tumor reached approximately 50-80 mm... 3 When the size of the tumor was determined, mice were randomly divided into four groups and treated with a control group, an RNP-only group, an RNP / A1I2R2C18 group, and a mock RNP / A1I2R2C18 group. The nanocomposite was injected subcutaneously around the tumor once a week for three weeks, and the tumor volume of the nude mice was measured.

[0098] Experimental results: From Figure 11 The results showed that the changes in mean tumor growth volume in different treatment groups were monitored and recorded three weeks after treatment. Compared with the control group, subcutaneous injection of RNP / A1I2R2C18 nanocomposite to the tumor significantly inhibited tumor growth volume.

[0099] Example 10: T7E1 restriction enzyme cleavage experiment mediated by RNP / A1I2R2C18 nanocomplex targeting mutant KRAS sites in tumors.

[0100] The specific operating method is as follows: Tumor tissues from the control group, the RNP-only group, the RNP / A1I2R2C18 group, and the Mock RNP / A1I2R2C18 group were collected. Total genomic DNA was extracted using a commercial kit. The target fragment with the mutation site was amplified by PCR (KRAS-FP: TGCAGTCAACTGGAATTTTCAT, as shown in SEQ ID NO: 9; KRAS-RP: GTTGGATCATATTCGTCCACAA, as shown in SEQ ID NO: 10). The fragments were then subjected to heat denaturation, annealing, and renaturation treatment. Finally, 0.3 μL of T7E1 endonuclease was added, and the reaction was carried out at 37°C for 30 minutes. The enzyme digestion results were then detected and analyzed by 2% agarose gel electrophoresis.

[0101] Experimental results: From Figure 11 The results showed that the RNP / A1I2R2C18 nanocomposite, when administered via subcutaneous injection around the tumor, had a high gene editing effect on the targeted mutant KRAS sites in the tumor tissue, indicating that the cationic lipid analog molecule A1I2R2C18 delivering Cas RNP protein has a certain inhibitory effect on tumor growth.

[0102] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application and not to limit the scope of protection of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present application. SEQUENCE LISTING <110> Sun Yat-Sen University <120> Use of cationic lipid analogues in intracellular delivery of gene editing ribonucleoprotein complexes <130> 27 January 2022 <160> 12 <170> PatentIn version 3.3 <210> 1 <211> 22 <212> DNA <213> Artificial synthesis <400> 1 ggctccctcccaggatcctctc 22 <210> 2 <211> 22 <212> DNA <213> Artificial synthesis <400> 2 gggtaacggcagacttctcctc 22 <210> 3 <211> 20 <212> DNA <213> Artificial synthesis <400> 3 gtgaaccgcatcgagctgaa 20 <210> 4 <211> 17 <212> DNA <213> Artificial synthesis <400> 4 gttggagctgatggcgt 17 <210> 5 <211> 25 <212> DNA <213> Artificial synthesis <400> 5 ctatgtccac ttcaggacag catgt 25 <210> 6 <211> 25 <212> DNA <213> Synthetic <400> 6 cctcttggga agtgtaagga agctg 25 <210> 7 <211> 25 <212> DNA <213> Synthetic <400> 7 aactcctaag ccagtgccag aagag 25 <210> 8 <211> 25 <212> DNA <213> Synthetic <400> 8 caggccatca ctaaaggcac cgagc 25 <210> 9 <211> 18 <212> DNA <213> Synthetic <400> 9 atggtgagca agggcgag 18 <210> 10 <211> 23 <212> DNA <213> Synthetic <400> 10 ttacttgtac agctcgtcca tgc 23 <210> 11 <211> 22 <212> DNA <213> Synthetic <400> 11 tgcagtcaac tggaattttc at 22 <210> 12 <211> 22 <212> DNA <213> Artificial synthesis <400> 12 gttggatcat attcgtccac aa 22

Claims

1. A nanocomposite, characterized in that, comprising a cationic lipid analog and a ribonucleoprotein complex; the cationic lipid analog has any one of the following 36 structures: 。 2. The nanocomposite of claim 1, wherein, the mass ratio of the cationic lipid analog and the ribonucleoprotein complex is (1-4):

1.

3. The nanocomposite of claim 1, wherein, the cationic lipid analog is any one of A1I2R2C16, A1I2R2C18, A1I2R2C19, A1I2R2C20, A1I2R3C16, A1I2R3C18, A1I2R3C19, A1I2R3C20, A1I2R11C16, A1I2R11C18, A1I2R11C19, A1I2R11C20, A1I2-1R2C18, A1I2-1R2C19, A1I2-1R2C20, A1I2-3R2C18, A1I2-3R2C19, A1I2-3R2C20.

4. The nanocomposite of claim 3, wherein, the cationic lipid analog is A1I2R2C18, A1I2-1R2C18 or A1I2-3R2C18.

5. A modified nanocomposite, characterized in that, comprising hyaluronic acid and the nanocomplex of any one of claims 1-4.

6. Use of the nanoparticle complex according to any one of claims 1 to 4 or the modified nanoparticle complex according to claim 5 in the preparation of an antitumor drug, wherein the ribonucleoprotein complex is a gene editing ribonucleoprotein complex, and the targeted site of gene editing is KRAS the site. KRAS The target sequence of the site is shown as SEQ ID NO:

4.

7. Use of the cationic lipid analog in the nanocomplex of any one of claims 1-4 in the preparation of an intracellular delivery carrier of a gene editing ribonucleoprotein complex.

Images