M1 macrophage targeting polypeptides and uses thereof

By designing and synthesizing the M1 macrophage targeting peptides M1pep1 and M1pep2, the problem of the lack of M1 macrophage targeting peptides in the existing technology was solved, and specific binding to M1 macrophages was achieved, which has good application prospects in the diagnosis and treatment of inflammatory diseases, metabolic diseases and tumors.

CN116554273BActive Publication Date: 2025-10-10FIRST AFFILIATED HOSPITAL OF DALIAN MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310464016.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-04-26
Publication Date
2025-10-10
Estimated Expiration
2043-04-26

AI Technical Summary

Technical Problem

The existing technology lacks high-affinity and high-specificity molecular detection methods for M1 macrophages. The application of targeting peptides in M2 macrophages has been reported, but the research on M1 macrophage targeting peptides has not been reported.

Method used

Two M1 macrophage-targeting peptides, M1pep1 and M1pep2, were designed and synthesized, namely FSDDCYDCRIPR and VHAVPIRTIYYP, respectively. They were prepared by phage panning and chemical synthesis methods and used to prepare peptide-conjugated drugs and probes to achieve specific binding to M1 macrophages.

Benefits of technology

It achieves highly specific binding to M1 macrophages and has good application prospects in the diagnosis and treatment of inflammatory diseases, metabolic diseases and tumors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116554273B_ABST
    Figure CN116554273B_ABST
Patent Text Reader

Abstract

The application discloses M1 type macrophage targeting polypeptides and application thereof, and belongs to the technical field of biological medicine. The application provides M1 type macrophage targeting polypeptides M1pep1 and M1pep2. Firstly, positive sequences are obtained through construction of a phage library and phage panning, polypeptides are obtained through a chemical synthesis method, and finally, the macrophage targeting polypeptides M1pep1 and M1pep2 are obtained through verification by flow cytometry and laser confocal experiments. The macrophage targeting polypeptides obtained by the application have small molecular weights, can be prepared into polypeptide coupled drugs or small molecule probes, and have good application prospects in the fields of diagnosis or treatment of diseases in which M1 type macrophages are widely involved, such as inflammatory diseases, metabolic diseases and tumors.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a M1 type macrophage targeting polypeptide and application thereof. BACKGROUND

[0002] Macrophages are an important part of the human innate immune system, widely distributed in connective tissue and various parenchymal organs. The phenotype and function of mature macrophages have high plasticity and heterogeneity, mainly manifested as: polarized into classical activated macrophages (M1 type) stimulated by IFN-γ and / or LPS and differentiated into alternative activated macrophages (M2 type) stimulated by IL-4 / 13. M1 type macrophages are rich in lysosomal granules, can participate in pathogen clearance by producing reactive oxygen intermediates (ROI), nitric oxide (NO) and releasing lysosomal enzymes, and participate in inflammatory response by synthesizing cytokines such as IL-1β, IL-6, TNF-α and chemotactic factors such as CCL2, CCL3 and CXCL8. Adipose tissue macrophages (ATMs) infiltrate adipose tissue in large quantities during obesity, and their phenotypes can also be divided into M1 type (pro-inflammatory, pro-insulin resistance) and M2 type; diet-induced obesity can cause ATMs in leaner animals to change from M2 type to M1 type. In addition, tumor-associated macrophages (TAMs), as an important part of the tumor microenvironment (TME), mainly come from bone marrow and peripheral blood, interact with tumor cells by secreting cytokines, and are closely related to tumor growth, metastasis, angiogenesis and lymphangiogenesis. TAMs have morphological and functional diversity, mainly divided into: M1 type that inhibits tumor growth and M2 type that promotes tumor growth. In the early stage of tumor formation, the macrophages infiltrating the tumor tissue are mainly of M1 type, which are stimulated by IFNγ and IL-12 to secrete various pro-inflammatory cytokines and inhibit tumor growth. In summary, M1 type macrophages play an important role in the occurrence and development of inflammatory diseases, metabolic diseases and tumors.

[0003] Currently, the field of precision medicine urgently needs to establish new methods for molecular detection with high affinity and high specificity for specific targets. Targeted polypeptides refer to a class of polypeptide molecules less than 30 amino acids targeting specific biological targets, which have the characteristics of small molecular weight, high activity, low immunogenicity, high batch repeatability, etc. At the same time, due to the close assembly of polypeptides, it can avoid being degraded by enzymes and has biological stability. Polypeptides are easy to synthesize and carry image probes and drug molecules, and have the ability to bind to target tissues with high specificity, which can enhance the targeting of conjugates, improve effectiveness and reduce adverse reactions. Currently, the screening and application of targeted polypeptides have become the research frontier in the field of molecular recognition. In 2013, researchers first discovered a polypeptide M2pep that specifically binds to M2-type macrophages, however, to date, no related research on M1-type macrophage targeting polypeptides has been reported. SUMMARY

[0004] Therefore, the purpose of the present application is to provide M1-type macrophage targeting polypeptides M1pep1 and M1pep2, which have small molecular weight, can carry drugs, and can also be connected to small molecule probes, for preparing polypeptide conjugate drugs and polypeptide conjugate probes that specifically target M1-type macrophages, and have good application prospects in the field of diagnosis or treatment of inflammatory diseases, metabolic diseases, and tumors in which M1-type macrophages are widely involved.

[0005] The purpose of the present application is achieved by the following means:

[0006] The present application provides M1-type macrophage targeting polypeptides, the amino acid sequence of which is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0007] Another aspect of the present application provides a gene encoding the above-mentioned M1-type macrophage targeting polypeptide.

[0008] Based on the above technical solution, further, the nucleotide sequence of the gene is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0009] The present application also provides the use of the above-mentioned M1-type macrophage targeting polypeptide and the gene encoding the above-mentioned M1-type macrophage targeting polypeptide in the preparation of polypeptide conjugate drugs or polypeptide conjugate probes.

[0010] Based on the above technical solution, further, the polypeptide conjugate drug or polypeptide conjugate probe is used for diagnosing or treating inflammatory diseases, metabolic diseases, and tumors.

[0011] The present application has the following beneficial effects compared with the prior art:

[0012] The application provides two M1 type macrophage targeting polypeptides M1pep1 and M1pep2 which can be highly specifically combined with M1 type macrophages, and can be prepared into polypeptide conjugated drugs or small molecule probes, and have good application prospects in the diagnosis or treatment of inflammatory diseases, metabolic diseases and tumors and other diseases in which M1 type macrophages are widely involved. BRIEF DESCRIPTION OF DRAWINGS

[0013] In order to more clearly illustrate the embodiments of the application, the drawings involved in the embodiments will be briefly introduced below.

[0014] Figure 1 For flow cytometry verification of M1 type macrophage targeting of 15 positive polypeptides, (A) is the flow cytometry detection result, and (B) is the ratio of the binding rate of 15 positive polypeptides to M1 type macrophages and M0 type macrophages.

[0015] Figure 2 For laser confocal verification of M1 type macrophage targeting of 15 positive polypeptides.

[0016] Figure 3 Structural diagrams of M1 type macrophage affinity polypeptides M1pep1 and M1pep2. DETAILED DESCRIPTION

[0017] The application will be described in detail below in combination with the embodiments, but the embodiments of the application are not limited thereto. Obviously, the embodiments described below are only some of the embodiments of the application, and other similar embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the application.

[0018] Example 1: Phage panning

[0019] Inducing M1 type macrophages: (1) Culturing mouse macrophages RAW264.7 to the number for panning; (2) using 1 ug / ml LPS+20 ng / ml IFN-γ to induce cells for 24 hours to obtain positive cells, and RAW264.7 cells without treatment as negative control.

[0020] Phage library: constructing heptapeptide library and dodecapeptide library.

[0021] Phage panning: entrusted to Pu Jian Biotechnology (Wuhan) Co., Ltd.: after cell panning, eluting phage amplification, immunotube panning, polyclonal phage FACs detection, monoclonal phage FACs detection, positive clone phage FACs detection, finally obtaining 6 7-peptides and 9 12-peptides positive sequences, and the specific sequences are shown in Table 1.

[0022] Table 1. Positive sequences obtained after phage panning

[0023]

[0024] Example 2 Polypeptide synthesis

[0025] The positive polypeptide obtained from the screening of Example 1 was synthesized by chemical synthesis method, and the synthesis process was as follows:

[0026] The reaction column was first placed in AM resin and 20 ml DCM, and oscillated for 30 min, and activated for use. Then, 3 times the resin molar amount of protected amino acid was added, 3 times the resin molar amount of HBTU was dissolved with a small amount of DMF, 10 times the resin molar amount of DIEA was immediately added, and reacted for 30 min. If it was colorless, it was a positive reaction, and if it was blue, it needed to be re-condensed. 20 ml of 20% piperidine / DMF solution was added, 5 min later, it was drawn out, and then 20 ml of 20% piperidine / DMF solution was added, oscillated for 15 min, and if it turned dark blue, it was a positive reaction, and the next amino acid could be connected. If it did not change color, it was negative, and needed to be re-protected. 3 times the resin molar amount of protected amino acid was added, 3 times the resin molar amount of HBTU was dissolved with a small amount of DMF, 10 times the resin molar amount of DIEA was immediately added, and reacted for 30 min. If it was colorless, it was a positive reaction, and if it was blue, it needed to be re-condensed. The above method was repeated to sequentially connect the remaining amino acids. The reaction was washed with DMF 3 times, DCM 3 times, and methanol 3 times, and finally the polypeptide resin was drawn out. According to the volume ratio of each component: TFA (94.5%), water (2%), EDT (2.5%), and TIS (1%), 15 ml of cleavage solution was prepared. The resin was loaded into a flask and oscillated at a constant temperature (30°C) for 2 h. The cleavage solution was blown dry with nitrogen as much as possible, poured into a centrifuge tube, slowly poured into ether, sealed, centrifuged for 5 min, and the supernatant was discarded, and the white solid below was obtained. Then washed with ether 6 times, and then dried at room temperature, to obtain the polypeptide.

[0027] Example 3 Verification of the targeting of the polypeptide

[0028] The targeting of the polypeptide prepared in Example 2 was evaluated by flow cytometry and laser confocal microscope experiments:

[0029] Flow cytometry: (1) The polypeptide was linked to the FITC fluorescent group powder, dissolved in PBS buffer, prepared into a 1 mM stock solution, and stored at -20°C for standby, and diluted into a 10 μM working solution with culture medium before experiment; (2) RAW264.7 cells were inoculated in a 6-well plate and cultured for 24 h; (2) The positive cell group was induced with 1 ug / ml LPS + 20 ng / ml IFN-γ for 24 h to obtain M1 type macrophages; RAW264.7 cells without treatment were used as a negative control; (3) 1 ml of the polypeptide working solution was added to the negative cell group and the positive cell group respectively, and cultured in the dark for 4 h; (4) The cells in the 6-well plate were collected and washed once with ice PBS; (5) The binding of the polypeptide and the M1 type macrophages was analyzed using a cell flow cytometer, with an excitation wavelength of 495 nm and an emission wavelength of 519 nm.

[0030] Laser confocal test: (1) The polypeptide was linked to the FITC fluorescent group powder, dissolved in PBS buffer, prepared into a 1 mM stock solution, and stored at -20°C for standby, and diluted into a 10 μM working solution with culture medium before experiment; (2) RAW264.7 cells were inoculated in a laser confocal culture dish and cultured for 24 h; (3) The positive cell group was induced with 1 ug / ml LPS + 20 ng / ml IFN-γ for 24 h to obtain M1 type macrophages; RAW264.7 cells without treatment were used as a negative control; (4) 1 ml of the polypeptide working solution was added to the negative cell group and the positive cell group respectively, and cultured in the dark for 4 h; (5) The cells were fixed with a 4% paraformaldehyde solution at room temperature for 20 min; (6) The Janelia Fluor® 594-washed anti-Phalloidin antibody (1:1000) was added and incubated in the dark for 2 h; (7) The DAPI solution was added and incubated for 30 min. (8) The binding of the polypeptide and the M1 type macrophages was analyzed using a laser confocal microscope, with a DAPI excitation wavelength of 359 nm and an emission wavelength of 461 nm; a Janelia Fluor® 594-washed anti-Phalloidin excitation wavelength of 590 nm and an emission wavelength of 618 nm; and a polypeptide-FITC excitation wavelength of 495 nm and an emission wavelength of 519 nm.

[0031] Figure 1Flow cytometry was used to verify the M1 macrophage targeting of 15 positive peptides. Blank was a blank control, 1-15 were negative controls (the binding percentages of the 15 positive peptides to M0 macrophages), and LPS IFN-γ+1 to LPS IFN-γ+15 were the binding percentages of the 15 positive peptides to M1 macrophages. The first two positive peptides with the largest M1 / M0 ratio were selected as peptides targeting M1 macrophages and named M1pep1 and M1pep2. The amino acid sequence of M1pep1 is: FSDDCYDCRIPR (SEQ ID NO: 1); the amino acid sequence of M1pep2 is: VHAVPIRTIYYP (SEQ ID NO: 2); the gene sequence encoding M1pep1 is: TTTAGTGATGATTGTTATGATTGTCGGATTCCTCGG (SEQ ID NO: 3); the gene sequence encoding M1pep2 is: GTTCATGCGGTTCCGATTCGTACGATTTATTATCCT (SEQ ID NO: 4). ID NO: 4).

[0032] Figure 2 Laser confocal microscopy was used to verify the M1 macrophage targeting of the 15 positive peptides. The relative positions of the peptides and macrophages were located by laser confocal microscopy. It can be seen that M1pep1 and M1pep2 have a higher affinity for M1 macrophages.

[0033] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An M1 macrophage targeting polypeptide, characterized in that: The amino acid sequence thereof is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

2. A gene encoding the M1 macrophage targeting polypeptide according to claim 1.

3. The gene according to claim 2, characterized in that The nucleotide sequence of the gene is shown in SEQ ID NO: 3 or SEQ ID NO:

4.

4. Use of the M1 macrophage targeting polypeptide according to claim 1 or the gene according to claim 2 or 3 in the preparation of a polypeptide-coupled drug or polypeptide-coupled probe targeting M1 macrophages.

Citation Information

Patent Citations

  • Tumor blood vessel and M1 type macrophage targeting peptide and application thereof

    CN108178783A

  • Peptides targeting macrophages and conjugates, compositions and uses thereof

    CN115996942A