A nucleic acid encoding human hgf and use thereof

By optimizing the nucleic acid sequence encoding human HGF, including the ORF, 5' cap, 5' UTR, 3' UTR, and poly-A sequence, the problems of unstable and inefficient protein expression in existing technologies were solved, achieving higher protein expression levels and molecular stability.

CN116590298BActive Publication Date: 2026-03-17PEKING UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-31
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

In the existing technology, the nucleic acid sequence encoding human HGF has problems of unstable protein expression and low efficiency. The presence of synonymous codons leads to large differences in the stability and protein expression efficiency of different nucleic acid sequences in cells.

Method used

A nucleic acid encoding human HGF was designed, containing a specific open reading frame (ORF) sequence that has high homology with the nucleic acid sequences of SEQ ID NO:21-31, and includes a 5' cap, 5' UTR, 3' UTR, and poly-A sequence. By optimizing the sequence design of these elements, the protein expression level was improved.

Benefits of technology

It achieves higher protein expression levels than the natural sequence, with more stable molecules and protein expression levels increased by at least 10%-50%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116590298B_ABST
    Figure CN116590298B_ABST
Patent Text Reader

Abstract

This invention relates to a nucleic acid encoding human HGF and its applications. The nucleic acid comprises one or more open reading frames (ORFs), and the ORF nucleic acid sequence has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence homology with nucleic acid sequences selected from SEQ ID NO:21-31. This invention provides a nucleic acid encoding human HGF, nucleic acid constructs, vectors, cells, and drugs thereof, wherein the nucleic acid has a protein expression level superior to that of the native sequence.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a nucleic acid encoding human HGF and its applications. Background Technology

[0002] Hepatocyte growth factor (HGF) is a multifunctional cytokine. The HGF / c-Met system is involved in cell survival, differentiation, proliferation, anti-inflammation and anti-fibrosis, and plays an important role in embryogenesis, wound healing, angiogenesis, tissue and organ regeneration, morphogenesis and carcinogenesis.

[0003] The phenomenon of a single amino acid having two or more codons is called codon degeneracy. Synonymous codons typically differ at the third base. The presence of synonymous codons allows for multiple different nucleic acid coding sequences for a single protein or polypeptide sequence, and these different nucleic acid sequences vary considerably in terms of stability and protein expression efficiency in cells. Finding optimal sequence designs is one of the key research areas in nucleic acid drug development. Summary of the Invention

[0004] To address the problems existing in the prior art, the present invention provides a nucleic acid encoding human HGF, a nucleic acid construct, a vector, a cell and a drug thereof, wherein the nucleic acid has a protein expression level superior to that of the natural sequence.

[0005] The purpose of this invention is to provide a nucleic acid.

[0006] The purpose of this invention is to provide a construct containing the above-mentioned nucleic acid.

[0007] Another object of the present invention is to provide a carrier, cell, and drug containing the above-mentioned nucleic acid.

[0008] According to a specific embodiment of the present invention, the nucleic acid encoding human HGF comprises one or more open reading frames (ORFs), wherein the ORF nucleic acid sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence homology with the nucleic acid sequences selected from SEQ ID NO:21-31. The nucleic acid exhibits a protein expression level superior to that of the native sequence.

[0009] Furthermore, the ORF nucleic acid sequence is selected from SEQ ID NO:21-31 or its transcribed RNA sequence.

[0010] Furthermore, the nucleic acid also contains a 5′ cap.

[0011] Furthermore, the 5' hat is selected from m7G5'ppp5'Np, m7G5'ppp5'NmpNp or m7G5'ppp5'NmpNmpNp.

[0012] Furthermore, the nucleic acid also contains a 5′UTR.

[0013] Furthermore, the 5′UTR is selected from one or a combination of SEQ ID NO:1-8.

[0014] Furthermore, the nucleic acid also contains a 3′UTR.

[0015] Furthermore, the 3′UTR is selected from one or a combination of SEQ ID NO:9-17.

[0016] Furthermore, the nucleic acid also contains a poly-A sequence, which contains 70-150 nucleotides.

[0017] Furthermore, the poly-A sequence contains a sequence selected from SEQ ID NO:18 or 19.

[0018] Further, it comprises sequences selected from SEQ ID NO:32, 33, 34, 35, 56, 57, 58, 60, 61, 63, 65 or their transcribed RNA sequences.

[0019] Furthermore, the nucleic acid contains one or more modified nucleosides selected from pseudouridine, N1-methyl-pseudouridine, or 5-methylcytidine.

[0020] Furthermore, the nucleic acid is selected from DNA or mRNA.

[0021] Furthermore, the nucleic acid has a protein expression level superior to that of the natural sequence, with an expression level at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% higher.

[0022] A vector containing the nucleic acid.

[0023] A cell containing the nucleic acid.

[0024] A pharmaceutical composition containing the said nucleic acid.

[0025] A method for expressing a polypeptide in a mammal, the method comprising contacting cells with the nucleic acid or the pharmaceutical composition thereof.

[0026] The nucleic acid or the pharmaceutical composition is used in the preparation of a medicament for treating or preventing a disease. Preferably, the disease is a disease of insufficient HGF expression.

[0027] Unless otherwise stated, the terms have their usual meanings.

[0028] In this invention, "polypeptide" or "protein" refers to a polymer composed of amino acids linked by peptide bonds. The amino acids are selected from 20 natural amino acids or other non-natural amino acids. The 20 natural amino acids are glycine, alanine, valine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine.

[0029] Nucleotides are a class of compounds composed of purine or pyrimidine bases, ribose or deoxyribose, and phosphate.

[0030] "Nucleic acid" refers to a polymer of nucleotides linked by 3',5'-phosphodiester bonds. Nucleic acids are single-stranded or double-stranded deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) molecules and their hybrid molecules. Examples of nucleic acid molecules include, but are not limited to, messenger RNA (mRNA), microRNA (miRNA), small interfering RNA (siRNA), self-amplifying RNA (saRNA), and antisense oligonucleotides (ASO). Preferably, the nucleic acid is mRNA.

[0031] Nucleic acids can be further chemically modified. Preferably, the chemical modification of mRNA is selected from one or a combination of pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, and 5-methylcytosine.

[0032] An open reading frame (ORF) is a base sequence located between the start and stop codons that encodes a protein. mRNA molecules contain an ORF and optionally further include expression regulatory sequences. Typical expression regulatory sequences include, but are not limited to, a 5' cap, a 5' untranslated region (5' UTR), a 3' untranslated region (3' UTR), a polyadenylated nucleotide sequence (polyA), and a miRNA binding site.

[0033] The 5' cap of mRNA is formed by a guanylic acid nucleotide linked to the 5' end of the mRNA via a 5'-5' triphosphate bond. This 5' guanylic acid nucleotide can be further modified, for example, by methylation to produce an N7-methyl-guanylic acid residue. The first or second nucleotide at the 5' end of the mRNA can be further modified, for example, by 2'-O-methylation of the ribose moiety. Examples of 5' caps include, but are not limited to, m7G5'ppp5'Np (type O), m7G5'ppp5'NmpNp (type I), and m7G5'ppp5'NmpNmpNp (type II). The 5' cap structure of mRNA provides a signal for ribosome recognition of mRNA and assists in ribosome binding to mRNA. The cap structure increases the stability of mRNA and protects it from degradation by 5'→3' exonucleases. In some embodiments, the cap is absent.

[0034] The untranslated region (UTR) is capable of being transcribed but not translated. A 5' UTR includes the sequence from the transcription start site to the start codon, but excludes the start codon. A 3' UTR includes the sequence from the stop codon to the transcription termination signal, but excludes the stop codon. Examples of UTRs include, but are not limited to, the sequences described in Table 1.

[0035] Table 1. 17 different sequences of UTR

[0036] Number Sequence SEQ ID NO. 5' UTR-1 AGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC 1 5' UTR-2 GGGCGAACTAGTACTCTTCTGGTCCCCACAGACTCGCCACC 2 5' UTR-3 TCTCAACACAACATATACAAAACAAACGAATCTCAAGCAATCAAGCATTCTACTTCTATTGCAGCAATTTAAATCATTTCTTTTAAAGCAAAAGCAATTTTCTGAAAATTTTCACCATTTACGAACGATAGC 3 5' UTR-4 AAGTTGAAAGTCGCCGCTGACAGTTGTGACCAGGATCGGACAGGTGAAC 4 5' UTR-5 ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC 5 5' UTR-6 ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACC 6 5' UTR-7 ACTCCCCGAACCACTCAGGGTCCTGTGGACAGCTCACCTAGCTGCA 7 5' UTR-8 ATAAACGCTCAACTTTGGCC 8 3' UTR-1 GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGA 9 3' UTR-2 GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC 10 3' UTR-3 CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACC 11 3' UTR-4 GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC 12 3' UTR-5 GCAGCTCGACGCCCGTTCGCTTGGTTCTGCCTGATTACCATCCAGTCGGGTGTGGGCCGTTACCACACCGGTGAATAGTTACCTGAAGCTTGGTCAAACCTGGAACATGTTGGTTCCACACCTTCATATCTCAGGCAGCAGAAAAACATGAAGGATAAGTGAAACGCCTGCACTGATAAATCAAAGAAGAGGGTAAAATGAAGGTCATATTTTTTCTGAAAATGCATAAATAATCTTTTAAAAATATATATACATACTGTATAGAGAGAGAGAGCGGTCCATGGCATTATTGCTGCTGAGTGACAGCTTAAGTTCAACCCAGGACAGGACTGCTGATCCAGCTGTGCTGAATCCATTTTTATTGTATTACCAGAAATACACGTTACAGTAATGTTTTTACAATATAAACATGAGTAGTTGTGTATTTTCTAGAAGTTTACCGCCTCTTGTTATTTGACATTAGCTTTCTTTCTCATTTATTTTCTTGTAAATAAATCTCTTGTGCTC 13 3' UTR-6 GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAA 14 3' UTR-7 GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCA 15 3' UTR-8 CTGCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCAT 16 3' UTR-9 ACCAGCCTCAAGAACACCCGAATGGAGTCTCTAAGCTACATAATACCAACTTACACTTTACAAAATGTTGTCCCCCAAAATGTAGCCATTCGTATCTGCTCCTAATAAAAAGAAAGTTTCTTCACA 17

[0037] Polyadenylated acid (poly-A) protects mRNA from degradation by 3′→5′ exonucleases, increasing the stability of the mRNA itself. The poly-A length is 100-250 nucleotides, preferably 100-150 nucleotides. Examples of poly-A include, but are not limited to, the sequences described in Table 2.

[0038] Table 2 Two different sequences of poly-A

[0039] Number Sequence SEQ ID NO. polyA-1 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 18 polyA-2 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 19

[0040] miRNAs are a class of endogenous non-coding RNAs, 19-25 nucleotides in length, that recognize and bind to miRNA binding sites on nucleic acid molecules, reducing nucleic acid molecule stability or inhibiting translation, and further downregulating gene expression levels. Removing miRNA binding sites from the natural nucleic acid sequence can increase protein expression; alternatively, adding one or more miRNA binding sites to the nucleic acid sequence can reduce protein expression. Preferably, the addition of the miR-122 binding site to the nucleic acid molecule inhibits the expression of the target gene in the liver.

[0041] "Composition" means any product that contains specified amounts of each specified ingredient.

[0042] "Pharmaceutical composition" refers to a composition comprising an active ingredient, which may further include pharmaceutically acceptable excipients and other optional therapeutic components. The pharmaceutical compositions of the present invention include those suitable for oral, rectal, topical, and non-enteric administration (including subcutaneous, intramuscular, and intravenous administration). The pharmaceutical compositions of the present invention can be readily prepared in unit dosage forms known in the art and by any method of preparation known in the pharmaceutical field.

[0043] Compared with the prior art, the present invention has the following beneficial effects:

[0044] 1. The mRNA encoding human HGF in this invention has a lower predicted minimum folding energy (MFE) than the natural sequence, making the molecule more stable.

[0045] 2. This invention provides a nucleic acid encoding human HGF, a nucleic acid construct, a vector, a cell, and a drug thereof, wherein the nucleic acid has a protein expression level superior to that of the natural sequence. Attached Figure Description

[0046] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0047] Figure 1 This is an agarose gel electrophoresis image of the in vitro transcription product mRNA.

[0048] Figure 2 This represents the expression level of luciferase mRNA in HSMC cells after co-transfection with luciferase mRNA and HGF mRNA.

[0049] Figure 3 It represents the absolute expression level of HGF mRNA in HSMC cells after co-transfection with luciferase mRNA and HGF mRNA.

[0050] Figure 4 This represents the relative expression level of HGF mRNA in HSMC cells after co-transfection with luciferase mRNA and HGF mRNA. Detailed Implementation

[0051] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are merely some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other implementation methods obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0052] Unless otherwise specified, all reagents, raw materials or equipment used in this invention are commercially available.

[0053] This invention applies artificial intelligence algorithms to predict structural stability, designs a series of nucleic acid molecules with folding free energies lower than those of natural sequences, and actually synthesizes and measures their activity. In some more specific embodiments, the nucleic acid encoding human HGF includes one or more open reading frames (ORFs), the ORF nucleic acid sequence of which has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence homology with the nucleic acid sequences selected from SEQ ID NO:21-31. The nucleic acid has a protein expression level superior to that of the natural sequence.

[0054] Furthermore, the ORF nucleic acid sequence is selected from SEQ ID NO:21-31 or its transcribed RNA sequence.

[0055] Furthermore, the nucleic acid also contains a 5′ cap.

[0056] Furthermore, the 5' hat is selected from m7G5'ppp5'Np, m7G5'ppp5'NmpNp or m7G5'ppp5'NmpNmpNp.

[0057] Furthermore, the nucleic acid also contains a 5′UTR.

[0058] Furthermore, the 5′UTR is selected from one or a combination of SEQ ID NO:1-8.

[0059] Furthermore, the nucleic acid also contains a 3′UTR.

[0060] Furthermore, the 3′UTR is selected from one or a combination of SEQ ID NO:9-17.

[0061] Furthermore, the nucleic acid also contains a poly-A sequence, which contains 70-150 nucleotides.

[0062] Furthermore, the poly-A sequence contains a sequence selected from SEQ ID NO:18 or 19.

[0063] Further, the nucleic acid comprises a sequence selected from SEQ ID NO:32, 33, 34, 35, 56, 57, 58, 60, 61, 63, 65 or a transcribed RNA sequence thereof.

[0064] Furthermore, the nucleic acid contains one or more modified nucleosides selected from pseudouridine, N1-methyl-pseudouridine, or 5-methylcytidine.

[0065] Furthermore, the nucleic acid is selected from DNA or mRNA.

[0066] Furthermore, the nucleic acid has a protein expression level superior to that of the natural sequence, with an expression level at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% higher.

[0067] A vector containing the nucleic acid.

[0068] A cell containing the nucleic acid.

[0069] A pharmaceutical composition containing the said nucleic acid.

[0070] A method for expressing a polypeptide in a mammal, the method comprising contacting cells with the nucleic acid or the pharmaceutical composition thereof.

[0071] The technical solution of the present invention will be further described in detail below with reference to the embodiments and accompanying drawings. However, the selected embodiments are only for illustrating the present invention and do not limit the scope of the present invention.

[0072] Example 1 Plasmid Preparation

[0073] ORF sequences encoding the same natural human HGF protein, SEQ ID NO. 20-31, were synthesized, where SEQ ID NO. 20 is the natural nucleic acid sequence (NM_000601.6), and the others are artificially designed nucleic acid sequences. DNA plasmids containing the ORF sequences and their flanking upstream and downstream regulatory sequences were constructed, amplified, and extracted using conventional molecular cloning methods. Examples of the 5'UTR, 3' UTR, and polyA sequences in the upstream and downstream regulatory sequences include, but are not limited to, the sequences described in Tables 1 and 2. DNA plasmids containing SEQ ID NO. 32-35 and 46-65 encode the mRNA products HGF1-24, respectively, and their correspondence is shown in Table 3.

[0074] Table 3 shows the correspondence between the constructs and the contained ORF sequences, 5' UTRs, and 3' UTRs.

[0075] Number Plasmid construction SEQ ID NO. ORF sequence SEQ ID NO. 5’ UTR SEQ ID NO. 3’ UTR SEQ ID NO. HGF-1 46 20 1 9 HGF-2 47 20 1 10 HGF-3 48 36 1 9 HGF-4 49 36 1 10 HGF-5 50 37 1 9 HGF-6 51 38 1 9 HGF-7 32 21 1 9 HGF-8 52 39 1 10 HGF-9 53 40 1 10 HGF-10 33 22 1 10 HGF-11 54 41 1 9 HGF-12 55 42 1 9 HGF-13 56 23 1 9 HGF-14 57 24 1 9 HGF-!5 34 25 1 9 HGF-16 58 26 1 9 HGF-17 59 43 1 9 HGF-18 60 27 1 9 HGF-19 61 28 1 9 HGF-20 62 44 1 9 HGF-21 63 29 1 9 HGF-22 64 45 1 9 HGF-23 35 30 1 9 HGF-24 65 31 1 9

[0076] The following lists the ORFs corresponding to the natural sequences and the more active constructs.

[0077] SEQ ID NO.20:

[0078]

[0079] SEQ ID NO.21:

[0080]

[0081] SEQ ID NO.22:

[0082]

[0083] SEQ ID NO.23:

[0084]

[0085] SEQ ID NO.24:

[0086]

[0087] SEQ ID NO.25:

[0088]

[0089] SEQ ID NO.26:

[0090]

[0091] SEQ ID NO.27:

[0092]

[0093] SEQ ID NO.28:

[0094]

[0095] SEQ ID NO.29:

[0096]

[0097] SEQ ID NO.30:

[0098]

[0099] SEQ ID NO.31:

[0100]

[0101] Example 2: mRNA preparation

[0102] After linearizing the DNA plasmid containing the HGF coding sequence, mRNA was obtained through in vitro transcription. The in vitro transcribed mRNA was detected by agarose gel electrophoresis; the bands were bright, uniform, and without tails, showing good integrity. Figure 1 A typical preparation process is shown below.

[0103] 2.1 Restriction endonuclease digestion of plasmid DNA

[0104] The reagents used for enzyme digestion are shown in Table 4 below:

[0105] Table 4. Reagents used for enzyme digestion

[0106] [[ID=!48]]Name Volume speI-HF (NEB) 1μl Plasmid DNA It should be noted that there may be a misprint in the original text where "HGF-!5" and "!48" are likely incorrect. This translation is based on the text provided as accurately as possible. 10μg 10×CutSmart Buffer (NEB) 2μl Nuclease-free water Add to a total volume of 20 μl

[0107] Vortex to mix, centrifuge briefly for 10 seconds, and react in a 37°C metal bath for 3 hours. If the amount of plasmid DNA added changes, the amounts of other additives should be adjusted accordingly.

[0108] 2.2 Plasmid DNA Precipitation

[0109] (1) Add 0.7 times the volume of isopropanol to the sample after reaction and mix thoroughly.

[0110] (2) Centrifuge at 13000 rpm and room temperature for 15 minutes to precipitate DNA. After removing the supernatant, add 1 ml of 70% ethanol to wash the precipitate, centrifuge at 13000 rpm and room temperature for 10 minutes, and remove the supernatant.

[0111] (3) After removing the supernatant, centrifuge for 10 seconds to collect the residual ethanol from the centrifuge tube wall to the bottom of the tube. Use a pipette tip to remove the residual ethanol and let it dry at room temperature for 2 minutes. Add 50 µL of ultrapure water to dissolve the DNA precipitate.

[0112] (4) After the precipitate has completely dissolved, use NanoDrop (Thermo Fisher) to detect the DNA concentration and store it in a -20°C freezer.

[0113] 2.3 In vitro transcription

[0114] In vitro transcription was performed using the Novoprotein In vitro transcription kit, catalog number: E131-01A.

[0115] (1) Thaw 10×IVT Buffer at room temperature, thaw 100mM NTP and Cleancap on ice, and place T7Enzyme Mix in an ice box.

[0116] (2) Take a clean 1.5ml EP tube and add the following components into the tube in sequence (20μl as an example) as shown in Table 5 below.

[0117] Table 5 Components added to the tube

[0118] name Volume (μl) IVT Reaction buffer 2 100mM ATP 1.5 100mM CTP 1.5 100mM pUTP 1.5 100mM GTP 1.5 DNA 1μg T7 Enzyme Mix 1 Nuclease-free water Supplement to 20

[0119] (3) Vortex mix for 5 seconds, centrifuge for 10 seconds, and incubate at 37°C for 2-3 hours in a constant temperature mixer.

[0120] (4) After the reaction is complete, add 1 μl of DNase I and incubate at 37°C for 15 minutes to remove the linearized template.

[0121] 2.4 Purification of mRNA

[0122] (1) Take the RNA Clean Beads out of 2 ~ 8°C 30 min in advance, equilibrate to room temperature, and invert or vortex to mix the magnetic beads thoroughly.

[0123] (2) Add 36 μl of RNA Clean Beads to the mixture after IVT.

[0124] (3) Use a pipette to mix thoroughly.

[0125] (4) Incubate at room temperature for 5 min to allow the RNA to bind to the magnetic beads.

[0126] (5) Place the sample on a magnetic rack for 5 minutes. After the solution becomes clear, carefully remove the supernatant.

[0127] (6) Keep the sample in the magnetic rack at all times, add 200 μl of freshly prepared 80% ethanol to rinse the magnetic beads, and incubate at room temperature for 30s.

[0128] (7) Remove the supernatant and repeat the previous step, rinsing a total of 2 times.

[0129] (8) Keep the sample in the magnetic rack at all times, and open the lid to air dry the magnetic beads for 5-10 minutes.

[0130] (9) Remove the sample from the magnetic rack, add an appropriate volume of nuclease-free water, pipette and blow 10 times to mix thoroughly, and let stand at room temperature for 5 min.

[0131] (10) Place the sample on a magnetic rack for 5 min. After the solution becomes clear, carefully transfer the supernatant to a new centrifuge tube.

[0132] (11) NanoDrop was used to detect mRNA concentration and OD. 260 / 280 Mark the value and store in a -80℃ refrigerator.

[0133] Example 3: In vitro transfection of mRNA

[0134] 3.1 Cell Plating

[0135] Human primary skeletal muscle cells (HSMCs) in good growth condition were selected, digested with trypsin at 37°C for 2 min, digestion was stopped by adding HSMC complete medium (Gibco), centrifuged at 1000 rpm for 5 min, and the cells were resuspended in HSMC complete medium and the cell density was adjusted to 1×10⁶ cells / min. 5 Cells / mL, 200 μL / well were seeded in 48-well cell culture plates.

[0136] 3.2 mRNA preparation

[0137] HGF mRNA and luciferase mRNA (Trilink, catalog number L-7202) were diluted to 200 ng / μL with RNase-free water.

[0138] (1) mRNA dilution solution

[0139] Add 100 ng of HGF mRNA and 100 ng of luciferase mRNA to each well into a centrifuge tube, and add 20 μL of Opti-MEM. TM (Gibco) medium, mix thoroughly.

[0140] (2) Lip 2000 diluent

[0141] Take 0.6 μL of Lipofectamine 2000 (Thermo Fisher) transfection reagent from each well, add 20 μL of Opti-MEM medium, and mix thoroughly.

[0142] (3) Preparation of transfection complex

[0143] Add the mRNA dilution buffer to the Lip 2000 dilution buffer, mix thoroughly, and let stand at room temperature for 10 min.

[0144] 3.3 mRNA transfection

[0145] Add 160 μL of Opti-MEM medium to the transfection complex and mix thoroughly. Discard the original culture medium from the cell culture plate and add 200 μL of the prepared transfection complex mixture to each well.

[0146] 3.4 Fluid Change

[0147] Four hours after transfection, observe the cell status and replace the culture medium in the cell culture plate with 200 μL of complete culture medium.

[0148] 3.5 Sample Collection

[0149] 24 h after transfection, the supernatant in the cell culture plate was collected for HGF expression detection;

[0150] Cells were collected from cell culture plates to detect luciferase expression levels.

[0151] Example 4: Detection of luciferase expression levels

[0152] Luciferase expression levels were detected using a luciferase reporter gene assay system (Promega, catalog number E1501).

[0153] 4.1 Reagent Preparation

[0154] (1) 1-fold cell lysis buffer

[0155] Calculate the required amount for the experiment in advance, and dilute the 5-fold cell lysis buffer with deionized water to make a 1-fold working solution.

[0156] (2) Preparation of luciferase detection solution

[0157] Remove the luciferase detection buffer from -20°C and allow it to thaw completely. Then, add it to the luciferase detection substrate and dissolve it completely to obtain the luciferase detection solution.

[0158] 4.2 Testing Procedures

[0159] (1) After transfection, aspirate the culture medium and wash the cells with 1×PBS;

[0160] (2) Add 50 μL of cell lysis buffer to the cell culture plate and incubate at room temperature for 10 min to lyse the cells.

[0161] (3) Take 20 μL of cell lysis buffer and transfer it to a black, opaque microplate. Mix it quickly and immediately detect the chemiluminescence value using a microplate reader.

[0162] 4.3 Test Results

[0163] The results showed that after luciferase mRNA was transfected into HSMC cells, there was no significant difference in the expression of luciferase in the cells. Figure 2 Therefore, luciferase can be used as an internal control for calibrating HGF expression levels.

[0164] Example 5: Identification of HGF Expression Level

[0165] 5.1 Reagent Preparation

[0166] (1) Warm up the reagent kit

[0167] Allow the HGF detection kit (Solarbio, catalog number SEKH-0201) to warm to room temperature.

[0168] (2) Prepare the washing solution

[0169] Calculate the volume of the diluted detergent solution to be used, and dilute the 20× concentrated detergent solution with deionized water to make 1× application solution.

[0170] (3) Gradient dilution of standard products

[0171] Add 1 mL of standard diluent to the lyophilized standard and mix gently after it is completely dissolved (concentration is 8000 pg / mL). Use the standard diluent to perform serial dilutions at the following concentrations: 8000, 4000, 2000, 1000, 500, 250, 125, 0 pg / mL.

[0172] (4) Biotinylated antibody working solution

[0173] Calculate the required amount of reagents in advance, dilute 100× antibody concentrate to 1× working solution with detection dilution buffer (SR2), and add it to the reaction well within 30 min.

[0174] (5) Enzyme conjugate working solution

[0175] Calculate the required amount for the experiment in advance, dilute the 100× enzyme conjugate concentrate to 1× working solution using enzyme conjugate diluent (SR3), and add it to the reaction wells within 30 min.

[0176] 5.2 Testing Procedures

[0177] (1) After the kit has returned to room temperature, dilute the cell culture supernatant sample with sample diluent, remove the strips, wash the plate 3 times with washing solution and shake dry;

[0178] (2) Add the standard and test sample to the reaction well, seal the plate and incubate at 37°C for 90 min;

[0179] (3) Shake off the liquid in the wells of the microplate, pat dry on absorbent paper, add 300 μL of washing buffer to each well, with a time interval of 30 s between adding the buffer and shaking the plate, and wash the plate 4 times.

[0180] (4) Add 100 μL of biotinylated antibody working solution to the reaction wells, seal the plate and incubate at 37°C for 60 min;

[0181] (5) Repeat the plate washing step in step (3);

[0182] (6) Add 100 μL of enzyme conjugate working solution to the reaction wells, seal the plate and incubate at 37°C for 30 min;

[0183] (7) Repeat the plate washing step in step (3) 5 times;

[0184] (8) Add 100 μL of chromogenic substrate to the reaction wells, seal the plate, and develop the color at 37°C in the dark for 15 min;

[0185] (9) Add 50 μL of chromogenic substrate to the reaction well and perform dual-wavelength detection using an ELISA reader within 5 min. The measured value is the OD value at 450 nm minus the OD value at 630 nm.

[0186] (10) Plot a standard curve using Excel with concentration as the x-axis and OD450-OD630 values ​​as the y-axis. Then, use the standard curve to calculate the HGF content in the sample based on the corresponding OD values.

[0187] 5.3 Calculation of absolute expression levels

[0188] The standard curve formula is y = 0.0002x + 0.0028 (R²). 2 =0.9987). The results showed that after transfection of different HGF mRNAs into HSMC cells, the expression level of HGF in the culture supernatant increased to varying degrees. Figure 3 The HGF concentration ranged from 200 to 1040 ng / mL. Among them, the HGF content was the highest in the HGF-23 mRNA sample, with an HGF secretion level of 1040 ng / mL in the cell culture supernatant.

[0189] 5.4 Calculation of relative expression levels

[0190] Since the amount of mRNA added, cell number and state, and transfection efficiency all affect HGF expression during the experimental reaction, luciferase mRNA expression was used as an internal control to improve the accuracy of experimental data. The RLU value of the HGF-10 sample was used as one unit to calibrate the relative expression level of HGF. The calculation formula for each sample is as follows:

[0191] HGF relative expression level (ng / mL) = (HGFn / RLUn) × RLU 10

[0192] Formula (1)

[0193] Wherein, HGFn represents the HGF expression level (ng / mL) corresponding to the nth HGF sequence sample; RLUn represents the bioluminescence intensity corresponding to the nth HGF sequence sample, representing the expression level of luciferase.

[0194] The results showed that the relative expression level of HGF in the corrected cell culture supernatant ranged from 173 to 670 ng / mL. Figure 4 This result better reflects the expression differences among different HGF mRNA sequences. The artificially designed sequences HGF-7, 10, 13, 14, 15, 16, 18, 19, 21, 23, and 24 exhibited superior protein expression levels compared to the natural sequences (HGF-1 and 2). Among them, HGF-7 (the obtained construct's nucleic acid sequence is SEQ ID NO. 32), HGF-10 (the obtained construct's nucleic acid sequence is SEQ ID NO. 33), HGF-15 (the obtained construct's nucleic acid sequence is SEQ ID NO. 34), and HGF-23 (the obtained construct's nucleic acid sequence is SEQ ID NO. 35) showed even better protein expression levels than the other sequences.

[0195] The optimal nucleotide sequences for the four nucleic acid constructs are as follows:

[0196] SEQ ID NO.32:

[0197]

[0198] SEQ ID NO.33:

[0199]

[0200] SEQ ID NO.34:

[0201]

[0202] SEQ ID NO.35:

[0203]

[0204] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A construct, characterized in that, the sequence of SEQ ID NO: 33, 57, 65.

2. The construct of claim 1, wherein, the construct further comprises one or more modified nucleosides selected from pseudouridine, N1-methyl-pseudouridine, or 5-methylcytidine.

3. A cell comprising the construct of claim 1 or 2.

4. A pharmaceutical composition comprising the construct of claim 1 or 2.