Cotton sympodial branch number and yield regulation gene GH_D05G2737, its encoded protein, expression vector and applications thereof
By editing the cotton GH_D05G2737 gene, CRISPR/Cas9 technology was used to regulate cotton yield traits, the problem of unclear molecular mechanism of cotton yield traits was solved, technical support for high-yield cotton breeding was achieved, and breeding efficiency was improved.
Patent Information
- Application Number
- CN202310408543.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-17
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2043-04-17
AI Technical Summary
In the prior art, the molecular mechanism of cotton yield traits has not been fully elucidated, and effective genetic resources are lacking for the selection and breeding of new cotton varieties.
By editing the cotton GH_D05G2737 gene, using CRISPR/Cas9 technology for gene editing, it clarifies its regulatory effect on cotton plant height, number of fruit branches, number of effective cotton bolls, etc., and provides the cotton fruit branch number and yield regulation gene GH_D05G2737, its encoding protein and recombinant expression vector, and is used in high-yield breeding of cotton and other crops.
Effective regulation of cotton yield has been achieved, the height of cotton plant, number of fruit branches and number of effective cotton bolls has been improved, the breeding cycle has been shortened, the breeding cost has been reduced, and the breeding efficiency has been improved.
Smart Images

Figure CN116590305B_ABST
Abstract
Description
Technical Field
[0001] The present invention application relates to the technical field of biological genetic engineering, and particularly relates to a cotton fruiting branch number and yield regulation gene GH_D05G2737 , its encoded protein, expression vector and application thereof. Background Art
[0002] Cotton ( Gossypiumspp ) is one of the most important textile raw materials in the world, and its production and trade play an important role in the global economy. The yield components per plant of cotton mainly include the number of effective cotton bolls, single boll weight, etc. With the release of genomics and the development of transgenic technology, the functions of more and more genes related to cotton yield traits have been analyzed, such as GhMAX2 , GhARF2 , GhPIN1 , GhMYB25 , etc. However, the yield traits of cotton are complex quantitative traits controlled by multiple genes, and the functional genes obtained currently are still not sufficient to fully clarify the molecular mechanism of yield formation. Therefore, it is necessary to deeply explore the key genes related to cotton yield traits and analyze their utilization pathways, so as to provide excellent gene resources for the breeding of new cotton varieties.
[0003] The information disclosed in this background art section is only intended to deepen the understanding of the overall background art of the present invention, and should not be regarded as an admission or any form of implication that this information constitutes the prior art known to those skilled in the art. Summary of the Invention
[0004] The inventors' research found that the gene GH_D05G2737 in cotton is homologous to the maize gene KWE2 . Through the creation of corresponding editing mutations, the performance of GH_D05G2737 in traits such as cotton plant height, number of fruiting branches, fruiting branch length, and number of effective cotton bolls and its regulatory effect on yield were clarified. This application provides a solid technical support for improving cotton yield by using the GH_D05G2737 gene.
[0005] One of the purposes of this application is to provide a cotton fruiting branch number and yield regulation gene GH_D05G2737 , and its nucleotide sequence is at least one of the following groups:
[0006] (1) As shown in SEQ ID NO.1;
[0007] (2) A DNA molecule that can affect the phenotype of yield-related traits formed by one to several base substitutions and / or one to several base insertions and / or deletions and / or large fragment nucleotide sequence insertions / deletions / shifts / inversions on the basis of SEQ ID NO.1.
[0008] Another aspect disclosed in this application provides a cotton fruiting branch number and yield regulation geneKWE2 The encoded protein, and its amino acid sequence is at least one of the following groups:
[0009] (1) A protein consisting of the amino acid sequence encoded by SEQ ID NO.1;
[0010] (2) As shown in SEQ ID NO.2;
[0011] (3) A protein obtained by substituting, deleting, and / or adding one or several amino acid residues to SEQ ID NO.2 and having an effect on yield-related traits.
[0012] The third aspect disclosed in the present application provides a recombinant expression vector, expression cassette, transgenic cell line or recombinant bacterium containing the cotton sympodial branch number and yield regulation gene GH_ D05G2737 .
[0013] The fourth aspect disclosed in the present application provides a primer pair for identifying mutations in the cotton sympodial branch number and yield regulation gene GH_ D05G2737 , and its sequences are as follows:
[0014] J214-Target Detection-F1: 5’- CGCAACCCTCAAGTTCTC-3’
[0015] J214-Target Detection-R1: 5’-TGGAAATCACGATGGGAC-3’
[0016] J214-Target Detection-F2: 5’-CCTTAGCCACCTTTGGAA-3’
[0017] J214-Target Detection-R2: 5’-ACGGAGTTGGAAATCACG-3’.
[0018] The fifth aspect disclosed in the present application uses the gene GH_D05G2737 , the recombinant expression vector or the primer pair in the improvement of cotton yield traits and the breeding of superior varieties / lines.
[0019] For example, silencing / downregulating the expression of the cotton gene GH_D05G2737 to increase the plant height, sympodial branch number, effective cotton boll number and / or leaf area of cotton.
[0020] The plants that can be transformed in the present application can be monocotyledonous and dicotyledonous plants, including but not limited to cotton, corn, wheat, barley, rye, rapeseed, sweet potato, sunflower, potato, soybean, pea, sorghum, switchgrass, alfalfa, Arabidopsis, etc.
[0021] One or more technical solutions provided in the embodiments of the present application have at least any one of the following technical effects or advantages:
[0022] 1. Perform CRISPR / Cas9 editing on the cotton yield regulation gene GH_D05G2737 to obtain homozygous CRISPR-Cas9 mutants, and clarify the GH_D05G2737 effects of the gene on traits such as plant height, number of fruiting branches, number of effective cotton bolls, and leaf size of cotton; determine its regulation function on cotton yield; thus laying a solid technical foundation for increasing cotton yield by using the GH_D05G2737 gene.
[0023] 2. By using the gene and method disclosed in the present application, it is convenient to create high-yield breeding materials for crops such as cotton, corn, and wheat, shorten the breeding cycle of new crop varieties, reduce the breeding cost, and improve the breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 is a phylogenetic analysis tree of the cotton GH_D05G2737 gene in the embodiments of the present application.
[0025] Figure 2 is a phenotypic map of the cotton GH_D05G2737 gene editing line in the embodiments of the present application; among them, CK is the control, and KO-1 is GH_D05G2737 gene editing line 1, and KO-2 is GH_D05G2737 gene editing line 2. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0026] Definition and description of related terms:
[0027] The term "cotton fruiting branch number and yield regulation gene" refers to a nucleotide sequence capable of encoding a protein, and this sequence specifically encodes a protein active polypeptide with the function of regulating the number of cotton bolls and yield.
[0028] The "cotton fruiting branch number and yield regulation gene" also includes a gene that can encode a protein with the same function as the natural biological yield regulation gene GH_D05G2737 variant forms of the open reading frame sequence; these variant forms include but are not limited to: deletion, insertion, and / or substitution of one or several nucleotides, and addition of several (usually within 60, preferably within 30, more preferably within 10, and most preferably within 5) nucleotides at the 5' or 3' end.
[0029] The "cotton fruit branch number and yield regulating gene" also includes a class of amino acid sequences that can translate and have the function of regulating the number of cotton bolls, the number of effective branches, the leaf area and the yield, such as the amino acid sequence of SEQ ID NO.2. This type of amino acid sequence also includes variant forms that have the same function as the natural cotton yield regulating protein. These variant forms include but are not limited to: the deletion, insertion and / or substitution of one or several amino acids, and the addition of one or several (usually within 20, preferably within 10, and more preferably within 5) amino acids to the C-terminus and / or N-terminus. In the art, when amino acids with similar or similar properties are substituted, the function of the protein is usually not changed; adding one or several amino acids to the C-terminus and / or N-terminus usually does not change the function of the protein.
[0030] In addition, the full-length nucleotide sequence of the "cotton fruit branch number and yield regulating gene" or its fragments can usually be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, the corresponding primers can be designed according to the relevant nucleotide sequence disclosed in this embodiment, especially the open reading frame sequence, and a commercially available cDNA library or a cDNA library prepared by conventional methods known to those skilled in the art is used as a template to amplify the relevant sequence. When the sequence is long, two or more nested PCR amplifications are usually required, and then the PCR amplification products of each time are spliced together in the correct order.
[0031] Particularly preferred is at least one cotton yield regulating gene disclosed in the present application expressed in higher plants. GH_ D05G2737 Once the desired nucleotide sequence is transformed into a specific plant species, it can be propagated in the species or transferred into other varieties of the same species (especially including commercial varieties) using conventional breeding techniques. GH_D05G2737The nucleotide sequence is inserted into an expression cassette or included in a non-pathogenic self-replicating virus, and then preferably, the expression cassette is stably integrated into the plant genome. The recipient for transformation in this application can be monocotyledonous and dicotyledonous plants, including but not limited to cotton, corn, wheat, barley, rye, rice, rapeseed, sunflower, potato, soybean, pea, switchgrass, Arabidopsis, etc. By expressing the nucleotide sequence disclosed in this application in transgenic plants, the biosynthesis of functional proteins that can enhance the corresponding heterosis performance is thus promoted in the transgenic plants. In this way, transgenic plants with enhanced heterosis performance can be produced. To express the nucleotide sequence of the present invention in transgenic plants, the nucleotide sequence disclosed in the present invention may need to be modified and optimized, and its codons can be changed to conform to plant preference while maintaining the amino acids encoded by the nucleotide sequence of the present invention. Moreover, high-level expression in plants can be best achieved from coding sequences with a GC content of at least about 35%, preferably more than about 45%, more preferably more than 50%, and most preferably more than about 60%.
[0032] Some specific embodiments of the present application will be described in detail below. The following examples are more convenient for better understanding the present invention, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the protection scope of the present invention.
[0033] In the experimental methods described in the embodiments of the present application, unless otherwise specified, they are all conventional methods; those skilled in the art should understand that the reagents, enzymes, etc. used in the following embodiments are all analytical pure reagents or enzymes that can be commercially purchased from reagent companies unless otherwise specified. The materials, methods, and examples are only for illustration and not for limitation.
[0034] Example 1. Cotton GH_D05G2737 Functional verification of the gene
[0035] Related research found that the GH_D05G2737 gene in cotton has the closest genetic relationship with the KWE2 gene in corn ( Figure 1 ), and the two are homologous genes; and further research shows that the GH_D05G2737 gene in cotton and the KWE2 gene in corn have roughly similar gene regulatory functions: negatively regulating yield and heterosis.
[0036] To further study the regulatory pathway and role of this gene on the biological yield of cotton, the GH_D05G2737 gene in cotton was edited by CRISPR-Cas9.
[0037] The specific operation is as follows:
[0038] 1. Construction of cotton GH_D05G2737 CRISPR-Cas9 vector of gene cDNA, design double-target gRNA in the exon region (Target 1: GCAAATCATGATCTGACGAAGGG, Target 2: ACAGGGTGAGGAGATCGGAAGGG), and use the upstream primer F (recombinant arm + Target 1 + 16bp of PSG template) and the downstream primer R (recombinant arm + Target 2 + 16bp of PSG template, note reverse complement) to amplify with at-26 -PSG as the template.
[0039] Reaction system: 1µL each of F / R primers, 1µL of amplification template, 25µl of tks, ddH2O to 50µL. After the PCR reaction, take 5µL of the PCR product for electrophoresis to check if the band is correct, about 630bp in size. If correct, directly recover the stock solution using the PCR gel recovery kit to obtain the purified PCR product.
[0040] Restriction enzyme digestion system: 1µg of vector, Bsa 1µL of I enzyme, 5µL of Buffer, ddH2O to 50µL, incubate at 37℃ for 2h. After the time is up, directly recover the stock solution using the DC 301 PCR gel recovery kit, and finally add 40µL of EB elution buffer to obtain the vector restriction enzyme digestion product.
[0041] Ligation system: 2µL of 5×CEII Buffer, 1µL of ExnaseII, 50ng of Vector, 35ng of target fragment, add ddH2O to 10µL. After preparing the recombinant system, place it in a 37℃ incubator for 30min, take it out and place it on ice for 5min, and then it can be transformed into Escherichia coli.
[0042] 2. Transformation of recombinant plasmid
[0043] Take out the DH5a Escherichia coli competent cells, melt them on ice, add the recombinant product to the competent cells, gently mix, and place on ice for 30min; incubate in a 42℃ water bath for 1.5min, place on ice for 5min, add 600µL of empty LB medium in a laminar flow hood, shake on a 37℃ shaker for 1 - 2h, centrifuge and plate, select the kanamycin-resistant plate when plating, and place it upside down in a 37℃ incubator for about 1d.
[0044] 3. Pick monoclonal colonies and extract plasmids. The specific operation steps are as follows:
[0045] (1) Pick a monoclonal colony from the LB solid medium plate and inoculate it into kanamycin-resistant LB liquid medium at a final concentration of 50 μg / mL, and culture overnight at 37°C; (2) Extract the plasmid using the Tiangen Plasmid Mini Kit. First, culture the monoclonal strain confirmed to be positive in a shaker at 37°C overnight. Take 12000 rpm centrifuge the cultured bacterial solution for 2 min, and use a pipette tip to remove as much supernatant liquid as possible. The collection of bacteria can be repeated; (3) Add 250 μL of P1 to the centrifuge tube and suspend the bacterial pellet using a vortex oscillator; (4) Add 250 μL of P2 to the centrifuge tube and gently invert 6 - 8 times to fully lyse the bacteria; (5) Add 350 μL of P3 to the centrifuge tube and gently invert up and down 6 - 8 times to mix well. At this moment, a white flocculent precipitate will appear. Centrifuge at 12000 rmp for 10 min; (6) Transfer the supernatant from the previous step to the adsorption column CP3 using a pipette and centrifuge at 12000 rmp for 1 min. Pour out the waste liquid and place the adsorption column back into the collection tube; (7) Add 600 μL of wash buffer PW to the adsorption column CP3, centrifuge at 12000 rmp for 1 min, pour out the waste liquid, and place the adsorption column back into the collection tube. Repeat the operation once; (8) Place the adsorption column CP3 back into the collection tube and centrifuge at 12000 rmp for 2 min; (9) Place the adsorption column CP3 into a clean 1.5 mL centrifuge tube, place it in a laminar flow hood and blow for 2 min. Add 50 μL of ddH2O to the middle part of the adsorption membrane, let it stand at room temperature for 2 min, and centrifuge at 12000 rmp for 2 min to collect the plasmid solution into the centrifuge tube, and store it at -20°C for later use; (10) Take a small amount of the recovered product and detect the quality of plasmid extraction by agarose gel electrophoresis with a concentration of 1%; (11) Perform monoclonal sequencing on the plasmid.
[0046] 4. Bacterial detection: For bacterial liquid detection, use 10 μL of 2×Mix, 1 μL of QC1 (CTGGCGAAAGGGGGATGTGCTGCAA), 1 μL of QC10 (GCCATTTGTCTGCAGAATTG), and 8 μL of ddH2O. The target band is 750 bp. Pick the correct monoclonal colony for inoculation and extract the plasmid for sequencing.
[0047] 5. Transform the cotton transformation receptor, Baimian 1, by the shoot tip method. After emergence, take samples for detection.
[0048] 6. Extract the plant genome by the CTAB method and detect positive plants by PCR.
[0049] Primers used for detecting positive:
[0050] C016 - CAS9 - 1390F1: ATGACCAGAAAGAGCGAGG;
[0051] C016 - CAS9 - 1926R1: GAACAGGTGGGCATAGGTT。
[0052] 7. Identification method of mutation sites
[0053] Select the DNA of positive plants for target detection.
[0054] Detection system: 10 μL of 2×Mix, 2 μL of target detection primers (J214 - target detection - F1 / R1 or J214 - target detection - F2 / R2), 8 μL of ddH2O for PCR amplification, and send it to a biological company for sequencing.
[0055] Target detection primers:
[0056] J214 - target detection - F1: CGCAACCCTCAAGTTCTC;
[0057] J214 - target detection - R1: TGGAAATCACGATGGGAC;
[0058] J214 - target detection - F2: CCTTAGCCACCTTTGGAA;
[0059] J214 - target detection - R2: ACGGAGTTGGAAATCACG.
[0060] Example 2. Cotton GH_D05G2737 Phenotypic identification of gene knockout lines
[0061] Plant the edited transgenic lines and the control variety, Baimian 1, under the same environmental conditions according to the method in Example 1, and conduct phenotypic investigation during the flowering period. It is found that GH_D05G2737 The cotton plants of the gene knockout lines are taller than those of the control variety, the number of fruiting branches and the number of effective cotton bolls increase, and the leaves become larger ( Figure 2 ). It shows that the cotton GH_D05G2737 gene and the maize KWE2 gene have conserved functions, and it also plays a negative regulatory role in cotton plant height and yield.
[0062] Although some preferred embodiments of the present application have been described, those skilled in the art can make additional changes and modifications once they learn the basic creative concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments and all changes and modifications falling within the scope of the present application.
[0063] Obviously, those skilled in the art can make various changes and modifications to this application without departing from the spirit and scope of the invention of this application. Thus, if these modifications and variations of this application fall within the scope of the claims of this application and their equivalent technologies, this application is also intended to cover these modifications and variations.
Claims
1. A cotton fruiting branch number and yield regulation gene GH_D05G2737 , and its nucleotide sequence is shown in SEQ ID NO.
1.
2. A cotton fruiting branch number and yield regulation gene GH_D05G2737 The encoded protein has an amino acid sequence as shown in SEQ ID NO.
2.
3. A recombinant expression vector, expression cassette or recombinant bacterium containing the cotton fruiting branch number and yield regulation gene described in claim 1 GH_D05G2737 4. A primer pair for identifying genes related to the number of sympodial branches and yield regulation in cotton GH_D05G2737 The sequences of the mutant primer pairs are as follows: J214 - Target Detection - F1: 5’- CGCAACCCTCAAGTTCTC-3’; J214 - Target Detection - R1: 5’-TGGAAATCACGATGGGAC-3’; J214 - Target Detection - F2: 5’-CCTTAGCCACCTTTGGAA-3’; J214 - Target Detection - R2: 5’-ACGGAGTTGGAAATCACG-3’.
5. The gene for regulating the number of cotton fruiting branches and yield as claimed in claim 1 GH_D05G2737 Its application in regulating the plant height, number of fruiting branches, number of effective cotton bolls and / or leaf area of cotton, characterized in that Knock out the cotton sympodial branch number and yield regulation gene GH_D05G2737 .
6. The cotton fruiting branch number and yield regulation gene according to claim 1 GH_D05G2737 Application in improving cotton yield traits and breeding superior varieties / lines, characterized in that Silencing / down-regulating the expression of the cotton gene GH_D05G2737 to increase the plant height, the number of fruiting branches, the number of effective cotton bolls and / or the leaf area of cotton.
Citation Information
Patent Citations
Gene engineering method and material for increasing plant yield
CN102732553A
Preparation method of cotton bollworm-resistant transgenic cotton
CN115011627A