Application of flounder 17β-hydroxysteroid dehydrogenase 12b

Through transient expression of ferroster 17β-hydroxysteroid dehydrogenase 12b (Hsd17b12b) in HEK293T cells, it regulates sex hormone synthesis, converts testosterone into androstenedione, solving the problem of gender control in fish and achieving precise gender control in ferroster breeding.

CN116602243BActive Publication Date: 2025-08-22INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310535373.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-12
Publication Date
2025-08-22
Estimated Expiration
2043-05-12

AI Technical Summary

Technical Problem

In fish, the prior art is difficult to effectively control gender differences, resulting in abnormal development of gonads and reduced fertility. Common sex hormone regulators are environmental endocrine disruptors and cannot be directly applied to breeding.

Method used

The gypsum 17β-hydroxysteroid dehydrogenase 12b (Hsd17b12b) was used to regulate sex hormone synthesis, and transiently express recombinant plasmid in HEK293T cells and convert testosterone to androstenedione, thereby increasing the level of androstenedione in the ovary and achieving gender control.

Benefits of technology

It significantly increases the level of androthenone and oocyte count in the ovary, provides an environmentally friendly gender control method, is suitable for dentin farming and can be promoted to other fish.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116602243B_ABST
    Figure CN116602243B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of molecular biology technology, and more specifically, to an application of flounder 17β-hydroxysteroid dehydrogenase 12b. The application of flounder 17β-hydroxysteroid dehydrogenase 12b (Hsd17b12b) in regulating the synthesis of sex hormones in flounder. The present invention also discloses an application method for increasing androstenedione levels in the ovary by intraperitoneal injection of a recombinant plasmid of Hsd17b12b in vivo, further demonstrating that the protein can be used to alter androgen levels in the gonads of flounder. The Hsd17b12b of the present invention can be used for research on gonadal differentiation and development in fish such as flounder, and can also provide a basis for screening inhibitors and activators thereof, thereby providing new ideas for single-sex fish farming.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, in particular to an application of flounder 17β-hydroxysteroid dehydrogenase 12b. Background Art

[0002] Estrogen is a crucial factor in the differentiation, development, and maintenance of the ovary in fish. When estrogen levels decrease and androgen levels increase in female individuals, abnormal gonadal development can occur. For example, reports in zebrafish and other fish have shown that exposure to high testosterone concentrations can lead to stunted ovarian development and reduced fertility. These testosterone-mediated changes can even cause females to eventually switch to male sex. Therefore, understanding the androgen synthesis pathways and mechanisms in fish is crucial for the study and application of sex control, yet research in this area remains incomplete and in-depth. Androstenedione, an androgen, can be taken orally to increase testosterone levels in humans and is often considered an alternative to synthetic hormones. The 17β-hydroxysteroid dehydrogenase (Hsd17b) family of enzymes, comprising over ten oxidoreductases, is involved in the conversion of testosterone to androstenedione in mammals. However, the functions of most genes in this family remain unclear in fish, and studies have shown that the functions of some genes differ from those in mammals. Hsd17b12, a reductase in this family, plays a role in the conversion of E1 to E2 in mammals such as humans. In fish, two Hsd17b12 enzymes, Hsd17b12a and -12b, have been discovered due to a gene duplication event. However, their functions are scarcely studied. The only report from the Japanese eel suggests that Hsd17b12a plays a role in the synthesis of 11-ketotestosterone, a function distinct from that in mammals. Functional studies on Hsd17b12b are virtually nonexistent. Sequence alignment reveals high amino acid sequence similarity between Hsd17b12a and -12b, but significant differences in the active center motif suggest distinct functions. Therefore, the specific function of Hsd17b12b in sex hormone synthesis needs to be clarified.

[0003] Fish often exhibit a growth advantage when they are single-sex, a phenomenon particularly pronounced in many commercial fish species. Therefore, achieving single-sex populations could bring significant economic benefits to the aquaculture industry. Numerous studies have shown that treatment with exogenous estrogens, estrogen receptor inhibitors, and aromatase inhibitors can achieve single-sex populations in many fish species. However, since these sex hormones and sex hormone receptor inhibitors are considered environmental endocrine disruptors and cannot be used directly in production, there is a need to develop sex control products that can be directly applied and are compatible with different sex hormone production pathways.

[0004] The Japanese flounder (Paralichthysolivaceus) is an important marine aquaculture fish species in my country, Japan, and South Korea. Its growth exhibits distinct sexual dimorphism, with females growing faster than males of the same age group. Research on sex control, and the subsequent implementation of all-female aquaculture, is crucial for boosting the industry's potential. Therefore, determining the function of sex hormone synthases not only provides a deeper understanding of the sex hormone synthesis pathway but also facilitates the development of activators and inhibitors, enabling precise sex control in production, thus possessing significant application value. Summary of the Invention

[0005] The present invention aims at the application of flounder 17β-hydroxysteroid dehydrogenase 12b.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] Disclosed is an application of flounder 17β-hydroxysteroid dehydrogenase 12b, and an application of flounder 17β-hydroxysteroid dehydrogenase 12b (Hsd17b12b) in regulating the synthesis of sex hormones in flounder.

[0008] The application of Hsd17b12b in regulating androgen in the gonads of flounder.

[0009] The application of Hsd17b12b in regulating androstenedione in the ovary of Japanese flounder.

[0010] The Hsd17b12b can increase the level of androstenedione in the ovaries of female flounder and increase the number of oogonia-like cells in the ovaries.

[0011] The Hsd17b12b is a protein transiently expressed in human embryonic kidney cells HEK293T using a eukaryotic expression recombinant plasmid constructed using the flounder Hsd17b12b gene.

[0012] The eukaryotic expression recombinant plasmid is based on the nucleotide sequence XM_020099439.1 of the Hsd17b12b gene. The Hsd17b12b coding sequence is obtained by PCR amplification, purified, and recombined into the eukaryotic expression vector pcDNA3.1 / myc-His(-)A using homology arms. The recombinant plasmid is then transfected into human embryonic kidney cells HEK293T to transiently express Hsd17b12b.

[0013] The coding sequence of the Hsd17b12b gene is shown in SEQ ID NO: 1

[0014] Specifically, the recombinant plasmid was transfected into HEK293T cells. Twelve hours after transfection, the culture medium was replaced with DMEM (1% fetal bovine serum) containing 5 μg / mL testosterone. After 6 hours of culture, the cells and culture medium were harvested, and total protein was extracted for Western blot analysis. The culture medium was also assayed for testosterone and androstenedione to identify their substrates and products.

[0015] The advantages of the present invention are:

[0016] This study, for the first time, used HEK293T cells to transiently express Hsd17b12b. Substrate and product assays confirmed that Hsd17b12b can convert testosterone into androstenedione. Intraperitoneal injection of the recombinant plasmid obtained from this study into the Japanese flounder significantly increased androstenedione levels in the ovaries (P < 0.05), and also resulted in the appearance of more oogonia-like cells in the ovaries.

[0017] The technical method of the present invention can be used for the study of the synthesis and control of sex hormones of the gene in flounder, can specifically control the specific production pathway of sex hormones and exert their effects in the body, and is more environmentally friendly and effective when applied in aquaculture. Therefore, it has broad application prospects and can also be promoted and applied to other fish. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Results of androstenedione levels in the culture medium of HEK293T cells transfected with pcDNA3.1-Hsd17b12b to express Hsd17b12b and after testosterone addition, as provided in the examples of the present invention. A: Western blot analysis using a His-tag antibody. B: LC-MS analysis of testosterone and androstenedione levels in the testosterone-treated group.

[0019] Figure 2 This example shows the histological changes in the ovaries of Japanese flounder following intraperitoneal injection of the pcDNA3.1-Hsd17b12b recombinant plasmid. A: Ovarian tissue from the control group. B: Ovarian tissue from the pcDNA3.1-Hsd17b12b-injected group. White arrows indicate oogonia-like cells; black arrows indicate oocytes.

[0020] Figure 3 The present invention provides the results of an ELISA assay for androstenedione levels in Japanese flounder following intraperitoneal injection of the pcDNA3.1-Hsd17b12b recombinant plasmid. A, Hsd17b12b gene expression assay results; *, significant difference (P < 0.05). B, androstenedione concentration in the ovary; *, significant difference (P < 0.05). DETAILED DESCRIPTION

[0021] The specific implementation manner of the present invention will be further described below in conjunction with examples and drawings. It should be noted that the specific implementation manner described here is only for illustrating and explaining the present invention and is not intended to limit the present invention.

[0022] The present invention uses mammalian HEK293T cells to transiently express the Japanese flounder Hsd17b12b, which can convert testosterone in the culture medium into androstenedione. In vivo experiments have also confirmed that recombinant Hsd17b12b can increase androstenedione levels in the ovaries of Japanese flounder.

[0023] Example 1: Eukaryotic expression of flounder Hsd17b12b in HEK293T cells

[0024] Total RNA was extracted from the ovarian tissue of the Japanese flounder and reverse transcribed into cDNA. Using this as a template, Hsd17b12b-BamHIF and Hsd17b12b-BamHI R were used as primers to obtain the Japanese flounder Hsd17b12b CDS sequence (SEQ ID NO: 1) containing homology arms by PCR amplification. The amplification conditions were: pre-denaturation at 94°C for 2 minutes; denaturation at 94°C for 30 seconds, annealing at 62°C for 30 seconds, extension at 72°C for 2 minutes, 35 cycles; final extension at 72°C for 5 minutes. The amplified product was purified by gel recovery. At the same time, the commonly used vector pcDNA3.1 / myc-His(-)A was linearized with the Takara restriction endonuclease BamHI, and the purified fragment was recombined into the linearized vector using the CloneSmarter homologous recombination kit. The primer sequences used are:

[0025] Hsd17b12b-BamHI F:

[0026] 5'-CACACTGGACTAGTggatccGCCACCATGGTTGTGACAGG-3'

[0027] Hsd17b12b-BamHI R:

[0028] 5'-AGCTTGGTACCGAGCTCggatccTCCCTGCTTCTGTTTCT-3'

[0029] The recombinant plasmid was transformed into DH5α Escherichia coli and plated onto LB (LA) plates containing 0.1% ampicillin. After overnight incubation, positive recombinants were screened and sequenced using a universal T7 primer (5'-TAATACGACTCACTATAGGG-3') to confirm that the recombinants contained the sequence shown in SEQ ID NO: 1.

[0030] SEQ ID NO: 1

[0031] ATGGTTGTGACAGGAGCCACAGATGGGATTGGGAAAGCTTACCGCAGAGGAGCTGGCCCGCAGAGGCTTTGCAATCGTGCTGATCAGCCGCTCTCAGGAGAAGCTGGATGAAGTCTCCAAGATGATCGCAAGCAGATGTGGCGTGGAGACTAAAACGATTGCAGCGGACTTCAGTGACGTCAACATCTACTCTAAG ATTGAGGAAGGACTCTCGGGGCTGGAGATCGGTGTATTGGTGAACAATGTTGGAATATCTTACTCTTACCCTGAATTCTTCCTGAATGTTCCCAATCTCGACACGTTCATCGACACCATGGTCAACATTAACATAACATCGGTTTGCCAAATGACTCGTCTCGTTTTGCCTCAAATGGTGGAGAGGAAGAAGGGGG CCATCCTCAACATCTCATCCGCCAGTGGGATGTACCCTGTTCCTCTTCTCTGTCTACTCTGCCTCCAAGGCATTTGTGGACTTCTTCTCACGAGGACTGCAGGCTGAGTACAAGAGCAAAGGCATCATCCAGAGCGTTCTGCCATTTTTTGTTGCAACCAAGTTGAGTAAAATCCGTCGGGCTACGCTGGA CAAGCCCACTCCAGAACGCTACGTCGCGGCCGAGCTCAACACTGTGGGGTTACAGACCCAGACCAACGGATAACCTGCCCCACGCCATCATTGGCTGGGTGACCACGGCTCTGCTCCTGCCAAGATCCTCAACAGCTACGTGATGGGGATGGGGTTGTCCCAGCGCGCTCATTACCTCAAGAAACAGAAGCAGGGA

[0032] The positive recombinant bacterial suspension obtained above was inoculated into 5 mL of LA medium and cultured overnight at 37°C and 220 rpm. The plasmid was extracted using the Kangwei Century Endotoxin-Free Plasmid Extraction Kit. HEK293T cells were seeded into 12-well plates and then transfected with the endotoxin-free recombinant plasmid and Yisheng transfection reagent (plasmid: transfection reagent = 1 μg: 3 μL) into the HEK293T cells to obtain cells expressing Japanese flounder Hsd17b12b.

[0033] The cells expressing Hsd17b12b of Japanese flounder obtained above were cultured in DMEM medium (containing 1% fetal bovine serum) containing testosterone (concentration of 5 μg / mL) and cultured for 6 hours before the cells and culture medium were collected. The collected cells were lysed with Biyuntian Cell Tissue Rapid Lysis Buffer containing 1M protease inhibitors and boiled to obtain total protein for Western blot analysis. The results of Western blot analysis are shown in Figure 2. Figure 1 As shown in A. At the same time, the culture medium of the testosterone group was taken out, and after the three biological replicates were mixed, the testosterone and androstenedione therein were detected by liquid chromatography-mass spectrometry LC-MS. The LC-MS detection results are shown in Figure Figure 1 As shown in B.

[0034] Depend on Figure 1 As shown in A, Hsd17b12b was transiently expressed in HEK293T cells, and androstenedione was produced in the cell culture medium after the addition of testosterone ( Figure 1 B) indicates that Hsd17b12b expressed in vitro can convert testosterone into androstenedione.

[0035] Example 2: Effect of recombinant flounder Hsd17b12b on androstenedione levels in flounder ovaries

[0036] Female flounder weighing 58±9g were selected, 30 per group, and injected with the recombinant plasmid described in Example 1 at a concentration of 0.1μg / g body weight. In addition, Ingen in vivo DNA transfection reagent was added at a ratio of 2.3μg:1μL of plasmid:transfection reagent. Injections were repeated every 7 days until day 49. At day 49, the fish were anesthetized with 35ppm ethyl 3-aminobenzoate methanesulfonate (MS-222). Gonadal tissue was then dissected and obtained. A portion of the gonad was fixed in Davidson medium for tissue sectioning and hematoxylin / eosin staining for histological observation. A portion of the gonad was used for total RNA extraction using the Trizol method. In vitro reverse transcription using Ingen Reverse Transcription Reagent was used to obtain cDNA for qPCR analysis of gene expression levels. Androstenedione levels were measured using ELISA in a portion of the gonad.

[0037] Depend on Figure 2 It can be seen that long-term intraperitoneal injection of pcDNA3.1-Hsd17b12b recombinant plasmid in flounder resulted in the appearance of more oogonia-like cells in the ovary, in which the expression level of Hsd17b12b was significantly increased ( Figure 3 A), and at the same time, the level of androstenedione also increased significantly ( Figure 3 B).

Claims

1. A use of flounder 17β-hydroxysteroid dehydrogenase 12b, characterized in that: Utilization of 17β-hydroxysteroid dehydrogenase 12b (Hsd17b12b) in regulating androgen production in the gonads of Japanese flounder.

2. The use of flounder 17β-hydroxysteroid dehydrogenase 12b according to claim 1, characterized in that: The application of Hsd17b12b in regulating androstenedione in the ovary of Japanese flounder.

3. The use of flounder 17β-hydroxysteroid dehydrogenase 12b according to any one of claims 1 to 2, characterized in that: The Hsd17b12b is a protein transiently expressed in human embryonic kidney cells HEK293T using a eukaryotic expression recombinant plasmid constructed using the flounder Hsd17b12b gene.

4. The use of flounder 17β-hydroxysteroid dehydrogenase 12b according to claim 3, characterized in that: The eukaryotic expression recombinant plasmid is based on the nucleotide sequence XM_020099439.1 of the Hsd17b12b gene. The Hsd17b12b coding sequence is obtained by PCR amplification, purified, and recombined into the eukaryotic expression vector pcDNA3.1 / myc-His(-)A using homology arms. The recombinant plasmid is then transfected into human embryonic kidney cells HEK293T to transiently express Hsd17b12b.

5. The use of flounder 17β-hydroxysteroid dehydrogenase 12b according to claim 4, characterized in that: The coding sequence of the Hsd17b12b gene is shown in SEQ ID NO: 1.