A DNA vaccine for preventing acute Toxoplasma gondii infection
By constructing a recombinant plasmid containing SAG1 and SABP1 genes, DNA vaccine was prepared, and the problem of poor effectiveness of single-gene vaccines was solved, and effective prevention and enhancement of immune response was achieved for acute infection of Toxoplasma gondii.
Patent Information
- Application Number
- CN202310704734.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-14
- Publication Date
- 2025-08-01
- Estimated Expiration
- 2043-06-14
AI Technical Summary
Existing single-gene DNA vaccines are difficult to stimulate the host to produce a complete immune response, and are difficult to effectively prevent acute infection of Toxoplasma gondii. Sulfonamide drugs are ineffective against chronic infection and have great side effects.
Recombinant plasmids pVAX1-SAG1 and pVAX1-SABP1 containing the SAG1 and SABP1 genes were constructed. A single or combined DNA vaccine was prepared through pVAX1 as a skeletal vector to stimulate the cellular immune response.
It significantly enhanced the cellular immune response of mice, improved resistance to acute infection of Toxoplasma gondii, and combined vaccine was the best, extending the survival time of mice.
Smart Images

Figure CN116603057B_ABST
Abstract
Description
Technical Field
[0001] The embodiments of the present invention relate to the field of biological medicine technology, and particularly to a DNA vaccine for preventing acute Toxoplasma gondii infection. Background Art
[0002] Toxoplasma gondii is an important zoonotic parasitic protozoan with a wide range of intermediate hosts. Humans can be infected by ingesting food, water sources contaminated with oocysts or undercooked meat containing cysts. Sulfonamides have a certain effect on acute Toxoplasma gondii infection, but have little effect on chronic Toxoplasma gondii infection. At the same time, sulfonamides have relatively large side effects on the human body. Therefore, studying new, safe and effective Toxoplasma gondii vaccines has important veterinary public health significance for preventing and controlling Toxoplasma gondii disease.
[0003] Compared with traditional vaccines, the greatest advantage of DNA vaccines is that they do not have the risks similar to live vaccines and are easy to induce the generation of CD8 + cytotoxic T lymphocyte (CTL) responses, triggering an immune response against infected cells; their antigen synthesis and presentation methods are more similar to natural pathogen infections, making DNA vaccines may be more effective against Toxoplasma gondii infection. Monovalent vaccines have a certain immune effect. However, due to the complex life cycle and immune evasion mechanism of Toxoplasma gondii, and different antigens induce different immune effects in the body, it is difficult for DNA vaccines prepared with a single antigen to stimulate the complete immune response of the host and it is difficult to achieve an ideal immune effect. Multigene DNA vaccines may have better protective effects than single-gene DNA vaccines. Therefore, the preparation of Toxoplasma gondii multigene DNA vaccines has become a research hotspot. Summary of the Invention
[0004] The mechanism by which Toxoplasma gondii tachyzoites invade host cells is complex, and multiple parasite proteins are involved in the invasion process. Among them, SAG1, as an important surface protein during the Toxoplasma gondii tachyzoite stage, participates in the adsorption and invasion of the parasite, has high immunogenicity, can stimulate the body to produce strong humoral and cellular immune responses, and is considered the most potential Toxoplasma gondii vaccine antigen. Previous studies in our laboratory found that another membrane surface protein of Toxoplasma gondii, SABP1, can bind to sialic acid molecules on the surface of host cells, and then mediate the adhesion and invasion of Toxoplasma gondii to host cells, playing an important role in the process of Toxoplasma gondii invading host cells. At the same time, the C-terminus of the SABP1 protein has an Immune mapped protein (IMP) domain, which is very conserved in the Apicomplexa protozoan family and has good immunogenicity. There is currently no research on the combined immunization effect of DNA vaccines of SAG1 and SABP1 proteins.
[0005] To this end, an embodiment of the present invention provides a DNA vaccine for preventing acute Toxoplasma gondii infection.
[0006] In order to achieve the above object, an embodiment of the present invention provides the following technical solutions:
[0007] According to the first aspect of the embodiments of the present invention, the present invention provides a DNA vaccine for preventing Toxoplasma gondii infection, which contains the following nucleotide sequences:
[0008] 1) The nucleotide sequence shown in SEQ ID NO.1 for encoding SAG1; and / or,
[0009] 2) The nucleotide sequence shown in SEQ ID NO.2 for encoding SABP1.
[0010] Furthermore, pVAX1 is used as a backbone vector.
[0011] According to the second aspect of the embodiments of the present invention, the present invention provides a preparation method of the DNA vaccine for preventing acute Toxoplasma gondii infection as described above, including:
[0012] Construct recombinant plasmids pVAX1-SAG1 and pVAX1-SABP1;
[0013] The recombinant plasmids pVAX1-SAG1 and pVAX1-SABP1 alone constitute the DNA vaccine; or, the recombinant plasmids pVAX1-SAG1 and pVAX1-SABP1 are mixed to constitute the DNA vaccine.
[0014] Furthermore, in the DNA vaccine formed by mixing, the mass ratio of the recombinant plasmid pVAX1-SAG1 to pVAX1-SABP is 1:1.
[0015] Furthermore, the DNA vaccine further includes a pharmaceutically acceptable carrier.
[0016] The embodiments of the present invention have the following advantages:
[0017] The present invention constructs eukaryotic expression plasmids pVAX1-SAG1 and pVAX1-SABP1 expressing Toxoplasma gondii plasma membrane proteins SAG1 and SABP1, verifies their high expression in 293T cells by indirect immunofluorescence technology, and then prepares a large amount of DNA vaccines, which are used to immunize Balb / c mice individually or in combination. After the fourth immunization, the humoral immunity and cellular immunity indexes, spleen lymphocyte proliferation ability, cytokine production ability of the mice, and their immune protection effects against Toxoplasma gondii RH strain infection are measured. The DNA vaccines constructed in the present invention can protect mice against Toxoplasma gondii RH strain infection to varying degrees, and the combined immunization with DNA vaccines has the best protection effect, effectively improving the immune effect of single-gene vaccines, stimulating the mice to produce cellular immune responses, and significantly enhancing the ability of the mice to resist acute Toxoplasma gondii infection. The present invention lays a new experimental foundation for the development of new drugs and vaccines against Toxoplasma gondii. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only exemplary, and those of ordinary skill in the art can also obtain other implementation drawings according to the provided drawings without creative efforts.
[0019] Figure 1 Nucleic acid electrophoresis identification of the recombinant plasmid pVAX1-SABP1 provided by the embodiment of the present invention, where 1 is pVAX1-SABP1.
[0020] Figure 2 Nucleic acid electrophoresis identification of the recombinant plasmid pVAX1-SAG1 provided by the embodiment of the present invention, where 1 is pVAX1-SAG1.
[0021] Figure 3 In vitro expression Western blot verification of the recombinant plasmids pVAX1-SAG1 and pVAX1-SABP1 provided by the embodiment of the present invention, where 1 is pVAX1-SAG1; 2 is pVAX1-SABP1; 3 is pVAX1; 4 is normal cells.
[0022] Figure 4 In vitro expression IFA verification of the recombinant plasmid pVAX1-SAG1 provided by the embodiment of the present invention (10× eyepiece × 20× objective).
[0023] Figure 5 In vitro expression IFA verification of the recombinant plasmid pVAX1-SABP1 provided by the embodiment of the present invention (10× eyepiece × 20× objective).
[0024] Figure 6In vitro expression IFA verification of the pVAX1 empty vector provided by the embodiments of the present invention (10×eyepiece × 20×objective).
[0025] Figure 7 Detection of the total IgG antibody titer in the serum of immunized mice provided by the embodiments of the present invention (**P<0.01, ***P<0.001, and ****P<0.0001).
[0026] Figure 8 Detection of IgG1 and IgG2a subclasses in the serum of immunized mice provided by the embodiments of the present invention (*P<0.05, **P<0.01, ***P<0.001, and ****P<0.0001).
[0027] Figure 9 Detection of the proliferation of splenocytes of immunized mice at 48 h provided by the embodiments of the present invention (*P<0.05, **P<0.01, ***P<0.001, and ****P<0.0001).
[0028] Figure 10 Detection of the proliferation of splenocytes of immunized mice at 72 h provided by the embodiments of the present invention (*P<0.05, **P<0.01, ***P<0.001, and ****P<0.0001).
[0029] Figure 11 Detection of the IFN-γ level of immunized mice provided by the embodiments of the present invention (****P<0.0001).
[0030] Figure 12 Detection of the IL-2 level of immunized mice provided by the embodiments of the present invention (****P<0.0001).
[0031] Figure 13 Detection of the IL-4 level of immunized mice provided by the embodiments of the present invention (**P<0.01 and ****P<0.0001).
[0032] Figure 14 Detection of the IL12(p70) level of immunized mice provided by the embodiments of the present invention (****P<0.0001).
[0033] Figure 15 Monitoring of the protection of immunized mice against worm infection provided by the embodiments of the present invention Detailed implementation manners
[0034] The following specific embodiments illustrate the implementation manners of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of them. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without making creative efforts belong to the scope of protection of the present invention.
[0035] Example 1 Construction of pVAX1-SABP1 Recombinant Plasmid
[0036] Using the pDEST-17-SABP1 plasmid constructed in the early stage of this laboratory as a template, specific primers for the SABP1 gene were designed (DOI: 10.1093 / infdis / jiaa072). The primer sequences are as follows: pVAX1-SABP1-5: 5'AACTTAAGCTTGCCACCATGGGATCTGGCAACAAC 3' (SEQ ID NO.3), pVAX1-SABP1-3: 5'TCCGTCTAGATCAATGGTGATGGTGATGATGCTTC 3' (SEQ ID NO.4). The synthesized primers were diluted to a working concentration of 10 μM, and the coding sequence of the SABP1 gene (SEQ ID NO.1) was obtained by PCR amplification. It was inserted into the middle of the HindⅢ and XbaⅠ restriction enzyme cleavage sites of the vector pVAX1 through restriction enzyme digestion and ligation to obtain the pVAX1-SABP1 recombinant plasmid. The constructed recombinant plasmid pVAX1-SABP1 was identified by nucleic acid electrophoresis, and the results are as Figure 1 shown.
[0037] Example 2 Construction of pVAX1-SAG1 Recombinant Plasmid
[0038] Log in to the homepage of the ToxoDB website, enter "TGGT1_233460", copy the full-length CDS sequence of the SAG1 gene, and paste it into the Primer 5.0 software to design specific primers for the SAG1 gene. The designed primer sequences are as follows: pVAX1-SAG1-5: 5'CTAGTCTAGATCAGTGGTGGTGGTGGTGGT3' (SEQ ID NO.5), pVAX1-SAG1-3: 5'ACCCAAGCTTATGGGCAGCAGCCAT3' (SEQ ID NO.6). Dilute the synthesized primers to a working concentration of 10 μM. Using the cDNA of Toxoplasma gondii RH strain as a template, the coding sequence of the SAG1 gene (SEQ ID NO.2) was obtained by PCR amplification, and inserted into the middle of the HindⅢ and XbaⅠ restriction enzyme cleavage sites of the vector pVAX1 through restriction enzyme digestion and ligation to obtain the recombinant plasmid pVAX1-SAG1. The constructed recombinant plasmid pVAX1-SAG1 was identified by nucleic acid electrophoresis, and the results are as Figure 2 shown.
[0039] Example 3 Verification of in vitro expression of recombinant plasmid
[0040] (1) Western blot verification
[0041] The recombinant plasmids pVAX1-SAG1 and pVAX1-SABP1 were introduced into 293T cells by liposome transfection with Lipo6000 TM respectively, and the pVAX1 empty vector was used as a negative control. After culturing for 24 h, discard the upper culture medium, wash three times with PBS, add 5×SDS loading buffer, boil for 10 min to prepare the sample, and perform SDS-PAGE and Western blot analysis after the sample has cooled to room temperature. Use PBST solution containing 1% BSA as the blocking solution, and use mouse polyclonal antibodies against SAG1 and SABP1 as the primary antibodies, and HRP-labeled goat anti-mouse IgG (H+L) as the secondary antibody to identify the target protein. The results showed that correct bands appeared at the target size positions, indicating that pVAX1-SAG1 and pVAX1-SABP1 were successfully expressed in 293T cells. The results are as Figure 3 shown.
[0042] (2) IFA verification
[0043] The recombinant plasmids pVAX1-SAG1 and pVAX1-SABP1 were transfected with Lipo6000 TMLiposomes were transfected into 293T cells, and the pVAX1 empty vector was used as a negative control. After culturing for 24 h, the cells were washed once with PBS, fixed with 4% paraformaldehyde at room temperature for 15 min, washed three times with PBS, then blocked with a blocking solution (PBST containing 1% BSA and 22.52 mg / ml glycine) at 37 °C for 1 h. Mouse polyclonal antibodies against SAG1 and SABP1 were used as primary antibodies. After incubation at 37 °C for 1 h, the cells were washed three times with PBST. Alexa Fluor 488 goat anti-mouse IgG (H+L) was used as the secondary antibody (diluent: PBST containing 1% BSA), and the cells were incubated at 37 °C for 1 h. After washing three times with PBS, ProLong TM Gold Antifade Mountant with DAPI was added dropwise. After sealing the coverslip with nail polish, the cells were observed under an upright fluorescence microscope. The results showed that obvious green fluorescence could be detected in the recombinant plasmid transfection group as shown in Figure 4 、 Figure 5 , while no fluorescence was observed in the negative control group as shown in Figure 6 , indicating the successful expression of pVAX1-SAG1 and pVAX1-SABP1 in 293T cells.
[0044] Example 4 Preparation of DNA vaccines
[0045] The verified recombinant plasmids pVAX1-SAG1 and pVAX1-SABP1 were subjected to large-scale endotoxin-free plasmid extraction to obtain DNA vaccines. These two recombinant plasmids alone constituted DNA vaccines, or a combined DNA vaccine was obtained by mixing the two recombinant plasmids at a mass ratio of 1:1. The immunization was divided into 6 groups. The first group was blank mice without immunization; the second group was the negative group injected with sterile PBS buffer; the third group was the pVAX1 empty vector group; the fourth group was the pVAX1-SABP1 recombinant plasmid immunization group; the fifth group was the pVAX1-SAG1 recombinant plasmid immunization group; the sixth group was the pVAX1-SABP1 + pVAX1-SAG1 combined immunization group. The prepared DNA vaccines were used to immunize mice by intramuscular injection. The plasmid concentration was diluted to 1 μg / μL. Each mouse in the third group was injected with 100 μg of pVAX1 plasmid, each mouse in the fourth group was injected with 100 μg of pVAX1-SAG1 plasmid, each mouse in the fifth group was injected with 100 μg of pVAX1-SABP1 plasmid, and each mouse in the sixth group was injected with 50 μg of pVAX1-SAG1 and 50 μg of pVAX1-SABP1 respectively.
[0046] Example 5 Evaluation of immunogenicity of DNA vaccines
[0047] (1) Detection of serum IgG antibody titers and IgG1, IgG2a subclasses in immunized mice
[0048] Mouse tail tip blood was collected 10 days after each immunization. The enzyme-linked immunosorbent assay (ELISA) plate was coated with Toxoplasma lysed antigen (TLA). The total antibody titer was detected using HRP-goat anti-mouse (H+L). Mouse tail tip blood was collected 10 days after the last immunization. The ELISA plate was coated with TLA, and the antibody subtypes were detected using HRP-Polyclonal Goat Anti Mouse IgG1 and HRP-Polyclonal Goat Anti Mouse IgG2a. The results showed that with the increase in the number of immunizations, the antibody titers of mice in the single DNA vaccine and combined DNA vaccine immunization groups increased, and there were significant differences compared with the blank control, negative group, and empty vector group (P<0.0001). After IgG subtype analysis, the IgG1 and IgG2a antibody subclass titers of mice in the single DNA vaccine and combined DNA vaccine immunization groups were significantly higher than those in the blank control, negative group, and empty vector group, and the OD 450nm value of IgG2a was higher than that of IgG1 (P<0.0001), indicating that after immunization with this DNA vaccine in BALB / c mice, it mainly induced a Th1-type immune response and induced a cellular immune response in the mouse body. The results of the total antibody titer are as Figure 7 shown; the results of the antibody subtype detection are as Figure 8 shown.
[0049] (2) Splenic lymphocyte proliferation assay
[0050] Ten days after the last immunization, 3 BALB / c mice were randomly selected from each group for eyeball blood collection. After sacrifice, the mice were soaked in 70% alcohol for 10 min. The spleens of the mice were aseptically removed, ground with a 200-mesh cell sieve, and 10 mL of culture medium containing 12% fetal bovine serum was added to wash the cell sieve. Centrifugation was performed at 2000 rpm at room temperature for 10 min, the cell culture medium was discarded, the cells were washed once with PBS buffer, and then 5 mL of hemolysin was added to lyse the splenocytes. After adding liquid to 15 mL, the mixture was homogenized and allowed to stand at room temperature for 5 min. Centrifugation was performed at room temperature for 10 min, the hemolysin was discarded, and the cell lysis was repeated once; the hemolysin was discarded, the splenocytes were resuspended with PBS buffer, and the splenocytes were washed 2 more times; Trypan blue was added to observe the cell status; after counting, the splenic lymphocytes were seeded into a 96-well cell culture plate (5×10 5(In the wells), add TLA (20 μg / mL), ConA (5 μg / mL) or GST (20 μg / mL) to stimulate lymphocytes, and culture them in an incubator for 48 h and 72 h; add 20 μL of CCK-8 reagent to each well and incubate for 4 h; the results show that the splenocytes of mice in each group proliferated under the stimulation of ConA, while the splenocytes of control group mice did not proliferate under the stimulation of TLA; compared with the stimulation with 1640 culture medium, the splenocytes of immunized mice were significantly increased under the stimulation of TLA, indicating that after the immunized mice were stimulated with specific antigen, they could effectively activate T and B lymphocytes to resist the invasion of Toxoplasma gondii. The results are as Figure 9 and Figure 10 shown.
[0051] (3) Detection of cytokine levels
[0052] While performing the splenocyte proliferation assay, collect the supernatant samples of splenocytes after 24 h of stimulation for the determination of IL-2 and IL4; collect the supernatant samples of splenocytes after 96 h of stimulation for the determination of IL-12p70 and IFN-γ. The results show that compared with the control group, the levels of IL-2, IL4, IL-12p70 and IFN-γ in immunized mice were significantly increased, and the levels of each cytokine in the combined immunization group increased most significantly (P < 0.0001). The results are as Figures 11-14 shown.
[0053] Example 6 Evaluation of the immunoprotective effect of DNA vaccine
[0054] Ten days after the fourth immunization, each experimental group of mice was intraperitoneally injected with 50 Toxoplasma gondii RH strain tachyzoites. Compared with other experimental groups, the combined DNA vaccine could effectively prolong the survival time of the challenged mice. Compared with the blank group, negative group and empty vector group, the average survival time of mice was prolonged by 4.33 d (P < 0.0001), indicating that the combined DNA vaccine enhanced the resistance of mice to acute Toxoplasma gondii infection. The results are as Figure 15 shown.
[0055] Although the present invention has been described in detail above with general descriptions and specific examples, on the basis of the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection of the present invention.
Claims
1. A method for preparing a DNA vaccine for preventing acute toxoplasma infection, characterized in that, Comprising: The nucleotide sequence shown in SEQ ID NO.1 was inserted into the Hind III and Xba I restriction enzyme cleavage sites of the vector pVAX1 by digestion and ligation to obtain the recombinant plasmid pVAX1-SABP1. The nucleotide sequence shown in SEQ ID NO.2 was inserted into the Hind III and Xba I restriction enzyme cleavage sites of the vector pVAX1 by digestion and ligation to obtain the recombinant plasmid pVAX1-SAG1; The recombinant plasmids pVAX1-SAG1 and pVAX1-SABP1 are mixed at a mass ratio of 1:1 to form a DNA vaccine.
2. The preparation method of the DNA vaccine for preventing acute Toxoplasma gondii infection according to claim 1, characterized in that The DNA vaccine further comprises a pharmaceutically acceptable carrier.