Novel zinc-binding dehydrogenase variant and method for producing L-aromatic amino acids using the same

Abstract

The present invention relates to a novel zinc-binding dehydrogenase variant and a method for producing L-aromatic amino acids using the same. The zinc-binding dehydrogenase variant changes the enzyme activity by replacing one or more amino acids in the amino acid sequence constituting the zinc-binding dehydrogenase, so that a recombinant microorganism containing the variant can effectively produce L-aromatic amino acids.

Description

Technical Field

[0001] The present invention relates to a novel zinc-binding dehydrogenase variant and a method for producing L-aromatic amino acids using the same. Background Art

[0002] Amino acids are classified into hydrophobic, hydrophilic, basic and acidic amino acids according to the properties of their side chains. Among them, amino acids with benzene rings are called aromatic amino acids. Among aromatic amino acids, there are phenylalanine, tyrosine and tryptophan. Phenylalanine and tryptophan are essential amino acids that cannot be synthesized in living organisms. They are high value-added industries that form a market of 300 billion US dollars per year worldwide.

[0003] The production of aromatic amino acids can utilize wild-type strains obtained under natural conditions or mutants that have been modified in a manner that improves their amino acid production capacity. In recent years, in order to improve the production efficiency of aromatic amino acids, microorganisms such as Escherichia coli and Corynebacterium that are often used for the production of useful substances such as L-amino acids have been used as targets, and gene recombination technology has been applied to develop various recombinant strains or mutants with excellent L-aromatic amino acid production capacity and methods for producing L-aromatic amino acids using them. In particular, the following attempts have been made: targeting genes such as enzymes, transcription factors, and transport proteins that participate in the biosynthetic pathway of L-aromatic amino acids, or inducing mutations in promoters that regulate their expression, thereby expanding the production of corresponding amino acids. However, the types of proteins such as enzymes, transcription factors, and transport proteins that are directly or indirectly related to the production of L-aromatic amino acids reach more than dozens of species, so whether the L-aromatic amino acid production capacity that changes according to the activity of such proteins is increased, in fact, a large amount of research is still needed.

[0004] Prior art literature

[0005] Patent Literature

[0006] Korean Patent No. 10-1830002 Summary of the invention

[0007] The object of the present invention is to provide novel zinc-binding dehydrogenase variants.

[0008] In addition, the present invention provides polynucleotides encoding the above variants.

[0009] In addition, the present invention provides a transformant comprising the above-mentioned variant or polynucleotide.

[0010] Another object of the present invention is to provide a method for producing L-aromatic amino acids using the above transformant.

[0011] One embodiment of the present invention provides a zinc-binding dehydrogenase variant consisting of the amino acid sequence of SEQ ID NO: 1, wherein glycine at position 102 in the amino acid sequence of SEQ ID NO: 3 is substituted with arginine.

[0012] The "zinc-binding dehydrogenase" used in the present invention is an oxidoreductase that binds zinc and has redox activity in the presence of NAD or NADP. The zinc-binding dehydrogenase may be a gene encoding the zinc-binding dehydrogenase or a sequence having substantial identity therewith. Here, "substantial identity" means that when each gene sequence, i.e., a base sequence or a nucleotide sequence, is aligned and analyzed with any other nucleotide sequence in a manner that corresponds to the greatest extent, the above-mentioned arbitrary other nucleotide sequence and each nucleotide sequence have a sequence homology of 70% or more, 80% or more, 90% or more, or 98% or more.

[0013] The zinc-binding dehydrogenase in the present invention is encoded by the yggP gene and comprises the amino acid sequence of SEQ ID NO:3.

[0014] According to a specific example of the present invention, the amino acid sequence of SEQ ID NO: 3 may be derived from wild-type Escherichia coli.

[0015] "Variant" used in the present invention refers to a polypeptide in which one or more amino acids in the N-terminus, C-terminus and / or the interior of the amino acid sequence of a specific gene of the polypeptide are conservatively replaced and / or changed, so that the amino acid sequence before the variation of the above-mentioned variant is different, but the function or property is maintained. Here, "conservative substitution" refers to replacing an amino acid with other amino acids with similar structure and / or chemical properties, which has little effect on the activity of the protein or polypeptide, or may have no effect at all. In addition, variants include variants in which part of one or more N-terminal leader sequences or transmembrane domains are removed, or variants in which a part is removed from the N- and / or C-terminus of a mature protein. Compared with the polypeptide before variation, the ability of such a variant may be increased, unchanged or reduced. In the present invention, variants can be mixed with variants, changes, variant polypeptides, variant proteins, variations, etc.

[0016] The variant of the present invention is a zinc-binding dehydrogenase variant, in which the 102nd amino acid, namely glycine, in the amino acid sequence of SEQ ID NO:3 is replaced by arginine, and can be composed of the amino acid sequence of SEQ ID NO:1.

[0017] Another aspect of the present invention provides a polynucleotide encoding the above zinc-binding dehydrogenase variant.

[0018] The "polynucleotide" used in the present invention is a polymer of nucleotides formed by long chain-like linkage of nucleotide monomers through covalent bonds, and is a DNA or RNA chain of a certain length or longer. More specifically, it refers to a polynucleotide fragment encoding the above-mentioned variant.

[0019] The polynucleotide may comprise a base sequence encoding the amino acid sequence of SEQ ID NO:1.

[0020] According to a specific example of the present invention, the polynucleotide may include a base sequence represented by SEQ ID NO:2.

[0021] Another aspect of the present invention provides a vector comprising a polynucleotide encoding the above zinc-binding dehydrogenase variant.

[0022] Another aspect of the present invention provides a transformant comprising the above zinc-binding dehydrogenase variant or polynucleotide.

[0023] "Carrier (vector)" used in the present invention refers to all types of nucleic acid sequence transport structures used as a means for delivering and expressing target genes to host cells. Unless otherwise specified, the above-mentioned carrier can refer to inserting the nucleic acid sequence carried into the host cell gene for expression and / or expressing independently. Such a carrier includes the necessary regulatory elements that are operably connected in order to express the gene insert, "operably connected (operably linked)" refers to the functional combination of the target gene and its regulatory sequence with each other and connected in a manner that can carry out gene expression, and "regulatory elements" include promoters for implementing transcription, arbitrary operon sequences for regulating transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences regulating the termination of transcription and translation.

[0024] The vector used in the present invention is not particularly limited as long as it can be replicated in the host cell, and any vector known in the art can be used. As an example of the above-mentioned vector, a plasmid, a cosmid, a virus and a phage in a natural state or a recombinant state can be cited. For example, as a phage vector or a cosmid vector, there are pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and as a plasmid vector, there are pBR systems, pUC systems, pBluescriptII systems, pGEM systems, pTZ systems, pCL systems and pET systems, etc., but are not limited thereto.

[0025] The above-mentioned vector can be constructed as a vector for cloning or a vector for expression. The vector for expression can use a conventional vector for expressing foreign genes or proteins in plants, animals or microorganisms in the field, and can be constructed by various methods known in the field.

[0026] Recombinant vectors can be constructed with prokaryotic cells or eukaryotic cells as hosts. For example, when the vector used is an expression vector and prokaryotic cells are used as hosts, a strong promoter (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter) that can make transcription generally includes a ribosome binding site and a transcription / translation termination sequence for translation initiation. When eukaryotic cells are used as hosts, the replication origin initiated in the eukaryotic cells contained in the vector includes f1 replication origin, SV40 replication origin, pMB1 replication origin, adenovirus replication origin, AAV replication origin, and BBV replication origin, but is not limited thereto. In addition, a promoter derived from a mammalian cell genome (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, tk promoter of HSV) can be utilized, and generally has a polyadenylation sequence as a transcription termination sequence.

[0027] The above-mentioned recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed by the vector. In the culture medium treated with the above-mentioned selection marker, only cells expressing the selection marker can survive, so transformed cells can be selected. As representative examples, the above-mentioned selection markers include kanamycin, streptomycin, chloramphenicol, etc., but are not limited thereto.

[0028] By inserting the recombinant vector into the host cell, a transformant can be prepared, and the transformant can be obtained by introducing the recombinant vector into a suitable host cell. The host cell is a cell that can stably and continuously clone or express the expression vector, and any host cell known in the art can also be used.

[0029] When prokaryotic cells are transformed to produce recombinant microorganisms, Escherichia coli strains such as E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X1776, E. coli W3110, and E. coli XL1-Blue; Bacillus strains such as Bacillus subtilis and Bacillus thuringiensis; various enteric bacteria and strains such as Salmonella typhimurium, Serratia marcescens, and Pseudomonas species can be used as host cells, but the host cells are not limited thereto.

[0030] When eukaryotic cells are transformed to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells can be used as host cells, for example, Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc., but are not limited to these.

[0031] As used herein, “transformation” refers to the phenomenon of artificially causing genetic changes by introducing foreign DNA into host cells, and “transformant” refers to a host cell into which foreign DNA has been introduced and which stably maintains the expression of the target gene.

[0032] In the above-mentioned transformation, a suitable vector introduction technology is selected according to the host cell, so that the target gene or a recombinant vector containing it can be expressed in the host cell. For example, the vector introduction can be implemented by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method or a combination thereof, but is not limited thereto. As long as the transformed gene can be expressed in the host cell, it can be included, without being limited to being inserted into the chromosome of the host cell or being located outside the chromosome.

[0033] The transformant includes cells transfected, transformed or infected with the recombinant vector according to the present invention in vivo or in vitro, and can be used as the same term as a recombinant host cell, a recombinant cell or a recombinant microorganism.

[0034] According to one specific example of the present invention, the transformant may be a strain of the genus Escherichia.

[0035] Examples of the Escherichia strains include, but are not limited to, Escherichia coli, Escherichia albertii, Escherichia blattae, Escherichia fergusonii, Escherichia hermannii, and Escherichia vulneris.

[0036] The transformant in the present invention may be a strain comprising the above-mentioned zinc-binding dehydrogenase variant or a polynucleotide encoding it, or a strain comprising a vector containing it; a strain expressing the above-mentioned zinc-binding dehydrogenase variant or polynucleotide; or a strain having activity against the above-mentioned zinc-binding dehydrogenase variant, but is not limited thereto.

[0037] According to one specific example of the present invention, the transformant may have the ability to produce L-aromatic amino acids.

[0038] The transformant may have the ability to produce L-aromatic amino acids naturally, or may be artificially endowed with the ability to produce L-aromatic amino acids.

[0039] According to one embodiment of the present invention, since the activity of zinc-binding dehydrogenase is altered, the L-aromatic amino acid production capacity of the transformant can be improved.

[0040] As used in the present invention, "productivity is improved" means that the productivity of L-aromatic amino acids is increased compared to the parent strain. The parent strain refers to a wild type or mutant strain that is the object of mutation, including a direct object of mutation or an object transformed by a recombinant vector, etc. In the present invention, the parent strain may be a wild type Escherichia strain or an Escherichia strain mutated from the wild type.

[0041] The transformant according to the present invention introduces a zinc-binding dehydrogenase variant, thereby changing the activity of the zinc-binding dehydrogenase, and shows an increased L-aromatic amino acid production capacity compared with the parent strain. In particular, the L-aromatic amino acid production is increased by more than 5% compared with the parent strain, specifically, by 5 to 60% (preferably 10 to 50%), and 4 to 20 g of L-aromatic amino acids can be produced per 1 liter of strain culture solution.

[0042] Another aspect of the present invention provides a method for producing an L-aromatic amino acid, comprising the steps of: culturing the transformant in a medium; and recovering the L-aromatic amino acid from the transformant or the medium in which the transformant is cultured.

[0043] The above-mentioned culture can be carried out according to suitable culture medium and culture conditions known in the art, and those skilled in the art can easily adjust the culture medium and culture conditions for use. Specifically, the above-mentioned culture medium can be a liquid culture medium, but is not limited thereto. The culture method can include, for example, batch culture, continuous culture, fed-batch culture, or a combination thereof, but is not limited thereto.

[0044] According to a specific example of the present invention, the above-mentioned culture medium must meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by those skilled in the art. Regarding the culture medium of Escherichia strains, reference can be made to the known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but it is not limited thereto.

[0045] According to a specific example of the present invention, the culture medium may contain various carbon sources, nitrogen sources and trace element components. As the carbon source that can be used, sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose, etc. are included; oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, etc.; fatty acids such as palmitic acid, stearic acid, linoleic acid; alcohols such as glycerol and ethanol; organic acids such as acetic acid. These substances can be used alone or in the form of a mixture, but are not limited to this. As the nitrogen source that can be used, peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate can be included. Nitrogen sources can also be used alone or in the form of a mixture, but are not limited to this. As a source of phosphorus that can be used, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts can be included, but are not limited to this. In addition, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate required for growth, but is not limited to this. In addition, essential growth substances such as amino acids and vitamins may be included. In addition, precursors suitable for the culture medium may be used. The above-mentioned culture medium or individual components may be added to the culture solution in batches or continuously in a suitable manner during the culture process, but are not limited thereto.

[0046] According to a specific example of the present invention, during the culture process, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the microbial culture solution in an appropriate manner to adjust the pH of the culture solution. In addition, during the culture process, defoamers such as fatty acid polyethylene glycol esters can be used to inhibit the generation of bubbles. Further, in order to maintain the aerobic state of the culture solution, oxygen or oxygen-containing gas (such as air) can be injected into the culture solution. The temperature of the culture solution can generally be 20°C to 45°C, for example, 25°C to 40°C. The culture time can continue until the desired production of useful substances is obtained, for example, it can be 10 to 160 hours.

[0047] According to a specific example of the present invention, in the step of recovering L-aromatic amino acids from the above-mentioned cultured transformants or the culture medium in which the transformants are cultured, the produced L-aromatic amino acids can be collected or recovered from the culture medium according to the culture method and using a suitable method known in the art. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity and size exclusion) and the like can be used, but are not limited thereto.

[0048] According to a specific example of the present invention, in the step of recovering L-aromatic amino acids, the culture medium may be centrifuged at a low speed to remove biomass, and the obtained supernatant may be separated by ion exchange chromatography.

[0049] According to a specific example of the present invention, the step of recovering the L-aromatic amino acid may include a process of purifying the L-aromatic amino acid.

[0050] According to a specific example of the present invention, the L-aromatic amino acid may be one or more selected from the group consisting of L-tryptophan, L-phenylalanine and L-tyrosine.

[0051] The zinc-binding dehydrogenase variant according to the present invention changes the enzyme activity by replacing one or more amino acids in the amino acid sequence constituting the zinc-binding dehydrogenase, so that a recombinant microorganism containing the variant can efficiently produce L-aromatic amino acids. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 FIG. 1 shows the structure of a plasmid pDSG according to an embodiment of the present invention.

[0053] Figure 2 The structure of plasmid pDS9 according to one embodiment of the present invention is shown. DETAILED DESCRIPTION

[0054] The present invention will be described in more detail below, but such description is provided for illustrative purposes only to help understand the present invention, and the scope of the present invention is not limited to such illustrative description.

[0055] Example 1. Preparation of strains expressing zinc-binding dehydrogenase variants

[0056] In order to confirm the effect of a variant in which glycine at position 102 in the amino acid sequence of zinc-binding dehydrogenase (SEQ ID NO: 3) was replaced with arginine on the production of L-aromatic amino acids, a vector expressing the zinc-binding dehydrogenase variant and a strain into which the vector was introduced were prepared. Plasmids pDSG and pDS9 were used to insert the gene of the zinc-binding dehydrogenase variant into the strain, and the preparation was performed as follows.

[0057] Here, the plasmid pDSG has a replication origin that works only in E. coli, has an ampicillin resistance gene and a guide RNA (gRNA) expression mechanism. The plasmid pDS9 has a replication origin that works only in E. coli, has a kanamycin resistance gene, λRed genes (exo, bet and gam) and a CAS9 expression mechanism derived from Streptococcus pyogenes.

[0058] 1-1. Preparation of transformation vector pDSG-yggP (Gly102Arg)

[0059] Using gDNA of Escherichia coli MG1655 (KCTC14419BP) as a template, PCR was performed using a primer pair of primers 7 and 9 and a primer pair of primers 8 and 10, thereby obtaining an upstream fragment of the 102nd amino acid mutation of the yggP gene of Escherichia coli encoding zinc-binding dehydrogenase, and a primer pair of primers 11 and 13 and a primer pair of primers 12 and 14, thereby obtaining a downstream fragment of the 102nd amino acid mutation of the yggP gene of Escherichia coli. At this time, each upstream and downstream fragment contained a sequence in which glycine (Gly) as the 102nd amino acid residue of the yggP gene was changed to arginine (Arg). Here, Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and PCR amplification was performed under the conditions of denaturation at 95°C for 10 seconds, annealing at 57°C for 15 seconds, and polymerization at 72°C for 10 seconds, which were repeated 30 times.

[0060] Plasmid pDSG was used as a template, and PCR was performed using primer pairs of primers 3 and 5, primer pairs of primers 4 and 6, primer pairs of primers 15 and 1, and primer pairs of primers 16 and 2, respectively, to obtain four pDSG gene fragments. At this time, each gene fragment contained a gRNA sequence targeting Gly No. 102 of the yggP gene. The gRNA selected the first 20mer of NGG of the sequence to be induced to mutate. Here, Takara PrimeSTARMaxDNApolymerase was used as the polymerase, and the PCR amplification conditions were repeated 30 times at 95°C for 10 seconds, 57°C for 15 seconds for annealing, and 72°C for 15 seconds.

[0061] Using the self-assembly cloning method (BioTechniques 51:55-56 (July 2011)), the upstream and downstream of the 102nd amino acid of the obtained yggP gene and four pDSG gene fragments were cloned to obtain a recombinant plasmid, which was named pDSG-yggP (Gly102Arg).

[0062] 1-2. Preparation of L-tryptophan or L-phenylalanine producing strain introduced with zinc-binding dehydrogenase variant yggP (Gly102Arg)

[0063] In order to prepare the L-tryptophan-producing strain and the L-phenylalanine-producing strain, Escherichia coli KFCC11660P and KCCM10016 were used as parent strains.

[0064] Plasmid pDS9 was transformed into KFCC11660P strain or KCCM10016 strain once, cultured in LB-Km (LB liquid medium containing 25 g / L and kanamycin 50 mg / L) solid medium, and selected colonies with kanamycin resistance. Plasmid pDSG-yggP (Gly102Arg) was transformed into the selected colonies twice, cultured in LB-Amp&Km (LB liquid medium containing 25 g / L, ampicillin 100 mg / L and kanamycin 50 mg / L) solid medium, and selected colonies with ampicillin and kanamycin resistance, and then PCR was performed using a primer pair of primers 17 and 18 to obtain gene fragments. Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and the PCR amplification conditions were repeated 30 times of denaturation at 95°C for 10 seconds, annealing at 57°C for 10 seconds, and polymerization at 72°C for 15 seconds. The sequence of the gene fragment obtained using the primer pair of Primer 17 and Primer 18 was confirmed by Macrogen.

[0065] The selected 2 transformants were subcultured 7 times in LB liquid medium, and bacterium colonies were selected in LB solid medium. Each bacterium colony was selectively cultured in LB, LB-Amp and LB-Km solid medium. Bacterium colonies that grew in LB solid medium and did not grow in LB-Amp and LB-Km solid medium were selected. The bacterial strains made by the above method were named KFCC11660P_yggP (Gly102Arg) and KCCM10016_yggP (Gly102Arg) respectively.

[0066] The primer sequences used in Example 1 are shown in Table 1 below.

[0067]

Table 1

[0068] Primer name SEQ ID NO: Primer sequence (5'-3') Primer 1 5 CAATTTTATTATAGTAATTGACTATTATAC Primer 2 6 GCTTGGTAACCAATTTTATTATAGTAATTGACTATTATAC Primer 3 7 GTTACCAAGCGGATATTCAGGTTTTAGAGCTAGAAATAGC Primer 4 8 GGATATTCAGGTTTTAGAGCTAGAAATAGC Primer 5 9 GAGCCTGTCGGCCTACCTGCT Primer 6 10 CGGCCGGCATGAGCCTGTCG Primer 7 11 ATGCCGGCCGGCTGCTATTTATGGCAAGCG Primer 8 12 GCTGCTATTTATGGCAAGCG Primer 9 13 CCCATCGCCGGTTGCAATAC Primer 10 14 GCTTGGTAACCCCATCGCCG Primer 11 15 GTTACCAAGCAGATATTCAGCGGCTACAG Primer 12 16 AGATATTCAGCGGGCTACAG Primer 13 17 TGCTCATAAACATATTGCGT Primer 14 18 GCCCATGCGATGCTCATAAA Primer 15 19 TCGCATGGGCGAGCTCCTGAAAATCTCGATAAC Primer 16 20 GAGCTCCTGAAAATCTCGATAAC Primer 17 21 ACGTGTGACGGATAAACCAC Primer 18 22 TTCACATACACCAGCTCAAT

[0069] Experimental Example 1. Evaluation of L-aromatic amino acid production ability of mutant strains introduced with zinc-binding dehydrogenase variants

[0070] The L-tryptophan or L-phenylalanine production abilities of the parent strains (KFCC11660P and KCCM10016) and the mutant strains into which the zinc-binding dehydrogenase variant was introduced (KFCC11660P_yggP(Gly102Arg) and KCCM10016_yggP(Gly102Arg)) were compared.

[0071] In a 100 mL flask containing 10 mL of the tryptophan production medium or phenylalanine production medium in Table 2 below, each strain (parent strain or variant strain) was inoculated at 1% by volume and cultured with shaking at 37° C. and 200 rpm for 72 hours. After the culture was completed, the concentration of L-tryptophan or L-phenylalanine in the medium was measured using HPLC (Agilent), and the results are shown in Tables 3 and 4 below, respectively.

[0072]

Table 2

[0073]

[0074]

Table 3

[0075]

[0076]

Table 4

[0077]

[0078] As shown in Tables 3 and 4 above, the mutant strains KFCC11660P_yggP(Gly102Arg) and KCCM10016_yggP(Gly102Ar g) introduced with the zinc-binding dehydrogenase variant were confirmed to have L-tryptophan and L-phenylalanine production increased by about 19% and 23%, respectively, compared with the parent strains KFCC11660P and KCCM10016.

[0079] So far, the present invention has been studied around its preferred embodiments. It will be appreciated by those skilled in the art that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative perspective rather than a restrictive perspective. The scope of the present invention is shown in the claims rather than in the above description, and should be interpreted as all differences within the scope of their equivalents are included in the present invention.

Claims

1. Use of a transformant for producing L-aromatic amino acids, wherein the transformant comprises a zinc-binding dehydrogenase variant consisting of the amino acid sequence of SEQ ID NO: 1, The L-aromatic amino acid is L-tryptophan or L-phenylalanine.

2. The use according to claim 1, wherein the transformant is a strain of the genus Escherichia.

3. A method for producing L-aromatic amino acids, comprising the following steps: a step of culturing a transformant comprising a zinc-binding dehydrogenase variant consisting of the amino acid sequence of SEQ ID NO: 1 in a culture medium; as well as a step of recovering the L-aromatic amino acid from the transformant or the culture medium in which the transformant is cultured, The L-aromatic amino acid is L-tryptophan or L-phenylalanine.

Images