A benzophenone compound, its preparation method and application

By chromatography and gel column chromatography on Aspergillus sp.WJ-131 fermented substances, 8'-hydroxymonomethylsulfurozhalocentes with immunomodulatory activity were successfully prepared, which solved the problem of lack of immunoactive benzophenone compounds in the prior art, and achieved the development of new compounds for immunomodulatory drugs.

CN116621702BActive Publication Date: 2025-06-13KUNMING MEDICAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310551773.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-17
Publication Date
2025-06-13
Estimated Expiration
2043-05-17

AI Technical Summary

Technical Problem

The prior art has not yet developed an immunoactive benzophenone compound, which limits its use in immunomodulatory drugs.

Method used

8'-hydroxymonomethylsulfuroctacin was prepared by performing a series of chromatography and gel column chromatography on the fermented substance of Aspergillus fumigatus sp.WJ-131, which has strong immunomodulatory activity.

Benefits of technology

The prepared 8'-hydroxymonomethylsulfurozhastrocin is not only more water-soluble, but also has the effect of promoting cell immune enhancement and is suitable for the preparation of immunomodulatory drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116621702B_ABST
    Figure CN116621702B_ABST
Patent Text Reader

Abstract

The present invention belongs to the technical fields of compound preparation and chemical medicine, and particularly relates to a benzophenone compound, a preparation method thereof and an application. The benzophenone compound 8'-hydroxy monomethylsulochrin of the present invention is a new benzophenone compound, which enriches the diversity of benzophenone compounds; compared with conventional benzophenone compounds, it has stronger water solubility; meanwhile, the benzophenone compound 8'-hydroxy monomethylsulochrin has strong immunomodulatory activity, has the effect of promoting the enhancement of cellular immunity, and can be used for preparing immunomodulatory drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical fields of compound preparation and chemical medicine, and particularly relates to a benzophenone compound, a preparation method thereof, and an application thereof. Background Art

[0002] The benzophenone compound molecule is composed of two benzene rings connected by a carbonyl group to form a skeleton nucleus containing 13 carbon atoms, and is connected with main substituents such as hydroxyl group, methoxy group, carbonyl group, isopentenyl group, etc. It is a large class of natural products with high diversity, and is generally considered to be an intermediate for synthesizing xanthone in organisms. Current research shows that most of these components exist in plant leaves, but in common traditional Chinese medicines, except for Belamcanda chinensis and Polygala tenuifolia, there are few reports on benzophenone components. Therefore, the synthesis of benzophenone compounds is very important.

[0003] So far, an anti-tumor injection developed based on the natural benzophenone compound gambogic acid has been declared for clinical research. According to literature reports, natural benzophenone compounds have many biological activities, such as anti-allergy, anti-inflammatory, anti-tumor, α-glucosidase inhibitory activity, and cardiovascular protection, etc., and have broad clinical application prospects. However, there are no relevant reports on benzophenone compounds with immune activity. Summary of the Invention

[0004] The purpose of the present invention is to provide a benzophenone compound, a preparation method thereof, and an application thereof. The benzophenone compound 8'-hydroxy monomethylsulochrin provided by the present invention has immunomodulatory activity and can be used for preparing immunomodulatory drugs.

[0005] The present invention provides a benzophenone compound 8'-hydroxy monomethylsulochrin, and its structural formula is shown in Formula I:

[0006]

[0007] The present invention also provides a preparation method of the benzophenone compound 8'-hydroxy monomethylsulochrin as described in the above technical solution, including the following steps:

[0008] Performing first silica gel column chromatography, second silica gel column chromatography, and gel column chromatography separation on the alcohol extract of the fermentation product of Aspergillus sp. WJ-131 in sequence to obtain the benzophenone compound 8'-hydroxy monomethylsulochrin;

[0009] The eluent for the first silica gel column chromatography is the first chloroform-methanol system; in the first chloroform-methanol system, the volume ratio of chloroform to methanol is 100:0 to 3:1; collect the chloroform-methanol solution elution section with a volume ratio of 60:1 for the second silica gel column chromatography;

[0010] The eluent for the second silica gel column chromatography is the second chloroform-methanol system; in the second chloroform-methanol system, the volume ratio of chloroform to methanol is 60:1;

[0011] The eluent for the gel column chromatography separation is methanol;

[0012] The preservation number of Aspergillus sp. WJ-131 is CCTCC: M 2023225.

[0013] Preferably, the first silica gel column chromatography includes:

[0014] Gradient elution is successively carried out with the first chloroform-methanol systems with volume ratios of 100:0, 60:1, 30:1, 10:1 and 3:1, and the chloroform-methanol solution elution section with a volume ratio of 60:1 is collected to obtain the first silica gel column chromatography solution; the flow rate of the first chloroform-methanol system is 2-5 mL / min.

[0015] Preferably, the pre-packed column for the gel column chromatography separation is an LH type alkylated dextran gel; the flow rate of the eluent for the gel column chromatography separation is 0.5-0.7 mL / min.

[0016] Preferably, the preparation method of the ethanol extract includes the following steps:

[0017] Inoculate the activated Aspergillus sp. WJ-131 into a fermentation medium for fermentation culture to obtain the fermentation product of Aspergillus sp. WJ-131;

[0018] Mix the fermentation product of Aspergillus sp. WJ-131 with absolute ethanol and carry out ultrasonic extraction to obtain the ethanol extract.

[0019] Preferably, the mass ratio of the fermentation product of Aspergillus sp. WJ-131 to the volume of absolute ethanol is (50-80) g:(80-150) mL; the power of the ultrasonic extraction is 250-350 W and the time is 20-40 min.

[0020] Preferably, the fermentation medium is sterilized potato; the temperature of the fermentation culture is 20-28 °C and the time is 30-35 d.

[0021] The present invention also provides the use of the benzophenone compound 8'-hydroxy monomethylsulochrin or the benzophenone compound 8'-hydroxy monomethylsulochrin prepared by the preparation method described in the above technical solution in the preparation of immunomodulatory drugs.

[0022] The present invention also provides an immunomodulatory drug, which includes excipients and the benzophenone compound 8'-hydroxy monomethylsulochrin described in the above technical solution or the benzophenone compound 8'-hydroxy monomethylsulochrin prepared by the preparation method.

[0023] The present invention also provides an Aspergillus fumigatus Aspergillus sp. WJ-131, and the preservation number of the Aspergillus fumigatus Aspergillus sp. WJ-131 is CCTCC: M 2023225.

[0024] Beneficial effects:

[0025] The present invention provides a benzophenone compound 8'-hydroxy monomethylsulochrin, and its structural formula is shown in Formula I:

[0026]

[0027] The benzophenone compound 8'-hydroxy monomethylsulochrin provided by the present invention is a new benzophenone compound, which enriches the diversity of benzophenone compounds; compared with conventional benzophenone compounds, it has stronger water solubility; at the same time, the benzophenone compound 8'-hydroxy monomethylsulochrin has strong immunomodulatory activity, has the effect of promoting the enhancement of cellular immunity, and can be used in the preparation of immunomodulatory drugs.

[0028] The present invention also provides a preparation method of the benzophenone compound 8'-hydroxy monomethylsulochrin. The benzophenone compound 8'-hydroxy monomethylsulochrin is a metabolite of Aspergillus fumigatus Aspergillus sp. WJ-131 and is isolated from its fermentation product. This method for preparing the benzophenone compound 8'-hydroxy monomethylsulochrin using Aspergillus fumigatus Aspergillus sp. WJ-131 as a raw material is simple and easy to implement, has a short cycle, mild culture conditions, few by-products, strong stereoselectivity, low cost, is easy to industrialize, and meets the requirements of modern environmental protection and low-carbon economy.

[0029] Biological preservation information:

[0030] Aspergillus sp. WJ-131 (Aspergillus fumigatus) was deposited at the China Center for Type Culture Collection on March 1, 2023. The deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC: M2023225. Brief Description of the Drawings

[0031] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments.

[0032] Figure 1 For the 1H-NMR spectrum of the benzophenone compound 8'-hydroxyl monomethyl sulochrin in Test Example 1; 1 1H-NMR spectrum;

[0033] Figure 2 For the 13C-NMR and DEPT spectra of the benzophenone compound 8'-hydroxyl monomethyl sulochrin in Test Example 1; 13 13C-NMR and DEPT spectra;

[0034] Figure 3 For the 1H- 1 H- 1 HCOSY spectrum of the benzophenone compound 8'-hydroxyl monomethyl sulochrin in Test Example 1;

[0035] Figure 4 For the HMBC spectrum of the benzophenone compound 8'-hydroxyl monomethyl sulochrin in Test Example 1;

[0036] Figure 5 For the HSQC spectrum of the benzophenone compound 8'-hydroxyl monomethyl sulochrin in Test Example 1;

[0037] Figure 6 For the NOESY spectrum of the benzophenone compound 8'-hydroxyl monomethyl sulochrin in Test Example 1;

[0038] Figure 7 For the HR-ESI-MS spectrum of the benzophenone compound 8'-hydroxyl monomethyl sulochrin in Test Example 1;

[0039] Figure 8 For the X-ray single crystal structure of the benzophenone compound 8'-hydroxyl monomethyl sulochrin in Test Example 1. Detailed Embodiments

[0040] The present invention provides a benzophenone compound 8'-hydroxyl monomethyl sulochrin, and its structural formula is shown in Formula I:

[0041]

[0042] The present invention also provides a method for preparing the benzophenone compound 8'-hydroxy monomethylsulochrin described in the above technical solution, which comprises the following steps:

[0043] Subjecting the alcohol extract of the fermentation product of Aspergillus sp. WJ-131 to first silica gel column chromatography, second silica gel column chromatography and gel column chromatography separation in sequence to obtain the benzophenone compound 8'-hydroxy monomethylsulochrin;

[0044] The eluent for the first silica gel column chromatography is a first chloroform-methanol system; the volume ratio of chloroform to methanol in the first chloroform-methanol system is 100:0 to 3:1;

[0045] The eluent for the second silica gel column chromatography is a second chloroform-methanol system; the volume ratio of chloroform to methanol in the second chloroform-methanol system is 60:1;

[0046] The eluent for the gel column chromatography separation is methanol;

[0047] The preservation number of Aspergillus sp. WJ-131 is CCTCC: M 2023225.

[0048] The present invention preferably prepares the fermentation product of Aspergillus sp. WJ-131. The preparation method of the fermentation product of Aspergillus sp. WJ-131 preferably comprises the following steps: inoculating the activated Aspergillus sp. WJ-131 into a fermentation medium for fermentation culture to obtain the fermentation product of Aspergillus sp. WJ-131.

[0049] The present invention preferably inoculates Aspergillus sp. WJ-131 onto a PDA slant medium for activation culture to obtain the activated Aspergillus sp. WJ-131.

[0050] The Aspergillus sp. WJ-131 of the present invention is preferably isolated from the stem part of Gardenia jasminoides. The ITS sequence of the Aspergillus sp. WJ-131 of the present invention is preferably as shown in SEQ ID NO.1, specifically 5’-TTATGCGGGAGGATATATCCGTGTTCCGAAGGTGCACCTGCGGCA TATCGATAAGCGGAGGATGTGTCCGTAGGGGAGCTGCGATCATCATAAGAGGATGATGCCTCCGTACCCCCACCCCGCATAATATCAATAACCCCAACGTGACCTCTGTTCTGAAACCATGCATACTGAGTTGATTATCGTAATCACTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA-3’. The similarity of this strain with the Aspergillus fumigatus with the accession number NR121481.1 in the NCBI database is 98.19%. And its colony characteristics on the PDA solid medium are: after inoculation for 24 h, the mycelium is white and cottony; after 72 h, it turns light green; after 96 h, a large number of spores are produced and it becomes dark green, and then it spreads from the center of the PDA solid medium to the edge until the whole colony is dark green, and the back of the PDA medium is yellow. Thus, it is confirmed as Aspergillus fumigatus and named Aspergillus sp. WJ-131, and it is deposited.

[0051] The temperature of the activation culture in the present invention is preferably constant temperature culture, and the temperature is preferably 20-28 °C, more preferably 28 °C; the time of the activation culture is preferably 3-7 days, more preferably 5 days. The present invention preferably stores the activated Aspergillus fumigatus Aspergillus sp. WJ-131 in an environment of 5 °C for standby.

[0052] After obtaining the activated Aspergillus fumigatus Aspergillus sp. WJ-131, the present invention preferably inoculates the activated Aspergillus fumigatus Aspergillus sp. WJ-131 into a fermentation medium for fermentation culture to obtain a fermentation product of Aspergillus fumigatus Aspergillus sp. WJ-131. The fermentation medium in the present invention is preferably sterilized potato. The preparation method of the fermentation medium in the present invention preferably includes: sterilizing clean potato pieces in a tissue culture device to obtain the fermentation medium. The diameter of the clean potato pieces in the present invention is preferably 1 cm; the tissue culture device is preferably a tissue culture flask. The mass ratio of the clean potato pieces to the volume of the tissue culture device in the present invention is preferably 45-55 g: 75-85 mL, more preferably 50 g: 80 mL. The sterilization temperature in the present invention is preferably 120-150 °C, more preferably 121-130 °C, and the time is preferably 30-50 min, more preferably 35-40 min. When performing the sterilization in the present invention, it is preferred to cover the tissue culture device.

[0053] The inoculation amount of the activated Aspergillus fumigatus Aspergillus sp. WJ-131 in the present invention is preferably 0.5% of the mass of the fermentation medium. The present invention has no special limitation on the inoculation operation, and conventional technical operations in the art can be used. The temperature of the fermentation culture in the present invention is preferably 20-28 °C, more preferably 25-28 °C; the time is preferably 30-35 days, more preferably 35 days. The present invention can effectively shorten the fermentation time by using the solid fermentation method.

[0054] After obtaining the fermentation product of Aspergillus sp. WJ-131, the present invention preferably mixes the fermentation product of Aspergillus sp. WJ-131 with absolute alcohol and then performs ultrasonic extraction to obtain an ultrasonic extraction mixture. The mass ratio of the fermentation product of Aspergillus sp. WJ-131 to the volume of absolute alcohol in the present invention is preferably (50-80) g: (80-150) mL, more preferably 70 g: 130 mL. The frequency of the ultrasonic extraction in the present invention is preferably 32-40 kHz, more preferably 40 kHz; the time is preferably 20-40 min, more preferably 30 min. The absolute alcohol in the present invention preferably includes methanol, ethanol, propanol or isopropanol, more preferably methanol. In the present invention, the absolute alcohol has good solubility for the benzophenone compound 8'-hydroxy monomethylsulochrin and can well separate the benzophenone compound 8'-hydroxy monomethylsulochrin from the Aspergillus fermentation product.

[0055] After obtaining the ultrasonic extraction mixture, the present invention preferably filters the ultrasonic extraction mixture and distills the obtained filtrate under reduced pressure to obtain a crude extract. The present invention has no special limitation on the specific process of the filtration, and the process well-known to those skilled in the art can be adopted. The vacuum degree of the reduced pressure distillation in the present invention is preferably 10-15 kPa, more preferably 12 kPa; the temperature is preferably 45-55 °C, more preferably 50 °C. The present invention has no special limitation on the time of the reduced pressure distillation, as long as the solvent in the filtrate can be removed.

[0056] After obtaining the crude extract, the present invention preferably performs the first silica gel column chromatography on the crude extract; the first silica gel column chromatography preferably includes the following steps:

[0057] Dissolve the crude extract with a dichloromethane-methanol solution to obtain a crude extract solution;

[0058] Mix the crude extract solution with silica gel, remove the solvent from the obtained mixture, and pack the silica gel adsorbed with the crude extract into a column;

[0059] Perform gradient elution successively with a first chloroform-methanol system with a volume ratio of 100:0, 60:1, 30:1, 10:1 and 3:1, collect the fraction with a volume ratio of 60:1, and obtain the first silica gel column chromatography solution.

[0060] The silica gel column chromatography separation in the present invention is preferably normal-phase silica gel adsorption chromatography, and the diameter of the column used is preferably 1.7 cm.

[0061] The present invention preferably dissolves the crude extract with dichloromethane to obtain a crude extract solution.

[0062] After obtaining the crude extract solution, the present invention preferably mixes the crude extract solution with silica gel, removes the solvent from the obtained mixture, and packs the silica gel adsorbed with the crude extract into a column. The mass of the silica gel in the present invention is preferably 1.0 to 1.2 times the mass of the crude extract. The particle size of the silica gel in the present invention is preferably 100-200 mesh, 200-300 mesh or 300-400 mesh, more preferably 300-400 mesh.

[0063] After packing the sample into the column, the present invention preferably performs gradient elution with a first chloroform-methanol system having volume ratios of 100:0, 60:1, 30:1, 10:1 and 3:1 in sequence to obtain chloroform-methanol solution elution segments with volume ratios of 100:0, 60:1, 30:1, 10:1 and 3:1 respectively, namely corresponding to Fraction A fraction, Fraction B fraction, Fraction C fraction, Fraction D fraction and Fraction E fraction; the chloroform-methanol solution elution segment with a volume ratio of 60:1 (Fraction B fraction) is the first silica gel column chromatography solution. The flow rate of the first chloroform-methanol system in the present invention is preferably 2-5 mL / min, more preferably 3.5 mL / min.

[0064] After obtaining the first silica gel chromatography solution, the present invention performs second silica gel chromatography on the first silica gel chromatography solution to obtain a second silica gel chromatography solution. The eluent for the second silica gel chromatography in the present invention is a second chloroform-methanol system, and the volume ratio of chloroform to methanol in the second chloroform-methanol system is preferably 60:1.

[0065] After obtaining the second silica gel chromatography solution, the present invention performs gel column chromatography separation on the second silica gel chromatography solution to obtain the benzophenone compound 8'-hydroxy monomethylsulfoochratoxin. The eluent for the gel chromatography separation in the present invention is methanol; the flow rate is preferably 0.5-0.7 mL / min, more preferably 0.6 mL / min. The pre-packed column for the gel chromatography separation in the present invention is preferably an LH type alkylated dextran gel; the diameter of the pre-packed column for the gel column chromatography separation is preferably 2.8 cm, and the column length is preferably 1.8 m.

[0066] The benzophenone compound 8'-hydroxy monomethylsulfoochratoxin provided by the present invention is a new benzophenone compound, which enriches the diversity of benzophenone compounds; compared with conventional benzophenone compounds, it has stronger water solubility; at the same time, the benzophenone compound 8'-hydroxy monomethylsulfoochratoxin has strong immunomodulatory activity, has the effect of promoting the enhancement of cellular immunity, and can be used for preparing immunomodulatory drugs.

[0067] Based on the above technical advantages, the present invention also provides the use of the benzophenone compound 8'-hydroxy monomethylsulochrin described in the above technical solution or the benzophenone compound 8'-hydroxy monomethylsulochrin prepared by the described preparation method in the preparation of immunomodulatory drugs.

[0068] The present invention also provides an immunomodulatory drug, which is characterized in that the immunomodulatory drug includes excipients and the benzophenone compound 8'-hydroxy monomethylsulochrin described in the above technical solution or the benzophenone compound 8'-hydroxy monomethylsulochrin prepared by the described preparation method. The mass percentage content of the benzophenone compound 8'-hydroxy monomethylsulochrin in the immunomodulatory drug of the present invention is preferably 1% - 99%, more preferably 55% - 90%. The present invention has no special limitation on the excipients, which can be reasonably adjusted according to the type of drug. The present invention has no special limitation on the dosage form and preparation method of the drug, and it can be prepared conventionally according to the dosage form of the drug, such as tablets, granules or injections.

[0069] The present invention also provides an Aspergillus fumigatus Aspergillus sp. WJ-131, and the preservation number of the Aspergillus fumigatus Aspergillus sp. WJ-131 is CCTCC: M 2023225. The source of the Aspergillus fumigatus Aspergillus sp. WJ-131 of the present invention has been described and defined in the above technical solution, and will not be elaborated here.

[0070] In order to further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below in conjunction with the drawings and embodiments, but they cannot be understood as limiting the protection scope of the present invention.

[0071] Example 1

[0072] The preparation method of the benzophenone compound 8'-hydroxy monomethylsulochrin is as follows:

[0073] 1. Strain activation: Inoculate Aspergillus sp. WJ-131 on a PDA slant medium, and incubate it at a constant temperature of 28°C for 5 days to obtain the activated Aspergillus sp. WJ-131, and place it in an environment of 5°C for standby;

[0074] 2. Preparation of fermentation medium: Peel and wash 25.0 kg of potatoes, cut them into potato pieces with a volume of 1 cm 3 and divide them into 50 tissue culture flasks with a volume of 1000 mL (500 g / flask). Then cover the tissue culture flasks and sterilize them at 121°C for 30 min, and cool to obtain the fermentation medium;

[0075] 3. Inoculate the activated Aspergillus sp. WJ-131 into the fermentation medium prepared in step 2 at an inoculation amount of 0.5% of the mass of the fermentation medium, cover it, and culture it at room temperature for 35 days to obtain an Aspergillus fermentation product;

[0076] 4. Take 80 g of the Aspergillus fermentation product obtained in step 3 and mix it with 120 mL of methanol. After mixing, ultrasonicate it for 30 min under the condition of 40 kHz, filter it, and take the filtrate for reduced pressure distillation (vacuum degree: 12 kPa, 50 °C) until there is no alcohol smell to obtain 80.0 g of a crude extract;

[0077] 5. Dissolve 80.0 g of the crude extract prepared in step 4 in 100 mL of dichloromethane, then mix it with 80.0 g of silica gel (300 - 400 mesh), and remove the solvent by reduced pressure concentration (vacuum degree: 12 kPa, 50 °C) and load it onto a column; Use solutions with a volume ratio of chloroform to methanol of 100:0, 60:1, 30:1, 10:1, and 3:1 for gradient elution, with a flow rate of 3.5 mL / min, to obtain five fractions: Fraction A, Fraction B, Fraction C, Fraction D, and Fraction E; Perform silica gel column chromatography elution on the Fraction B fraction using chloroform-methanol with a volume ratio of 60:1 as the eluent to obtain an eluate; Purify the eluate through LH-type alkylated dextran gel using methanol as the solvent with a flow rate of 0.6 mL / min to obtain Compound 1.

[0078] Test Example 1

[0079] Identify the structure of Compound 1 prepared in Example 1, and the specific steps are as follows:

[0080] Detect Compound 1 prepared in Example 1 with a nuclear magnetic resonance spectrometer to obtain 1D / 2D NMR (one-dimensional nuclear magnetic resonance spectroscopy and two-dimensional nuclear magnetic resonance spectroscopy), HR-ESI-MS (high-resolution electrospray ionization mass spectrometry), and X-ray single crystal diffraction ( Figures 1 to 8 ) to identify the obtained compound 8'-hydroxy monomethylsulochrin and its structure.

[0081] From the HSQC spectrum combined with the carbon spectrum, the chemical shift assignments of the H of Compound 1 and the C connected to it are shown in Table 1:

[0082] Table 1 of Compound 1's 13 C and 1 H NMR data

[0083]

[0084] Note: Using CD 3OD measurement( 1 HNMR was 400 MHz, 13 CNMR was 100 MHz).

[0085] Compound 1 was a pale yellow oil. The high-resolution electrospray ionization mass spectrum (HR-ESI-MS, Figure 7 ) showed an m / z of 363.1071 [M+H] + ((calcd. for C 18 H 19 O 8 + , 363.1075), indicating a molecular formula of C 18 H 18 O 8 , with an unsaturation degree of 10. Comprehensive analysis of the 1 H( Figure 1 ), 13 C, DEPT( Figure 2 ) and HSQC( Figure 5 ) NMR spectra revealed that compound 1 showed 18 carbons, including three methyl groups [δ H 3.42 (H 3 -7’), 3.68 (H 3 -8), 3.70 (H 3 -9); δ C 56.3 (C-7’), 52.6 (C-8), 56.6 (C-9)], one methylene group [δ H 4.58 s (H 2 -8’); δ C 64.6 (C-8’)], four methine groups [δ H 6.71 (H-3), 6.99 (H-5), 6.41 (H-3’), 6.58 (H-5’); δ C 104.1 (C-3), 108.3 (C-5), 100.7 (C-3’), 108.7 (C-5’)], nine quaternary carbons [δ C 128.0 (C-1), 158.5 (C-2), 159.7 (C-4), 129.9 (C-6), 168.0 (C-7), 112.6 (C-1’), 162.8 (C-2’), 152.8 (C-4’), 165.3 (C-6’)], and one carbonyl group [δ C 201.8 (C-10)].

[0086] Combined with the analysis of the 1D and 2D NMR spectra of Compound 1, from the HMBC spectrum ( Figure 4 ), it can be observed that H-5 is correlated with C-1, C-3, C-4, C-6, and C-7. Combining their chemical shifts indicates that the methyl ester of Compound 1 is located at C 6 -C 7 via the C 6 bond; H-3 is respectively correlated with C-1, C-4, and C-10, and H-5’ is respectively correlated with C-1’, C-3’, C-6’, and C-8’. Combining their displacements indicates the presence of two benzene rings; the connection of the two benzene rings through the carbonyl group is proven by the long-range correlations of H-3 and H-3’ with C-10 respectively; the correlation of H-7’ with C-2’ and the correlation of H-9 with C-2, combined with their chemical shifts, indicate that the two methoxy groups are respectively located at C-2 and C-2’; the correlation of H-8’ with C-4’, combined with the chemical shift value of C-8’ (δ C 64.6), indicates that the hydroxyl group (-OH) is located at the C-8’ position. At the same time, the 1 H- 1 H COSY spectrum of Compound 1 is as shown in Figure 3 , and the NOESY spectrum is as shown in Figure 6 . The absolute configuration of Compound 1 was determined by single-crystal X-ray diffraction experiment [MoKα] ( Figure 8 ). Therefore, the structure of Compound 1 was fully confirmed and named 8'-hydroxysinglymethylsporodesmin.

[0087] In summary, it can be determined that the structural formula of the compound 8'-hydroxysinglymethylsporodesmin prepared in Example 1 is:

[0088]

[0089] Example 2

[0090] Screening for the immunomodulatory activity of the benzophenone compound 8'-hydroxysinglymethylsporodesmin is carried out as follows:

[0091] Preparation of mouse spleen lymphocyte suspension: ICR mice were sacrificed by cervical dislocation, soaked in 75% (v / v) alcohol for 5 min, and the spleens were aseptically isolated on a laminar flow bench, rinsed with PBS, and the connective tissue and fat components were removed. The spleen tissue was placed on a 200-mesh stainless steel sieve and ground with the core of a glass syringe. It was rinsed with 3 mL of PBS buffer, and the rinsing solution was collected and transferred to a centrifuge tube. Centrifugation was carried out at 4°C and 1000 rpm for 15 min, and the supernatant was discarded. 3 mL of erythrocyte lysate was added and left at room temperature for 2 min. 7 mL of PBS buffer was added to balance the osmotic pressure of the spleen cells. Centrifugation was carried out at 1000 rpm for 5 min, and the supernatant was discarded. PBS buffer was added again for centrifugation (1000 rpm, 5 min), and the supernatant was discarded to obtain a grayish-white spleen cell pellet. The cells were suspended in RPMI-1640 medium to prepare a single-cell suspension at a certain concentration. Trypan blue staining was used for counting, and the number of viable cells was greater than 95%. The cell concentration was adjusted to 1×10 5 cells / mL.

[0092] Detection of mouse spleen lymphocyte proliferation by MTS method: The mouse spleen lymphocyte suspension prepared by the above method was added to a 96-well cell culture plate, 180 μL per well. The experiment was divided into a cell blank control group (40 μL of RPMI-1640 was added to each well); an inducer LPS single stimulation group (10 μL of inducer LPS and 10 μL of RPMI-1640 were added to each well); a sample combined with LPS stimulation group. 10 μL of 8'-hydroxymethylthioochratoxin solution (the final concentration of 8'-hydroxymethylthioochratoxin was 20 μM) and 10 μL of inducer LPS (the final concentration was 10 μg / mL) were added to each well, with 3 replicates in each group. The cells were cultured in an incubator at 37°C and 5% CO 2 for 72 h. 20 μL of MTS was added and cultured for 3 h, shaken for 10 min, and the absorbance was measured at 490 nm. The results are shown in Table 2.

[0093] Table 2 Effect of 8'-hydroxymethylthioochratoxin on the cell proliferation rate induced by lipopolysaccharide (LPS)

[0094]

[0095] The experimental results showed that the benzophenone compound 8'-hydroxymethylthioochratoxin had a certain promoting effect on the proliferation of mouse spleen lymphocytes induced by lipopolysaccharide (LSP), showing an immunopotentiating effect. Therefore, 8'-hydroxymethylthioochratoxin has research value as a lead compound for the development of immunomodulatory drugs. The method of producing a large number of simple immunomodulatory compounds 8'-hydroxymethylthioochratoxin based on microbial fermentation can not only meet the requirements of environmental protection and low carbon, but also provide a new way for mass production, offering a new option for the development of immunomodulatory drugs.

[0096] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A benzophenone compound, 8'-hydroxy monomethylsulochrin, with a structural formula as shown in Formula I:

2. A preparation method of the benzophenone compound 8'-hydroxy monomethylsulochrin according to Claim 1, characterized in that it comprises the following steps: Subjecting the alcohol extract of the fermentation product of Aspergillus sp. WJ-131 to the first silica gel column chromatography, the second silica gel column chromatography and gel column chromatography separation in sequence to obtain the benzophenone compound 8'-hydroxy monomethylsulochrin; The eluent for the first silica gel column chromatography is a first chloroform-methanol system; the volume ratio of chloroform to methanol in the first chloroform-methanol system is 100:0 to 3:1; Collect the chloroform-methanol solution elution segment with a volume ratio of 60:1 for the second silica gel column chromatography; The eluent for the second silica gel column chromatography is a second chloroform-methanol system; the volume ratio of chloroform to methanol in the second chloroform-methanol system is 60:1; The eluent for the gel column chromatography separation is methanol; The preservation number of Aspergillus sp. WJ-131 is CCTCC: M 2023225.

3. According to the preparation method described in Claim 2, characterized in that the first silica gel column chromatography includes: Successively performing gradient elution with first chloroform-methanol systems with volume ratios of 100:0, 60:1, 30:1, 10:1 and 3:1, collecting the chloroform-methanol solution elution segment with a volume ratio of 60:1 to obtain the first silica gel column chromatography solution; The flow rate of the first chloroform-methanol system is 2-5 mL / min.

4. According to the preparation method described in Claim 2, characterized in that the gel column chromatography separation uses an LH-type alkylated dextran gel column, and the flow rate of the eluent for the gel column chromatography separation is 0.5-0.7 mL / min.

5. According to the preparation method described in Claim 2, characterized in that the preparation method of the alcohol extract includes the following steps: Inoculating the activated Aspergillus sp. WJ-131 into a fermentation medium for fermentation culture to obtain the fermentation product of Aspergillus sp. WJ-131; Mixing the fermentation product of Aspergillus sp. WJ-131 with absolute alcohol and then performing ultrasonic extraction to obtain the alcohol extract.

6. According to the preparation method described in Claim 5, characterized in that the mass ratio of the fermentation product of Aspergillus sp. WJ-131 to the volume of absolute alcohol is (50-80) g:(80-150) mL; the power of the ultrasonic extraction is 250-350 W and the time is 20-40 min.

7. According to the preparation method described in Claim 5 or 6, characterized in that the fermentation medium is sterilized potato; the temperature of the fermentation culture is 20-28 °C and the time is 30-35 d.

8. Use of the benzophenone compound 8'-hydroxy monomethylthiosterigmatocystin as claimed in claim 1 or the benzophenone compound 8'-hydroxy monomethylthiosterigmatocystin prepared by the preparation method as claimed in any one of claims 2 to 7 in the preparation of an immunomodulatory drug.

9. An immunomodulatory drug, characterized in that the immunomodulatory drug comprises excipients and the benzophenone compound 8'-hydroxy monomethylthiosterigmatocystin as claimed in claim 1 or the benzophenone compound 8'-hydroxy monomethylthiosterigmatocystin prepared by the preparation method as claimed in any one of claims 2 to 7.

10. An Aspergillus fumigatus Aspergillus sp. WJ-131, the preservation number of the Aspergillus fumigatus Aspergillus sp. WJ-131 is CCTCC: M 2023225.