Application of the rice OsRS29 gene in regulating rice grain shape, chalkiness formation, and heat tolerance

Abstract

This invention provides an application of the rice OsRS29 gene in regulating rice grain shape, chalkiness, and high-temperature tolerance. The OsRS29 gene participates in regulating rice grain shape and weight, and simultaneously affects chalkiness formation. It also stably participates in regulating rice grain shape, weight, and chalkiness under high temperatures. This invention found that loss of function of the OsRS29 gene leads to longer rice grains, increased grain weight, increased chalkiness, and greater sensitivity to high temperatures; while overexpression of the OsRS29 gene results in smaller rice grains, reduced grain weight, less chalkiness, and greater tolerance to high temperatures. This invention provides a new approach for improving rice seed appearance and enhancing its high-temperature tolerance.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological genetic engineering, and particularly relates to application of rice OsRS29 gene in regulating rice grain shape, chalkiness formation and high temperature tolerance. BACKGROUND

[0002] SR proteins, as splicing factors, are involved in the splicing of pre-mRNA and post-mRNA splicing activities. Studies have shown that SR proteins play an important role in various cellular processes such as plant hormone signal transduction, development and adaptation to abiotic stress. At present, there is still a lack of systematic and in-depth research on the function and mechanism of rice SR genes.

[0003] Grain weight is one of the main factors affecting rice yield, and rice grain shape and size are key factors determining the formation of rice yield. Therefore, it is of great significance to mine genes related to rice grain shape and analyze the regulatory network involved in revealing the molecular mechanism of high and stable yield of rice and promoting rice breeding for high yield.

[0004] Cultivating high-quality rice under the condition of ensuring yield is an important goal of rice breeding. With the improvement of people's living standards, the demand for high-quality rice is increasing. Rice quality includes appearance quality, cooking quality and taste quality, and consumers will first pay attention to the appearance quality of rice, such as whether there is chalkiness and the degree of chalkiness. The formation of rice quality traits such as chalkiness is complex, which is not only controlled by genetic factors, but also easily affected by environmental conditions, especially high temperature. The research and breeding application of genes related to rice quality are still relatively few.

[0005] High temperature during the grain filling stage is an important environmental factor affecting the normal development of rice grains. Previous research results have shown that environmental temperature higher than 26℃ is easy to cause the increase of rice chalkiness and the decrease of yield. With the continuous occurrence of global warming, the influence of high temperature stress on rice quality and yield is increasingly intensified. Mining genes related to rice heat tolerance and applying them in molecular breeding will help to cultivate heat-resistant rice varieties to better cope with global warming. SUMMARY

[0006] The present application provides application of rice OsRS29 gene in regulating rice grain shape, chalkiness formation and high temperature tolerance.

[0007] The specific technical solutions are as follows:

[0008] The present application provides, in a first aspect, application of OsRS29 gene as a target in screening products for regulating rice grain shape, rice yield, rice chalkiness formation or rice high temperature tolerance.

[0009] The second aspect of this invention provides the application of the OsRS29 gene in the preparation of products that regulate rice grain shape, rice yield, rice chalkiness formation, or rice heat tolerance.

[0010] Preferably, the nucleotide sequence of the OsRS29 gene includes the sequence shown in SEQ ID No. 1.

[0011] Preferably, the nucleotide sequence of the alternative splice of the OsRS29 gene includes the sequence shown in SEQ ID No. 2 or SEQ ID No. 3.

[0012] Preferably, the particle shape includes one or more of particle length, particle width, aspect ratio, and particle thickness.

[0013] Preferably, the yield includes one or both of the thousand-grain weight and the yield per plant.

[0014] A third aspect of the present invention provides the application of a recombinant expression vector in improving the high-temperature tolerance of rice, inhibiting the formation of chalkiness in rice, or cultivating high-temperature resistant rice. The recombinant expression vector includes an empty vector and an expression gene inserted into the empty vector. The nucleotide sequence of the expression gene is selected from one of the sequences shown in SEQ ID No. 2 or SEQ ID No. 3.

[0015] Preferably, the empty carrier is pUN1301.

[0016] The fourth aspect of this invention provides the application of a mutant material in improving rice grain shape, increasing rice yield, or cultivating high-yield rice, targeting the OsRS29 gene, wherein the mutant material can inhibit or block the expression and / or function of OsRS29.

[0017] Preferably, the mutant material includes a nuclease and a target sequence, wherein the target sequence includes the sequence shown in SEQ ID No. 4 or SEQ ID No. 5.

[0018] The fifth aspect of the present invention provides a method for improving rice grain shape, increasing rice yield, or cultivating high-yield rice, comprising the following steps: inhibiting or blocking the expression and / or function of OsRS29, thereby improving rice grain shape, increasing rice yield, or cultivating high-yield rice.

[0019] The sixth aspect of the present invention provides a method for improving the high-temperature tolerance of rice, cultivating high-temperature tolerant rice, or inhibiting the formation of chalky white in rice, comprising the following steps: increasing the expression level of the OsRS29 gene in rice, thereby improving the high-temperature tolerance of rice, obtaining high-temperature tolerant rice, or inhibiting the formation of chalky white in rice.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] This invention yields the OsRS29 gene, which regulates rice grain shape, grain weight, chalkiness, and heat tolerance. Overexpression of this gene results in smaller grains, reduced grain weight, less chalkiness, and greater heat tolerance in rice. Loss of function of the OsRS29 gene leads to longer grains, increased grain weight, increased chalkiness, and greater sensitivity to high temperatures. This invention provides applications for the genetic improvement of rice yield traits or heat tolerance, such as for breeding rice varieties with longer grains and higher yields, or rice germplasm materials with lower heat tolerance and chalkiness. This invention addresses the current problem of a limited number of genes related to rice grain shape and quality traits, providing a technical direction for the application of new grain shape and quality genes, and offering new resources for studying the molecular mechanisms regulating grain shape and quality. It will contribute to providing a theoretical basis for molecular design breeding to improve rice, and has significant application value for effectively regulating rice grain shape and quality through genetic breeding and genetic engineering methods. Attached Figure Description

[0022] Figure 1 This study presents the structural and tissue expression analysis of different splice variants of OsRS29, along with protein sequence alignment. In Figure A, a schematic diagram of the structures of different OsRS29 splice isoforms is shown, with arrows indicating primer positions for RT-PCR amplification and numbers in parentheses representing the corresponding amplification product sizes. Figure B shows the expression of OsRS29 splice isoforms in different tissues. Root: root; Stem: stem; Leaf: leaf; DBF: pre-flowering spikelet; DF: flowering spikelet; 3-30DAF: spikelets at 3, 5, 7, 11, 17, 21, 25, and 30 days after flowering.

[0023] Figure 2 This image shows the quantitative expression of OsRS29 and GUS staining results of transgenic plants with promoter 1. In the figures: A shows roots, stems, leaves, spikelets before flowering, spikelets at flowering, and pistils and stamens (from left to right); BC shows caryopsis (B) and spikelets (C) at 3, 5, 7, 11, 17, 21, 25, and 30 days after flowering (from left to right); D shows the expression analysis of OsRS29 in different tissues of Nipponbare rice, with sampling times including roots, stems, and leaves, as well as spikelets before flowering and at 3, 5, 7, 11, 17, 21, 25, and 30 days after flowering. OsActin is the internal reference gene. Data are presented as mean ± standard deviation, with three biological replicates per group. The scale bar in the figure is 1 mm.

[0024] Figure 3GUS staining results for transgenic plants with OsRS29 promoter 2. A shows the roots, stems, leaves, spikelets before flowering, spikelets, pistils, stamens, caryopsis on day 3 after flowering, and spikelets on day 3 after flowering (from left to right); BC shows the caryopsis (B) and spikelets (C) on days 5, 7, 11, 17, 21, 25, and 30 after flowering (from left to right). The scale bar in the figure is 1 mm.

[0025] Figure 4 Validation of the OsRS29 gene editing and overexpression lines. A shows the mutation site information for the OsRS29 gene editing lines GE#1 and GE#2. The numbers in parentheses indicate the base distance of the mutation site from the start codon ATG, followed by the base change: -AGG indicates a deletion of 3 AGG bases, TA indicates a substitution from T to A, CT indicates a substitution from C to T, and -GATA indicates a deletion of 4 GATA bases. B shows the OsRS29 gene expression in the OE1#1, OE1#2, OE2#1, and OE2#2 gene overexpression lines.

[0026] Figure 5 This study analyzed the agronomic traits of wild-type Nipponbare and OsRS29 gene-edited lines and gene-overexpression lines. In this study, A represents the grain phenotype of the wild-type, OsRS29 gene-edited, and gene-overexpression lines, with a scale bar of 1 cm. B and G are bar charts showing grain length (B), grain width (C), grain thickness (D), length-to-width ratio (E), thousand-grain weight (F), and yield per plant (G) for different lines, respectively. Data are expressed as mean ± standard deviation. Multiple comparisons of the same trait between different materials were performed using the LSD method. Significant differences were indicated by different letters, p < 0.05, n = 10.

[0027] Figure 6 This study observed the chalky phenotype of brown rice in the OsRS29 gene-edited line and the gene-overexpressing line. Specifically: A shows the appearance phenotype of brown rice grains in the OsRS29 gene-edited line (scale bar: 1 cm); B shows the chalky distribution in the cross-section of grains in the OsRS29 gene-edited line (scale bar: 1 mm); C shows the appearance phenotype of brown rice grains in the OsRS29.1 and OsRS29.2 gene-overexpressing lines (scale bar: 1 cm); D shows the chalky distribution in the cross-section of grains in the OsRS29.1 and OsRS29.2 gene-overexpressing lines (scale bar: 1 mm).

[0028] Figure 7Seed shape of OsRS29 gene-edited lines and gene-overexpression lines under different temperature treatments during the grain-filling stage. A represents seed shape of OsRS29 gene-edited lines and gene-overexpression lines treated at normal temperature during the grain-filling stage (Normal temperature, NT); B represents seed shape of OsRS29 gene-edited lines and gene-overexpression lines treated at high temperature during the grain-filling stage (High temperature, HT). Scale bars are 1 cm for all values. CH represents bar charts showing grain length (C), grain width (D), grain thickness (E), length-to-width ratio (F), thousand-grain weight (G), and yield per plant (H) for different lines under the two temperatures. Data are expressed as mean ± standard deviation. Data for the same trait were compared between different materials using the LSD method. Significant differences were indicated by different letters, p < 0.05, n = 10.

[0029] Figure 8 Observation of chalky phenotype in brown rice of OsRS29 gene-edited lines and gene-overexpression lines under different temperature treatments during the grain-filling stage. A: NT: Brown rice phenotype of different lines and chalky distribution in cross-section of corresponding grains under normal temperature (NT) treatment during the grain-filling stage; B: HT: Brown rice phenotype of different lines and chalky distribution in cross-section of corresponding grains under high temperature (HT) treatment during the grain-filling stage. Scale bar: 1.5 mm. Detailed Implementation

[0030] This invention reveals for the first time that the rice SR protein-encoding gene OsRS29 (LOC_Os04g02870) participates in regulating rice grain shape and weight, and also influences the formation of chalkiness in rice. Furthermore, high-temperature treatment during the grain-filling stage shows that OsRS29 can stably participate in regulating rice grain shape under high temperatures and positively regulate rice's tolerance to high temperatures during the grain-filling stage. This invention provides new applications for the OsRS29 gene in regulating rice grain shape and yield, as well as in regulating rice chalkiness formation and high-temperature tolerance. It also provides a basis for preparing heat-resistant rice germplasm resources with ideal grain shape.

[0031] The first aspect of this invention provides the application of the OsRS29 gene as a target in screening products that regulate rice grain shape, rice yield, rice chalkiness formation, or rice heat tolerance.

[0032] This application found that loss of function of the OsRS29 gene leads to longer rice grains and increased grain weight, thereby increasing rice yield. It also found that rice is more prone to chalkiness and is more sensitive to high temperatures. Overexpression of the OsRS29 gene leads to smaller rice grains and reduced grain weight, thereby reducing rice yield. At the same time, it is less prone to chalkiness and is more tolerant to high temperatures. Therefore, the OsRS29 gene can be used as a target for screening products that regulate rice grain shape, rice yield, rice grain chalkiness formation, or rice high-temperature tolerance.

[0033] The results of qRT-PCR experiments in this application showed that OsRS29 was expressed in all tissues, but the expression level was higher in spikelets during flowering and at different grain-filling stages. Staining results of OsRS29 promoter-fused GUS transgenic plants further confirmed these results. Due to the presence of alternative splicing, OsRS29 can produce two different CDS (Coding sequences): OsRS29.1 and OsRS29.2. RT-PCR results showed that OsRS29.1 was the predominant expression of OsRS29 in all tissues.

[0034] This application utilizes CRISPR / Cas9 technology to create OsRS29 gene-edited lines based on Nipponbare rice and constructs OsRS29 gene overexpression lines. The function of the OsRS29 gene was identified by observing the phenotypes of these rice materials at various developmental stages and in different tissues, particularly the grains. Results show that this gene participates in regulating rice grain shape and weight, and also affects the formation of chalkiness in rice. There is no functional differentiation between OsRS29.1 and OsRS29.2. Compared to the wild type, the OsRS29 gene-edited lines exhibit longer grains and increased thousand-grain weight; overexpression of both OsRS29.1 and OsRS29.2 leads to smaller grains and reduced grain weight. In terms of appearance quality, under conventional rice growing conditions, the OsRS29 gene-edited lines at grain filling and maturity exhibit a white-bellied phenotype, while the wild-type Nipponbare rice and the OsRS29.1 and OsRS29.2 gene overexpression lines harvested under the same conditions have transparent grains. High temperature is a significant environmental factor affecting chalkiness and yield in rice. High temperature treatment results showed that OsRS29 positively regulates rice's tolerance to high temperatures during the grain-filling stage. Compared to normal growing conditions, high temperature treatment during the grain-filling stage led to a decrease in rice grain weight, but the reduction was greater in the OsRS29 gene-edited lines than in the wild type, while the reduction was much smaller in the OsRS29.1 and OsRS29.2 gene overexpression lines. Regarding appearance quality, grains from the OsRS29 gene-edited lines harvested under high temperatures during the grain-filling stage were more prone to chalkiness, and the degree of chalkiness was significantly greater than that of wild-type grains under the same conditions. Conversely, the degree of chalkiness in the OsRS29.1 and OsRS29.2 gene overexpression lines was less than that in the wild type.

[0035] The second aspect of this invention provides the application of the OsRS29 gene in the preparation of products that regulate rice grain shape, rice yield, chalky formation of rice grains, or rice heat tolerance.

[0036] Preferably, the nucleotide sequence of the OsRS29 gene includes the sequence shown in SEQ ID No. 1.

[0037] SEQ ID No. 1 OsRS29 (LOC_Os04g02870) promoter and genome sequence (5'→3')

[0038] AACTTCTTCTTTCCTTGAGTAGCTAAAAAAATTCTACATATAAAAACAATATCTTCATACAAGATGAAATTTTGAGCTCATAATATAGTATGGCGCCCCTACAACATGAAAAAACCACCCCTCGATCTTATCATCTTAACCTCTTAAACCAATGTTTATAATTCAATGCTTTTGTTAT GATTATAGTTGTAGCACTGCACATAGCACCAATCAACTGTTTTCTTGGAAAAATCACCTTCTGTCCTTGAATAGCTAAAATAGTTTTATTTTAAGATATAAGAAGAATTCTACTAAAACATAAAATTTAAAGCTCATGATATAGTACGAAGGTACAACATAGAAAAATCGTTTCCCAAC CTTATTATAACCTCTGAGATATCAATAGCACGTATATCTTTATATAACAAATAATACTTCACAGTCGGAATCACTCGTAAGAGCAAATTACACATATCACTTCAAAGAAAGAAAATACATAATCGCGCGTGCGAAAGGATCCAACTCATAGAAAATTTGAACAAATATAATATAACCCC GCAAAAATAATGACCAGAAAATCAACAAATCAGATGGAACACAGCTAGCAGCTCGTGTGTGCGCTTCATGATATCATCAGCGAGGGACAAGTGTCTCGAAGCAGTTGAGCCCATCCAGCTCCACGGCAAACCGTGGCTTCATCACTTGCTTGCTCACAACCACCCTGACGGCAGCGGCA

[0039] GCTACAGGTGCACCGCTGATGTTCTTCGTCTCTTTGCTCGGCTTCTGCACCTGCACTACT

[0040] TTCACTGGGCTTGCTGCTGCCAGCTGCAAATCACAAGAAATCAACAGATGTAAAATG

[0041] GTCCTAATCGAGCAAGAACAGCAACAGCAGCAGCAGCATGTGCAAGATCAAATATATGTA

[0042] TATATATTCGTGAAGAATCTTTGTTGATTTGAGTGAGAAAGTGACTGACTGACCTTGT

[0043] TGATCTTCAGGCATTCACCGGCCACCTGCGAAGACAGGATAGCATCTGCAGAAGCCAT

[0044] GGTTTTGTGACTTTGTCTCGCTGATTGTCTAGCTATTGCTGCAAAATTGATGATTGATTC

[0045] AATGGTACAACAAAGCTAGCTGTGTCTATTATATATGCAATGGAGAAGGTAAGAAGGT

[0046] AAATATGTTGGGATTGAGCTGCTGTTGTTTCAATGGCTTAAGATGCAAGAGGATAGGAG

[0047] GCTTTGTTGGATGTCTTTGAATCCACGTTGCTCGACATAGTGTTCTTTTGTAGTTTTGCT

[0048] GAAGAAGCTCGATTGCTAGATGGATAGCACCCTAGCTTCAGAATCCTTATCCACAAGA

[0049] TCGATGGCTCAGCAATATCCAATGCTCCAAGCCTTCAAGGGTTGTGCACTTTTTCCTTCT

[0050] CTCATGGATAATGATATGTAGATGGTGACTACAAGATTCTTTTCTTCTTTTGGTTGAGCA

[0051] AATGAGAATTATCATTACATAATTCAAGGTGTAAGAAAGGCGCCATTAGACAACCATAAT

[0052] GTTTGTGACACATTAAGGGCCTGTTCACTTTGATGCCATTTTCAACCATACCATTTTTTG

[0053] GTAAAGTTGACAAAAAAATGTCTACGTTTAGTTTGTTGCCAAATTTAGTAAATACATAA

[0054] GAAATCCTGCTAAAATTTTAGCAATATTGCCATCTTACCAAAATTTTGGAATTGCCAAAA

[0055] TTTCGTAAGGTTTATTTTGGCTACAATCTGAACAGGCCCTAAAATAACAAACACCAAGA

[0056] AAAAAAAGATATTATTCTCCTACTTATTTCCATCTTTTTCAAGCCATGGTTTGTCTTGGAG

[0057] CTTTATATATTACTGTTTAATATCACTTGTGGATTTTATAATTTGTAAGGAGACTGTGGTTT

[0058] CTAGTGGGTTTTATTATTTTATAATTTGTAAGGAGACTGTCTAACATCTTCTCATAATCTTA

[0059] ACAAAAAGAAGCTAGACTGTGTCGGGAAGGTTGGGACTCCCCAAACAGTCCATGATTG

[0060] CATGGGCCTACCAGCCCATGTCGAGTATGGCCCAGCCCAACGAACCCAAACAGAAACC

[0061] AACCAACACAAGACACCGACCGACGCCGACCAAGAAGCCCTCCTCCTCCAAAAGCCC

[0062] CAAAAGCCCTAGCCGCCTCCCCCTTCGTCCTCCGCTCCACGAGACCACGACGCAGGTG

[0063] ACCCTCCTCCTCCTCCTCGGTGCTAGGCTCTAGGCGCTAGGGTTTCTCGAGCTAGAACC

[0064] CCTCGACCTGGAGAGAGTCCTCGGGCTGATCCGGTTGCGCTGTCTGCTGCTTTCCTTGC

[0065] TAGGGTTTTCTGGTTCTTGCTGTCTTGGGATCTTTGATTTGCTGCGAAGGCGAAGGCGA

[0066] AGATGAGGCCCGTGTTCGTGGGGAACCTCGACTACGACACCCGCCACTCCGAGCTCGA

[0067] CCGCCTCTTCTACCGCTACGGCAGGATCGACCGCATCGACATGAAGTCAGGTCTGCCTT

[0068] TGCCCTCCTCTCCACCTGTCTTCTTTTTTTTTCCCCCGTGAATTATTAGATCCGGTTTGGT

[0069] GCTCATATACGGCACCGATTTGTTAATCTCCTGCGAGATTGCGAGTCCATGGTGTCTAAT

[0070] AAATTTTCTTTTCTTTTCACCCTAGAGAAAACAAGAGGTTCTTTTCCAACTTTGAACTG

[0071] TTCTTGGTTACCACTCTCATGTTTATGATATGTTTTCACAATAATAATCTTTAGTAATTTAC

[0072] CAAGAATAACCACCCAAGCATGTCGATGTGCTTTATGTTAAATATGTTTTGTGGAAGCAA

[0073] TTAGGATGTTTAAGATTAGCTTGTCGTCGTTACATCTGTAACATCCAACGGCGTGGAAC

[0074] ACATAAATTGTGCATATGTATGATGGTCCATGCCCATGTAGCCGCAGTTGCAATATATGTA

[0075] CAGCAGGAAGCAAGATGTTTTAAATGTTTACTCTGGCGCAGGAACTACAGAGGCAAAA

[0076] CTCAACTCCTGAAACACCCTCCATGCACTCATCCGGCCATCCCCTTCACTTGACCATCC

[0077] ATTACATGACGCGCGCTGTTTACTGTTGTTACCACTGCCCGAGCATGTTTAGCGGGGAC

[0078] TGGCACCATCATGTGATCCATGCCGTGCCGTCAGTTCCATCATTCCATACCATGCCATGA

[0079] CTAGCAGTATCACCATGCCATCCTCCCGGCATCAACATCACAATGTTCTGTGCGTGCTGT

[0080] CTCAATAAGCAATGCCTGTGAGATTGTTCTGTTATTGGTGAAGCACTCTCAGTATCTCCT

[0081] GAGTCGTATCGTCTTACTTTGGATATAAGTTATTACAACATCATGCTTAGCTCTGATCCAT

[0082] CAATGGAATCTACCAATAACCACACTAGTGCTCTTCATACCATCAGATATTTTGCAGGTG

[0083] CAGTACTCTTCTGTTCTTATTAGGTCTGATTGAACGGGGATTGTGTGTTGAGTTGTTTAT

[0084] CATAAAGGAAAACTGGAAATGCTTGCACCTATTGGCGCAAAGACATTATTTATTTTTTCT

[0085] CTGTTCTTAATTGTGTTTACCTTTTCTTTAGGATTTGCTTTTGTCTACTTTGAGGATGAGC

[0086] GTGATGGTGATGAGGCCATACGAGCCCTTGATGGCTATCCTTTTGGCCCTGGGAGGCGC

[0087] AGGCTTTCGGTGGAGTGGTCACGGGTAATTTCTCTTGCTGTTCTTGTCACCACCTATAAC

[0088] CCTGAAAAAATTGAAACATGTTTTACTTACATGTTGAGAGTTTTGTTGTTTAATTTAGTC

[0089] GGTCTTTAATGTCAAAGTATTGCATTCGTTATTATGGCCTTTATTACAGGGTGATCGTGGT

[0090] TCCAGGCGTGATGGCTATAGCAAACCACCTGTGAATACTAAACCCACGAAGACACTATT

[0091] TGTCATTAACTTTGACCCCATCAACACCAGAGTCACTGATATCGAAAGGCATTTCGAAC

[0092] CATTTGGAAAGCTTTCGAATGTTCGGATCAGGAGGAACTTTGCTTTTGTGCAGTTTGAA

[0093] ACACAGGAAGAGGCCACAAAAGCACTTGAAGCTACTCATTCTACGTATGAATCTGATTC

[0094] ACCTCTTCTTAACCTTGTTGAGATTCCTTATGCGAAGTTACCAGATTTCCTTATTTGCCAT

[0095] GTAAAGTTACGTGAATTTTTTGTTTGCCACTGAGAGTTGTCTCTTCCTTTATTTGCTACC

[0096] TTTTCTCAATTGCTCCCTTATTTGCCACTCATGGTAATTTTCTGTTAGAGGGTTGTTAATG

[0097] GGTGCATATGCAAAGTCTACCTTTCTTCGCAACCCGTTCAGAATTTGGATATAACAAAA

[0098] AAAAACATGGCATGTGGATCCCACTGCTTATAGAAAAATGAATGAGCCAAATCTGTTGC

[0099] ACGTGGATCTTCCTAGAGTTTCCCTCAACTGCAACCATGCCGCTGTTGCCAAATCTGTC

[0100] TGGTGGTCCGGCCAACAAAACATGAACCCTTGAACCATAGTGGTGCTATATATCTAGTT

[0101] CCTCTTCGAAATACCATATGTGGTAGATCGGTGGCCCAACATGTACTGCTGTTTGCAGTT

[0102] TGTTGGTACAGATTACAACTTGCAGTAGTAGAAACGTTCCATGGTGGGGGCTGCTCGGT

[0103] GGTTGCCATGGACATGGTGATGGTGCTTGCCCTCAAATTCCATGCAGCCATGGGGATCC

[0104] TGAGTAGCAGCTTTTATATTTGGGAGGTAGTGCTGCCGGACTCATGCTATGGTTGCTCAT

[0105] AGTGCCGGGGAGGATTCTGGGCGAAGACCGCCGTGGAGGGTGGGGAGGAAGGTTTCT

[0106] GCTTGAGCTGATGGGAGGGAATGAGGAAATAGCATAGGAGCAGCTACTGGCTTGGATG

[0107] TAGATTGGGTAATACGGGAGATAGTTGGATGTAGATTGGGTAATACGGGAGATAGTGAA

[0108] GTTAATTAAAGGACTCCTGTTTGCGAATATTCGTCAGTTTTGACTTTTATGAATATGATTT

[0109] TGACCATTAATTTTTTAATTAGGTATACAAAAGTGAATAGCTCTAAATGTACAATATTAG

[0110] TAAAGTACTTCTGATCACAAATCTAACAACACCAATTTGATACAATAGTTATATAATTTGA

[0111] AAGGTATAACTATAGAAAGCATGATTAGTCAAAGTCAAAACTGACAAGTATTTGTGAAC

[0112] GGAAGGAGTATCTTTTGGTAATTCCTAGGATATGCCAAAACAGAGAAACGTTAATGGT

[0113] ATTGAAGGCATGTAAGGGTCACAATTTCATATGGTTGTCGCAAGGGGACAATCAATTGT

[0114] CGCTGACAAATAAGGAAATTGGATAACTTTGCATGGCAAATAAGGAACTTTCTCAAGCT

[0115] TATATAGGATAAATGAAATTTCCACATAGGCGCTTCATTGATTTTGTTTCTGACGTGC

[0116] ATGGAAAATTAGCAGATATTGCTTTAATTGTTCGATTCAGTTAGGAATGTTACTATTCAAT

[0117] CATTCTTCTAGTCTTGCTTAAAACACACAGTAGAGGCACACAGCTACCCAGTTATGCT

[0118] GCTTCTGAAATCTATGCAATTCTGTACACACTAATGATTTTGATATTTTTGAAATTATTGT

[0119] AGCATGTAACCAATATGCCTTCTGTATTTTTCCTTCTGTCTGCAGCAAGTTGTTGGACAG

[0120] GGTGATTTCTGTTGAGTATGCCTTCAGGGATGATACAGAACGAGGTGACAGGTATGATG

[0121] GTGCAAGAGGTGGCTATGGTAGGCGAGATGATAGTCCATATCGTCGATCAGTTAGTCCA

[0122] GTGTACAGGTCACGCCCAAGTCCTGACTACGGTCGTCAAAGGAGTCCTGTGTACGGTT

[0123] CGTATGACAGGAGTCCTGTTAATGATCGCTATCGAAGGTATGTCCTTCATACATTCATTTA

[0124] AGTAGTTCCTTGGATTGCACTATTTATGCTTGGGGATGTTATGTTATGCTAGGAGCAGCA

[0125] GTTCTCTAAGCAAATATTTTCTTGAGGACACCAGAACATTTATGTTACCTAAGCTAGTCA

[0126] GATTAACCACCCCACTTCACATTTTATGTTATAGACATGGACTGCACCTTGTTATTATGAA

[0127] TTAAGTCCTGAAATTACTAGTATTTTTTAATCACACAATCACATTTGGGTGCTCTTGGAG

[0128] CACACTTTGGCCTGGGCCCTGGCACTATTTACAATAAATATCGATCAATTATAACTACAA

[0129] CTGCAAAATATTAATTCTTCGTTTGTTTTGTATTATTTGTCTATAATTGCAGCCGATCTCCT

[0130] GTCCGGCGATCAAGATCCCCACTTGCCAACAGAAGAGCTTATGATTGACAGAGTTTTCT

[0131] CAAGGGTGGTTGGCTGGTTGCTGAAGGGTTTGCATCTGCCTCTCTAGATCTTTAGCAGT

[0132] GATAGCAAGAACTTGTCTTCTCCGTACTATATATATAATTTAGATATGGGTACTCATGGGT

[0133] GGTTCGTAGTCGAACTGAAAATCTTTTACCTTTTGTTGACCTGGAACTCCGTACTAGTAT

[0134] AATTTAGATATGATGTGTTGTGCATCAAGGCAAAACTCTGTGCGATGTACCTGTGCCAC

[0135] AACGTTTCTATGACTACCGCACTTTATATTTCTAGCCT

[0136] Preferably, the nucleotide sequence of the alternative splice of the OsRS29 gene includes the sequence shown in SEQ ID No. 2 or SEQ ID No. 3.

[0137] SEQ ID No. 2OsRS29.1 CDS sequence (5'→3')

[0138] ATGAGGCCCGTGTTCGTGGGGAACCTCGACTACGACACCCGCCACTCCGAGCTCGACCGCCTCTTCTACCGCTACGGCAGGATCGACCGCATCGACATGAAGTCAGGATTTGCT TTTGTCTACTTTGAGGATGAGCGTGATGGTGATGAGGCCATACGAGCCCTTGATGGCTATCCTTTTGGCCCTGGGAGGCGCAGGCTTTCGGTGGAGTGGTCACGGGGTGATCGTGGTTCCAGGCGTGATGGCTATAGCAAACCACCTGTGAATACTAAACCCACGAAGACACTATTTGTCATTAACTTTGACCCCATCAACACCAGAGTCACTGATATCGAAAGGCATTTCGAACCATTTGGAAAGCTTTCGAATGTTCGGATCAGGAGGAACTTTGCTTTTGTGCAGTTTGAAACACAGGAAGAGGCCACAAAAGCACTTGAAGCTACTCATTCTACCAAGTTGTTGGACAGGGTGATTTCTGTTGAGTATGCCTTCAGGGATGATACAGAACGAGGTGACAGGTATGATGGTGCAAGAGGTGGCTATGGTAGGCGAGATGATAGTCCATATCGTCGATCAGTTAGTCCAGTGTACAGGTCACGCCCAAGTCCTGACTACGGTCGTCAAAGGAGTCCTGTGTACGGTTCGTATGACAGGAGTCCTGTTAATGATCGCTATCGAAGCCGATCTCCTGTCCGGCGATCAAGATCCCCACTTGCCAACAGAAGAGCTTATGATTGA

[0139] SEQ ID No.3 OsRS29.2 CDS sequence (5'→3')

[0140] ATGCTTAGCTCTGATCCATCAATGGAATCTACCAATAACCACACTAGTGCTCTTCATACCATCAGATATTTTGCAGGATTTGCTTTTGTCTACTTTGAGGATGAGCGTGATGGTGATGAGGCCATACGAGCCCTTGATGGCTATCCTTTTTGGCCCTGGGAGGCGCAGGCTTTCGGTG GAGTGGTCACGGGGTGATCGTGGTTCCAGGCGTGATGGCTATAGCAAACCACCTGTGAATACTAAACCCACGAAGACACTATTTGTCATTAACTTTGACCCCATCAACACCAGAGTCACTGATATCGAAAGGCATTTCGAACCATTTGGAAAGCTTTCGAATGTTCGGATCAGGAGG AACTTTGCTTTTGTGCAGTTTGAAACACAGGAAGAGGCCACAAAAGCACTTGAAGCTACTCATTCTACCAAGTTGTTGGACAGGGTGATTTCTGTTGAGTATGCCTTCAGGGATGATACAGAACGAGGTGACAGGTATGATGGTGCAAGAGGTGGCTATGGTAGGCGAGATGATAGT CCATATCGTCGATCAGTTAGTCCAGTGTACAGGTCACGCCCAAGTCCTGACTACGGTCGTCAAAGGAGTCCTGTGTACGGTTCGTATGACAGGAGTCCTGTTAATGATCGCTATCGAAGCCGATCTCCTGTCCGGCGATCAAGATCCCCACTTGCCAACAGAAGAGCTTATGATTGA

[0141] Preferably, the grain shape includes one or more of grain length, grain width, length-to-width ratio, and grain thickness. Rice yield is mainly determined by three factors: the number of effective panicles, the number of filled grains per panicle, and grain weight. Rice grain shape indicators include grain length, grain width, grain thickness, and length-to-width ratio. The first three are closely related to grain weight and also affect the appearance quality and commercial value of rice. Grain shape has become an important indicator for breeders to select high-quality rice varieties. Research on rice grain shape traits has significant practical and theoretical value for improving rice yield. Rice grain shape is also one of the important indicators for measuring the appearance quality of rice, and it also affects the commercial quality and processing quality of rice (brown rice rate, milled rice rate, head rice rate, etc.).

[0142] Preferably, the yield includes one or both of the thousand-grain weight and the yield per plant.

[0143] A third aspect of the present invention provides the application of a recombinant expression vector in improving the high-temperature tolerance of rice, inhibiting the formation of chalkiness in rice, or cultivating high-temperature resistant rice. The recombinant expression vector includes an empty vector and an expression gene inserted into the empty vector. The nucleotide sequence of the expression gene is selected from one of the sequences shown in SEQ ID No. 2 or SEQ ID No. 3.

[0144] Preferably, the empty carrier is pUN1301.

[0145] The fourth aspect of this invention provides the application of a mutant material in improving rice grain shape, increasing rice yield, or cultivating high-yield rice, targeting the OsRS29 gene. The mutant material can inhibit or block the expression and / or function of OsRS29. In this application, the mutant material can partially inhibit the expression and / or function of OsRS29, i.e., reduce the expression and / or function of OsRS29, or it can completely block it, i.e., substantially completely eliminate the expression and / or function of OsRS29.

[0146] Preferably, the mutant material comprises a nuclease and a target sequence, wherein the target sequence comprises the sequence shown in SEQ ID No. 4 or SEQ ID No. 5. The nuclease is a Cas9 nuclease, and the Cas9 nuclease is selected from one or more of SpCas9, SaCas9, ScCas9, and XCas9.

[0147] SEQ ID No.4(5'-3'):

[0148] GGGAGGCGCAGGCTTTCGGT

[0149] SEQ ID No.5(5'-3')

[0150] GAGTCACTGATATCGAAAGG

[0151] The fifth aspect of this invention provides a method for improving rice grain shape, increasing rice yield, or cultivating high-yield rice, comprising the following steps: inhibiting or blocking the expression and / or function of OsRS29, thereby improving rice grain shape, increasing rice yield, or cultivating high-yield rice. This application found that after inhibiting or blocking the expression and / or function of OsRS29, the grain length of rice significantly increased, and the length-to-width ratio significantly increased, with the grain length increasing by more than 4.53% and the length-to-width ratio increasing by more than 4.44% compared to the wild type; simultaneously, the thousand-grain weight and yield per plant also significantly increased, with the yield per plant increasing by more than 14.83% and the thousand-grain weight increasing by more than 5.40% compared to the wild type.

[0152] The sixth aspect of this invention provides a method for improving the high-temperature tolerance of rice, cultivating high-temperature tolerant rice, or inhibiting the formation of chalkiness in rice, comprising the following steps: increasing the expression level of the OsRS29 gene in rice, thereby improving the high-temperature tolerance of rice, obtaining high-temperature tolerant rice, or reducing the formation of chalkiness in rice. This application found that after overexpression of OsRS29, under normal conditions, the grains of the overexpressing lines all exhibited the same transparent phenotype as the wild type, and no chalkiness was observed in the cross-section of the grains, indicating that increasing the expression level of the OsRS29 gene in rice can inhibit the formation of chalkiness in rice grains; after treatment at 36℃ for 14 hours and 28℃ for 10 hours during the grain-filling stage, the reduction in grain weight caused by overexpression of OsRS29 was less than that of the wild type, and the chalkiness was much lower than that of the wild type, indicating that increasing the expression of the OsRS29 gene in rice can improve the high-temperature tolerance of rice, thereby cultivating high-temperature tolerant rice.

[0153] The present invention will be further described below with reference to specific embodiments. The following are only specific embodiments of the present invention, but the scope of protection of the present invention is not limited thereto.

[0154] Example 1: OsRS29 gene expression analysis

[0155] The protein encoded by the SR gene is a component of the splicing complex and participates in the alternative splicing of other genes. Studies have shown that the SR gene itself also undergoes alternative splicing events.

[0156] The RAP-DB database (https: / / rapdb.dna.affrc.go.jp / ) shows that the OsRS29 gene has four splice isoforms. Figure 1 In section A), the nucleotide sequences of the four splicing isomers differ in the 5' and 3' untranslated regions. These four isomers produce two different coding sequences (CDS): isomer 1 and isomer 2 have the same CDS sequence, named OsRS29.1; isomer 3 and isomer 4 have the same CDS sequence, named OsRS29.2.

[0157] The nucleotide sequence of the OsRS29 gene is shown in SEQ ID NO.1.

[0158] In OsRS29.1, the CDS sequences of isomer 1 and isomer 2 are shown in SEQ ID NO.2; in OsRS29.2, the CDS sequences of isomer 3 and isomer 4 are shown in SEQ ID NO.3.

[0159] The first exon of OsRS29.1 and OsRS29.2 are different, but the remaining nucleotide sequences are completely identical.

[0160] 1.1 OsRS29 gene splicing status

[0161] like Figure 1 As shown in Figure A, specific primers (Primer F (5'-3'): TCGACTACGACACCCGCCAC (SEQ ID No. 6), Primer R (5'-3'): AGCCATCAAGGGCTCGTATG (SEQ ID No. 7)) capable of simultaneously amplifying OsRS29.1 and OsRS29.2 fragments were designed. RT-PCR combined with sequencing was used to analyze the tissue-specific expression of different OsRS29 transcripts in the roots, stems, leaves, and spikelets of Nipponbare plants before flowering, during flowering, and on days 3, 5, 7, 11, 17, 21, 25, and 30 after flowering. The results are shown in Figure A. Figure 1 B.

[0162] from Figure 1 As shown in Figure B, the 147bp amplified product corresponding to OsRS29.1 was detected in all tested tissues, but the 571bp amplified fragment of OsRS29.2 was only detected in stems, leaves, and spikelets 11 days after flowering. This indicates that OsRS29 expression and subsequent function of the OsRS29 protein in rice plants are mainly mediated by OsRS29.1.

[0163] The relative expression levels of OsRS29 in different tissues at different developmental stages of rice were detected using qRT-PCR. The results are shown in the figure. Figure 2 D.

[0164] from Figure 2 As shown in the data, OsRS29 is expressed in various tissues, with relatively low expression levels in roots, stems, and leaves. Higher expression levels are observed in spikelets at different developmental stages, particularly at flowering and on the 7th and 25th days after flowering. This suggests that OsRS29 may play a major role in spikelets during rice development.

[0165] 1.2 Spatiotemporal Representation Pattern Analysis of OsRS29

[0166] To further understand the spatiotemporal expression pattern of OsRS29, expression vectors fused with GUS were constructed based on the CDS positions of OsRS29.1 and OsRS29.2 promoter sequences (promoter 1 and promoter 2), respectively. These vectors were then transformed into Nipponbare rice for subsequent staining analysis. The staining results are shown below. Figure 2 and Figure 3 .

[0167] The GUS staining method is as follows:

[0168] The GUS staining buffer used in the experiment was prepared fresh each time. The GUS staining steps for various rice tissues are as follows:

[0169] (1) Take fresh rice tissue to be stained, soak it in the prepared GUS staining buffer, wrap it with aluminum foil, and place it at 37°C in the dark for 12-16 hours.

[0170] (2) After staining, discard the GUS staining solution, treat the tissue with anhydrous ethanol, and place it at 37°C for decolorization to remove chlorophyll from the tissue.

[0171] (3) Use an inverted microscope to observe and photograph the GUS staining of each tissue after decolorization.

[0172] from Figure 2 The staining results of various tissues of the GUS transgenic plant fused with promoter 1 (OsRS29.1 CDS upstream sequence) showed that no GUS signal was detected in the roots, while a weak GUS signal was present in the stem nodes and leaves. A strong GUS signal was detected in the stamens during flowering; GUS signal was also detected in the caryopsis at different developmental stages, with particularly strong GUS signals in the caryopsis approximately 7 and 20 days after flowering, indicating high expression levels of OsRS29 in these tissues.

[0173] from Figure 3 It was found that for transgenic plants fused with GUS in promoter 2 (upstream sequence of OsRS29.2 CDS), a very weak GUS signal was observed only in the stamens before and during flowering, and in the glumes of spikelets 5 days after flowering. No obvious GUS signal was observed in the roots, stems, leaves, or spikelets at other developmental stages. This indicates that for OsRS29, the promoter function, which is recognized by RNA polymerase and initiates transcription to generate precursor mRNA, is mainly performed by the promoter 1 sequence based on the OsRS29.1 CDS region.

[0174] It is worth noting that for caryopsis within the first 10 days of development, the GUS signal is mainly concentrated at the apex and base of the caryopsis. For spikelet glumes ( Figure 2 C) Except for weak GUS signals detected on the upper part of the spikelet glumes before flowering, 7 days after flowering, and 30 days after flowering, no obvious GUS signals were observed on the glumes at other stages before flowering and during grain filling. These results are consistent with the results of qRT-PCR tissue expression analysis of the OsRS29 gene. Figure 2 In the middle D), OsRS29 was highly expressed in caryopsis at all developmental stages, especially at the apex and base of the caryopsis.

[0175] Example 2: Screening of OsRS29 gene-edited homozygous lines and OsRS29 gene overexpression lines

[0176] To understand the biological functions of OsRS29 in rice growth and development, this study created gene-edited and gene-overexpressing lines of OsRS29.

[0177] 2.1 Homozygous OsRS29 gene-edited lines

[0178] Using CRISPR / Cas9 technology, two different target sites were designed. These two target sites are located on the second exon (target site 1 sequence (5'-3'): GGGAGGCGCAGGCTTTCGGT (SEQ ID No. 4) and the third exon (target site 2 sequence (5'-3'): GAGTCACTGATATCGAAAGG (SEQ ID No. 5)) of two different CDS of the OsRS29 gene, respectively. Gene editing vectors were constructed and transformed with Agrobacterium tumefaciens to obtain OsRS29 edited lines based on Nipponbare rice.

[0179] After obtaining the transgenic lines, two different homozygous OsRS29 gene-editing lines, GE#1 and GE#2, were confirmed and screened by target sequencing analysis.

[0180] from Figure 4 As shown in Figure A, the homozygous OsRS29 gene-edited line GE#1 has a 3-base deletion of AGG at the 190th base of the OsRS29.1 ATG initiation (160th base of the OsRS29.2 ATG initiation).

[0181] from Figure 4 As shown in Figure A, the homozygous OsRS29 gene-editing line GE#2 has a 3-base deletion of AGG at the 190th base of the OsRS29.1 ATG start (160 bases of the OsRS29.2 ATG start), a single-base substitution from T to A at the 323rd base (293 bases of the OsRS29.2 ATG start), a single-base substitution from C to T at the 326th base (296 bases of the OsRS29.2 ATG start), and a 4-base deletion of GATA at the 328th base (298 bases of the OsRS29.2 ATG start). These insertions, substitutions, or deletions alter the open reading frame, preventing translation into a normal protein sequence, thus hindering the normal functioning of the OsRS29 gene.

[0182] 2.2 OsRS29 gene overexpression lines

[0183] Since OsRS29 can generate two different CDS through alternative splicing, in order to investigate whether there is functional differentiation between OsRS29.1 and OsRS29.2, OsRS29.1 gene overexpression vector and OsRS29.2 gene overexpression vector were constructed respectively.

[0184] Using Nipponbare rice cDNA as a template, full-length CDS fragments of OsRS29.1 and OsRS29.2 were amplified. The corresponding primer sequences (5'-3') are as follows:

[0185] OsRS29.1-CDS-F:

[0186] CGACTCTAGAGGATCCCCGGGATGAGGCCCGTGTTCGTGG(SEQ ID No.8)

[0187] OsRS29.2-CDS-F:

[0188] CGACTCTAGAGGATCCCCGGGATGCTTAGCTCTGATCCATCAATGG(SEQ ID No.9)

[0189] OsRS29.1 / 2-CDS-R:

[0190] AATTCGAGCTCGGTACCCGGGTCACTTGTCATCGTCATCCTTGTAGTCGATGTCATG ATCTTTATAATCACCGTCATGGTCTTTGTAGTCATCATAAGCTCTTCTGTTGGCAAG (SEQ ID No. 10)

[0191] Simultaneously, the vector plasmid was linearized by restriction endonuclease SmaⅠ. Then, homologous recombinase was used to recombine the amplified, correctly sequenced complete CDS fragments of OsRS29.1 and OsRS29.2 with the linearized pUN1301 vector, achieving in vitro circularization of the two linearized DNAs, i.e., recombination of the complete CDS fragments of OsRS29.1 and OsRS29.2 into the overexpression binary vector pUN1301. The successfully constructed gene overexpression vector was transformed into Agrobacterium, and the OsRS29.1 and OsRS29.2 gene overexpression lines were obtained using Nipponbare rice as a background.

[0192] The gene overexpression lines were validated using qRT-PCR. From T1 plants, gene overexpression lines OE1#1 and OE1#2 targeting OsRS29.1, and gene overexpression lines OE2#1 and OE2#2 targeting OsRS29.2 were screened. The results are shown below. Figure 4 .

[0193] from Figure 4 As shown in Figure B, the relative expression level of the OsRS29 gene in the OsRS29 gene overexpression lines is much higher than that in the wild-type Nipponbare.

[0194] Example 3: Phenotypic analysis of OsRS29 gene-edited and overexpression lines

[0195] In this embodiment, phenotypic analysis was performed on the OsRS29 gene-edited and overexpression lines obtained in Example 2. The phenotypic analysis included grain shape, grain weight, and chalkiness formation. This included the following:

[0196] 3.1 Analysis of particle shape and weight

[0197] Ten rice plants of each type and ten transgenic lines at maturity were randomly selected. Agronomic traits, including grain length, grain width, grain thickness, thousand-grain weight, and yield per plant, were measured and statistically analyzed. The measured grain length (B), grain width (C), grain thickness (D), length-to-width ratio (E), thousand-grain weight (F), and yield per plant (G) are shown in the table below. Figure 5 See Table 1.

[0198] Table 1

[0199]

[0200] In Table 1, data of different materials with the same property were compared multiple times using the LSD method. Significant differences were marked with different letters, p<0.05, n=10.

[0201] The results are as follows: Compared with wild-type Nipponbare, the grain shape and weight of the OsRS29 gene-edited line and the gene-overexpression line changed significantly.

[0202] from Figure 5As shown in Table 1, compared with wild-type Nipponbare, the OsRS29 gene-edited lines exhibited significantly longer grains, increased length-to-width ratio, and significantly increased thousand-grain weight. Specifically, compared to wild-type Nipponbare, the two OsRS29 gene-edited homozygous lines (GE#1 and GE#2) showed increases in grain length of 4.53% and 5.86%, respectively; length-to-width ratios of 4.44% and 4.44%, respectively; and grain weights of 5.40% and 6.15%, respectively. The yield per plant in all gene-edited lines was significantly increased compared to the wild type, with increases of 14.83% and 16.94%, respectively; and the thousand-grain weight increased by 5.40% and 6.15%, respectively. However, there were no significant differences in grain width and thickness between the OsRS29 gene-edited lines and the wild type. In summary, OsRS29 gene knockout leads to longer grains and increased grain weight in rice.

[0203] from Figure 5 As shown in Table 1, compared with wild-type Nipponbare, overexpression of OsRS29.1 and OsRS29.2 both lead to smaller rice grains and reduced grain weight. Compared with wild-type Nipponbare, the two overexpression lines of OsRS29.1 (OE1#1 and OE1#2) showed reductions in grain length, grain width, grain thickness, thousand-grain weight, and yield per plant by 5.19% and 7.46%, 9.28% and 8.98%, 8.85% and 8.41%, 16.60% and 11.51%, and 11.87% and 13.51%, respectively. Similarly, compared with wild-type Nipponbare, the two overexpression lines of OsRS29.2 (OE2#1 and OE2#2) showed reductions in grain length, grain width, grain thickness, thousand-grain weight, and yield per plant by 4.13% and 5.33%, 8.08% and 8.08%, 6.19% and 8.41%, 15.54% and 12.05%, and 12.39% and 12.39%, respectively. Furthermore, there were no significant differences between the OsRS29.1 and OsRS29.2 overexpression lines in terms of grain length, grain width, grain thickness, length-to-width ratio, thousand-grain weight, and yield per plant, indicating that there is no functional differentiation between the two in regulating grain shape.

[0204] 3.2 Analysis of chalk formation

[0205] Chalkiness is a key indicator for judging rice quality. The fewer chalky grains and the smaller the chalky area, the lower the chalkiness and the better the rice quality.

[0206] from Figure 6 As shown in A and B, under conventional rice growing conditions, the grains of wild-type Nipponbare (Nip) are transparent when they reach maturity (A); when the cross-section of the seed is cut open with a blade, it is found that the cross-section of the grains of wild-type Nipponbare (Nip) is transparent (B).

[0207] from Figure 6As shown in A and B, the seeds of the OsRS29 gene-edited lines (GE#1 and GE#2) exhibit an opaque, chalky white appearance in the center of the seed, especially near the ventral side (A). Observation of the cross-section of the seed with a blade reveals that the endosperm of the OsRS29 gene-edited lines shows a certain area of ​​chalky white in the central part near the ventral side, while the outer part of the seed remains transparent (B). In other words, the OsRS29 gene-edited lines exhibit a ventral white phenotype.

[0208] from Figure 6 As shown in C and D, the brown rice phenotypes of the OsRS29.1 (OE1#1 and OE1#2) and OsRS29.2 (OE2#1 and OE2#2) overexpression lines were not significantly different from those of the wild type. The grains of the OsRS29.1 and OsRS29.2 overexpression lines harvested under the same growing conditions all exhibited the same transparent phenotype as the wild type, and no chalkiness was observed in the cross-section of the grains, consistent with the brown rice phenotype of wild-type Nipponbare.

[0209] The combined results indicate that the OsRS29 gene affects the formation of chalkiness in rice, and loss of function of the OsRS29 gene makes rice more prone to chalkiness.

[0210] Example 4: The OsRS29 gene participates in the regulation of rice quality and grain weight under high temperature.

[0211] In this embodiment, the OsRS29 gene-edited line and overexpression line obtained in Example 2 were subjected to high-temperature grouting tests. These included the following:

[0212] High temperature is an important environmental factor affecting chalkiness and yield in rice. To investigate whether high temperature affects the regulation of rice grain shape, weight, and chalkiness by OsRS29, two homozygous OsRS29 gene-edited lines GE#1 and GE#2, two OsRS29.1 gene overexpression lines OE1#1 and OE1#2, and two OsRS29.2 gene overexpression lines OE2#1 and OE2#2 were planted under two treatments: normal temperature (28℃ during the day / 25℃ at night, photoperiod of 14h during the day / 10h at night) and high temperature during the grain-filling stage (36℃ during the day / 28℃ at night, photoperiod of 14h during the day / 10h at night). The phenotype of mature grains was observed using these materials as experimental subjects.

[0213] Meanwhile, wild-type Nipponbare was planted as a control group under both temperature treatments.

[0214] 4.1 Analysis of the effects of high temperature during the grain-filling period on seed shape and weight

[0215] The results of seed shape and weight of two OsRS29 gene-edited lines and four gene-overexpression lines under different temperature treatments during the grain-filling stage are shown in the figure. Figure 7And Table 2.

[0216] Table 2

[0217]

[0218] NT: Normal temperature treatment during grouting (NT); HT: High temperature treatment during grouting (HT). Data from different materials with the same property were compared multiple times using the LSD method. Significant differences were indicated by different letters, p < 0.05, n = 10.

[0219] from Figure 7 As shown in Table 2, the measurement data indicate that high temperature does not significantly affect rice grain shape. Under heat treatment conditions during the grain-filling stage, compared with the wild type under the same growth conditions, the grain length of the two OsRS29 gene-edited lines was significantly longer and the grain weight was significantly increased. The grain length, grain width, grain thickness, and grain weight of the OsRS29.1 and OsRS29.2 gene overexpression lines were significantly reduced, which is consistent with the grain phenotype of the OsRS29 transgenic lines under normal temperature treatment conditions.

[0220] from Figure 7 As shown in Table 2, high temperature significantly reduces the thousand-grain weight of rice. It can be seen that compared with materials harvested under normal temperature treatment, the thousand-grain weight and yield per plant of the corresponding lines harvested under high temperature treatment during the grain-filling stage were both reduced. Compared with the normal temperature control, under high temperature treatment, the thousand-grain weight and yield per plant of wild-type rice decreased by 4.53% and 7.38%, respectively; the thousand-grain weight and yield per plant of the OsRS29 gene-edited line decreased by 8.88–10.57% and 12.7–15.00%, respectively; the thousand-grain weight and yield per plant of the OsRS29.1 overexpression line decreased by 1.68–2.71% and 1.68–2.71%, respectively; and the thousand-grain weight and yield per plant of the OsRS29.2 overexpression line decreased by 0.66–1.37% and 1.24–3.60%, respectively.

[0221] The above results indicate that OsRS29 can stably participate in the regulation of rice grain shape under both conventional and high temperatures. However, compared with the wild type, the changes in grain weight under high temperature treatment in the OsRS29 gene-edited and gene-overexpression lines differed from those in the wild type. The reduction in grain weight in the gene-edited lines was greater than that in the wild type, while the reduction in grain weight in the gene-overexpression lines was smaller than that in the wild type. This suggests that overexpression of OsRS29 can enhance the tolerance of rice to high temperatures during grain weight formation.

[0222] 4.2 Analysis of the effect of high temperature during the grain-filling stage on chalkiness of grains

[0223] To understand the effect of OsRS29 on chalky rice formation under high temperature conditions during the grain-filling stage, this study observed the brown rice phenotype of wild-type and OsRS29 transgenic plants harvested under two temperature treatments.

[0224] from Figure 8 As shown in section A, under normal temperature treatment, the grains of the two OsRS29 gene-edited lines exhibited obvious chalkiness in the middle and near the ventral region; while under the same conditions, the grains of the wild-type and OsRS29.1 and OsRS29.2 gene overexpression lines were generally transparent, and the cross-section of the grains was also transparent, with no chalkiness observed. This is consistent with the phenotype of seeds harvested under conventional rice cultivation conditions. Figure 6 ).

[0225] from Figure 8 As shown in Figure B, under high-temperature treatment, wild-type Nipponbare kernels only showed a small area of ​​chalkiness in the middle of the endosperm, while the endosperm of OsRS29 gene-edited lines harvested under the same conditions showed a large area of ​​chalkiness or complete opacity. Conversely, the kernel phenotypes of OsRS29.1 and OsRS29.2 gene overexpression lines harvested under high-temperature treatment were consistent, with the endosperm showing high transparency similar to that under normal temperature treatment, and no obvious chalky areas. Observation of the kernel cross-section showed that the kernels of OsRS29.1 and OsRS29.2 gene overexpression lines had chalkiness in the middle of the cross-section, but the degree of chalkiness was much lower than that of wild-type kernels under the same conditions.

[0226] These results indicate that OsRS29 affects the temperature sensitivity of rice grains under high temperatures. The loss of OsRS29 gene function makes rice more sensitive to high temperatures during the grain-filling stage, making rice grains more prone to chalkiness and increasing chalkiness. Overexpression of OsRS29, on the other hand, can enhance the rice's tolerance to high temperatures during grain formation.

Claims

1. OsRS29 Use of a gene in modulating grain shape, yield, chalkiness formation or high temperature tolerance in rice, characterized in that, The regulation is to increase the content of rice. OsRS29 The expression level of genes can be adjusted to increase the high-temperature tolerance of rice during the grain-filling stage, or to obtain rice that is resistant to high temperatures during the grain-filling stage, or to inhibit the formation of chalkiness in rice; or to inhibit or block the expression of genes. OsRS29 The expression and / or function of [the rice variety] thereby improving rice grain shape, increasing rice yield, or cultivating high-yield rice. OsRS29 The nucleotide sequence of the gene is the sequence shown in SEQ ID No. 1, or the sequence described above. OsRS29 The nucleotide sequence of the gene's alternative splice is shown in SEQ ID No. 2 or SEQ ID No.

3.

2. Use of a recombinant expression vector in improving high temperature tolerance at the grain-filling stage, inhibiting chalkiness formation, or breeding a high temperature tolerant rice at the grain-filling stage, characterized in that, The recombinant expression vector comprises an empty vector and an expression gene inserted in the empty vector, and a nucleotide sequence of the expression gene is selected from one of sequences shown in SEQ ID No. 2 or SEQ ID No.

3.

3. Use of a mutant material in improving grain shape, increasing yield or breeding high yield rice, characterized in that, In OsRS29 gene target point, the mutant material can inhibit or block the expression and / or function of OsRS29 OsRS29 gene, the nucleotide sequence of the OsRS29 gene is the sequence shown in SEQ ID No. 1, or the nucleotide sequence of the alternative splice body of the OsRS29 gene is the sequence shown in SEQ ID No. 2 or SEQ ID No.

3.

4. Use according to claim 3, characterized in that, The mutant material comprises a nucleic acid nicking enzyme and a target sequence, and the target sequence is a sequence shown in SEQ ID No. 4 or SEQ ID No.

5.

5. A method for improving grain shape, increasing yield or breeding high yield rice, characterized by, comprising the step of inhibiting or blocking the expression and / or function of OsRS29 an OsRS29 gene whose nucleotide sequence is shown as SEQ ID No. 1, or a alternatively spliced body of the OsRS29 gene whose nucleotide sequence is shown as SEQ ID No. 2 or SEQ ID No. 3, thereby improving rice grain shape, increasing rice yield, or cultivating high-yield rice.

6. A method for improving high temperature tolerance at the grain-filling stage of rice or breeding a high temperature tolerant rice at the grain-filling stage or inhibiting chalkiness formation in rice, characterized by, comprising the step of increasing the expression of a gene in rice OsRS29 the nucleotide sequence of the OsRS29 gene is shown as SEQ ID No. 1, or the nucleotide sequence of a alternatively spliced body of the OsRS29 gene is shown as SEQ ID No. 2 or SEQ ID No. 3, thereby increasing the high temperature tolerance during the grain-filling stage of rice or obtaining a high temperature tolerant rice during the grain-filling stage or inhibiting the chalkiness formation of rice.

7. Use according to claim 1 or 3 or method according to claim 5, wherein the compound is of formula (I) ###0002### (I) or a pharmaceutically acceptable salt thereof. The grain shape comprises one or more of grain length, grain width, length-width ratio and grain thickness; And / or, the yield comprises one or both of thousand-grain weight and yield per plant.

Images