Halogenoalkane dehalogenase and its application in the degradation of 1,2,3-trichloropropane

Abstract

The present invention discloses a haloalkane dehalogenase and its application in the degradation of 1,2,3-trichloropropane. The haloalkane dehalogenase provided by the present invention is a protein with the amino acid sequence of SEQ ID NO.1. The haloalkane dehalogenase of the present invention has high degradation activity towards the refractory and highly toxic 1,2,3-trichloropropane, and can degrade 42.63% of 1,2,3-trichloropropane after 2 h of reaction, with a fast biodegradation rate; IPTG is used to induce the expression of the haloalkane dehalogenase in recombinant bacteria, and high enzyme activity can be obtained after 5 h of expression. The recombinant bacteria express the haloalkane dehalogenase faster and with higher yields. The haloalkane dehalogenase of the present invention has high activity in a relatively wide pH range (3.0 - 9.0) and temperature range (25°C - 60°C), and has a relatively broad application scope.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and relates to a haloalkane dehalogenase and an application thereof in the degradation of 1,2,3-trichloropropane. Background Art

[0002] 1,2,3-Trichloropropane is a synthetic organic pollutant and an important chemical product and chemical raw material worldwide. Due to its low organic carbon partition coefficient, moderate solubility and strong stability, once released, 1,2,3-Trichloropropane can quickly migrate from the soil to the groundwater, leading to persistent groundwater contamination. 1,2,3-Trichloropropane has highly toxic effects such as teratogenicity, carcinogenicity, and mutagenicity, and its toxicity to humans is significantly higher than that of other chlorides. Even low concentrations of 1,2,3-Trichloropropane exposure can pose a huge threat to the ecological environment and human health. Therefore, the prevention, control and treatment of 1,2,3-Trichloropropane in groundwater are of great scientific and social significance, and relevant research work is urgently needed.

[0003] Microbial remediation is an ideal approach for remediating 1,2,3-TCP-contaminated groundwater due to its environmentally friendly, economical, non-reactive, and adaptable nature. While 1,2,3-TCP biodegradation has been observed under both anaerobic and aerobic conditions, microbial degradation in natural environments is extremely slow and primarily driven by co-metabolism. Currently, only a few strains can utilize 1,2,3-TCP as an electron acceptor under strictly anaerobic conditions to convert it into unstable chloropropenes, which then undergo biohydrolysis to form allyl alcohol. However, bioreductive dechlorination is only suitable for remediating low-concentration 1,2,3-TCP-contaminated groundwater (<1 mg / L) and requires a long acclimatization period before biodegradation can initiate. Currently, no aerobic microorganisms have been reported that can utilize 1,2,3-TCP as a sole carbon and energy source for growth and metabolism. This may be due to the strong inhibitory effect of 1,2,3-TCP on both microbial growth and metabolism, or to a lack of enzymes required for key steps in the 1,2,3-TCP catabolism pathway.

[0004] Dehalogenation is the initial and key step in the mineralization of 1,2,3-TCP, and it also reduces its biotoxicity. 1,2,3-TCP is first hydrolyzed and dehalogenated by haloalkane dehalogenase (DhaA) to produce 2,3-dichloropropane (DCP), which is then reacted with halohydrin dehalogenase (HheC) and epoxide hydrolase (EchA) to produce glycerol. Analysis of products in the 1,2,3-TCP biosynthesis pathway revealed that the initial dehalogenation product, 2,3-TCP, is bioavailable, indicating that the initial dehalogenation of 1,2,3-TCP to 2,3-TCP is a key step limiting its biodegradation. Using haloalkane dehalogenases directly on 1,2,3-trichloropropane (1,2,3-TCP) not only rapidly initiates its biodegradation but also reduces its cytotoxicity to microorganisms. Therefore, the key to improving the biodegradation efficiency of 1,2,3-TCP is to obtain highly active haloalkane dehalogenases. However, since wild strains are regulated by various factors, achieving high enzyme production levels is often difficult, limiting the industrial application of haloalkane dehalogenases. Therefore, cloning the genes encoding haloalkane dehalogenases through genetic engineering and expressing them in large quantities on heterologous receptors is of great significance. Summary of the Invention

[0005] The technical problems to be solved by the present invention are how to degrade 1,2,3-trichloropropane and how to repair the pollution.

[0006] To solve the above technical problems, the present invention first provides a method for degrading 1,2,3-trichloropropane, which comprises: adding protein to an inorganic salt solution containing 1,2,3-trichloropropane to react and achieve degradation of 1,2,3-trichloropropane;

[0007] The protein is as follows A1) or A2):

[0008] A1) a protein having an amino acid sequence of SEQ ID NO. 1;

[0009] A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1).

[0010] To facilitate purification of the protein in A1), a tag as shown in the following table may be attached to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID NO. 1 in the sequence listing.

[0011] Table: Sequence of tags

[0012]

[0013] In the above method, the inorganic salt solution can be composed of a solvent and a solute, the solvent is water, the solutes and their concentrations are respectively Na2HPO4·7H2O 7 g / L, KH2PO4 3 g / L, (NH4)2SO4 5 g / L, NaCl 3 g / L, MgSO4·7H2O 0.7 g / L, and the pH is adjusted to 7.5 using NaOH.

[0014] In the above method, the reaction temperature may be 25-45°C.

[0015] The application of the protein in degrading 1,2,3-trichloropropane also falls within the protection scope of the present invention.

[0016] In the above applications, the degradation conditions may be a high temperature environment, an alkaline environment, an acidic environment, a high temperature alkaline environment, or a high temperature acidic environment.

[0017] In the above application, the temperature for protein degradation of 1,2,3-trichloropropane may be 25-60°C. Further, the temperature may be 30-60°C. Further, the temperature may be 35-55°C. Further, the temperature may be 40-50°C. Further, the temperature may be 45°C.

[0018] In the above application, the acidic environment may be at a pH of 3-6. Further, the acidic environment may be at a pH of 5. The alkaline environment may be at a pH of 7-9. Further, the alkaline environment may be at a pH of 8.

[0019] The application of the protein in the remediation of 1,2,3-trichloropropane pollution also falls within the protection scope of the present invention.

[0020] The present invention also provides a method for preparing a haloalkane dehalogenase, which comprises: introducing the coding gene of the protein into Escherichia coli BL21 (DE3) via a pET-28a (+) vector to obtain a recombinant bacterium, expressing the coding gene under the induction of isopropyl-β-D-thiogalactopyranoside (IPTG), and isolating the haloalkane dehalogenase.

[0021] Specifically, the protein coding gene is introduced into E. coli BL21 (DE3) via the pET-28a (+) vector and can be recombined via the pET-28a- dhaA Introduced into the E. coli, the pET-28a- dhaA For the plasmid pET-28a (+) Eco RI and Hind III recognition sequence is replaced by the DNA fragment shown in SEQ ID NO.2 in the sequence list dhaAThe recombinant plasmid obtained by the gene can express the haloalkane dehalogenase shown in SEQ ID NO.1 in the sequence list dhaA Fusion protein with a HIS tag.

[0022] The coding gene can be isolated from Rhodococcus rhodochrous bacteria using specific primers. Rhodococcusrhodochrous The gene was specifically amplified from the genomic DNA of strain NCTC10210.

[0023] The primer may be an upstream primer dhaA R: 5'-CCC GAATTC ATGTCCACAATTCCCGTGCT -3'; downstream primer dhaA F: 5'-CCG AAGCTT TCACTCGCGGTTGAAACAGT -3'.

[0024] In the above method, the induction time of the isopropyl-β-D-thiogalactopyranoside can be 5 hours.

[0025] The protein of the present invention possesses haloalkane dehalogenase activity, showing high biodegradation activity against the recalcitrant and highly toxic 1,2,3-trichloropropane. It can degrade 42.63% of 1,2,3-trichloropropane in just 2 hours, demonstrating a rapid biodegradation rate. The recombinant bacteria, induced to express the haloalkane dehalogenase using isopropyl-β-D-thiogalactopyranoside (IPTG), achieved high enzyme activity after just 5 hours of expression. Compared to wild-type strains (which typically require fermentation for more than 24 hours), the recombinant bacteria expressed the haloalkane dehalogenase at a faster rate and with higher yields. The haloalkane dehalogenase of the present invention exhibits high activity across a wide pH range (3.0-9.0) and temperature range (25°C-60°C), suggesting a broad range of applications.

[0026] The present invention overcomes the shortcomings of poor environmental adaptability, slow startup, and poor 1,2,3-trichloropropane degradation performance associated with the remediation of 1,2,3-trichloropropane contamination by microorganisms. The invention also provides a method for achieving efficient heterologous expression of the haloalkane dehalogenase preparation, thereby overcoming limitations on the industrial application of haloalkane dehalogenases. This invention has significant practical significance for the industrial application of haloalkane dehalogenases.

[0027] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The plasmid map.

[0029] Figure 2 Purification of haloalkane dehalogenase: Lane M is a protein molecular weight standard; Lanes 1-3 are 0.6-1.0 mmol / L IPTG (precipitate after bacterial cell disruption and centrifugation); Lanes 4-9 are 0.1-0.4 mmol / L IPTG (supernatant after bacterial cell disruption and centrifugation).

[0030] Figure 3 This is the optimal reaction pH test result of haloalkane dehalogenase.

[0031] Figure 4 is the optimal reaction temperature of haloalkane dehalogenase.

[0032] Figure 5 This is the effect of different haloalkane dehalogenase addition amounts on the degradation efficiency of 1,2,3-trichloropropane. DETAILED DESCRIPTION

[0033] The experimental methods in the following examples, unless otherwise specified, are all conventional methods and are carried out in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. The quantitative tests in the following examples were all repeated three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0034] Rhodococcus rhodochrous Rhodococcus rhodochrouss train NCTC10210: China General Microbiological Culture Collection Center (CGMCC 1.2348).

[0035] pET-28a: Novagen, catalog number: HG-VYN0170.

[0036] Example 1. Preparation of haloalkane dehalogenase and enzyme activity detection

[0037] This embodiment provides a method of Rhodococcus rhodochrouss train Haloalkane dehalogenase from NCTC10210.

[0038] 1. Construction of recombinant plasmids and recombinant bacteria

[0039] Rhodococcus rhodochrous Rhodococcus rhodochrouss train The genomic DNA of NCTC10210 was used as a template. dhaA F and dhaAPCR amplification was performed using a primer pair consisting of R to obtain a PCR product;

[0040] Upstream primer dhaA R: 5'-CCC GAATTC ATGTCCACAATTCCCGTGCT -3', underlined EcoR I restriction enzyme cutting site; downstream primer dhaA F: 5'-CCG AAGCTT TCACTCGCGGTTGAAACAGT -3', underlined Hind III restriction enzyme cutting site.

[0041] The obtained PCR products and plasmid pET-28a (+) were used Eco RI and Hind III double enzyme digestion, the large fragment after PCR product digestion was connected with the vector backbone after plasmid pET-28a (+) digestion, and the obtained recombinant vector with correct sequence was recorded as pET-28a- dhaA .

[0042] pET-28a- dhaA To transform the plasmid pET-28a (+) (map as shown Figure 1 shown) Eco RI and Hind III recognition sequence is replaced by the DNA fragment shown in SEQ ID NO.2 in the sequence list dhaA The recombinant plasmid obtained by the gene can express the haloalkane dehalogenase shown in SEQ ID NO.1 in the sequence list dhaA Fusion protein with a HIS tag.

[0043] pET-28a- dhaA Import E. coli BL21 (DE3), the recombinant bacteria BL21-pET-28a- dhaA .

[0044] 2. Expression and activity determination of haloalkane dehalogenase

[0045] (1) Expression of haloalkane dehalogenase

[0046] 1) The recombinant bacteria BL21-pET-28a- dhaA Streak onto LB-Kan plates (LB solid medium containing kanamycin, where the concentration of kanamycin is 50 μg / mL) and culture overnight at 37°C;

[0047] 2) Pick a single colony and inoculate it in liquid LB-Kan (LB liquid medium containing kanamycin at a concentration of 50 μg / mL). Cultivate overnight at 37°C and 200 rpm. The next day, transfer the colony to 1000 mL of LB medium at a 1% inoculum size and continue culturing.

[0048] 3) Waiting for OD 600 When the p-value reached 0.4-0.8, different concentrations of IPTG (0.1, 0.2, 0.4, 0.6, 0.8, and 1.0 mmol / L) were added, and expression was induced at 20°C and 100 rpm for 5 h. The cells were collected, and a certain volume of cell lysis buffer (50 mmol / L Tris-HCl pH 6.8, 100 mmol / L dithiothreitol, 2% sodium dodecyl sulfate, 0.1% bromophenol blue, and 10% glycerol) was added to the cells. The cells were placed on ice and ultrasonically disrupted until the bacterial solution became clear, thereby obtaining a crude haloalkane dehalogenase enzyme solution.

[0049] 4) The crude enzyme solution was centrifuged at 12,000 rpm for 15 min, and the cell lysate and cell debris were collected and subjected to SDS-PAGE.

[0050] The experimental results showed that changing the concentration of IPTG did not significantly change the expression level of haloalkane dehalogenase. Therefore, in subsequent experiments, the expression of haloalkane dehalogenase was induced at a concentration of 0.1 mmol / L IPTG.

[0051] (2) Determination of haloalkane dehalogenase activity

[0052] The enzymatic activity of haloalkane dehalogenase was detected by halide ion colorimetric method: 1,2,3-Trichloropropane (TCP, Beijing Jiangchen Biotechnology Co., Ltd.) and haloalkane dehalogenase crude enzyme solution were added to 50 mM phosphate buffer (pH = 8.0). The concentration of 1,2,3-Trichloropropane in the reaction system was 5 mM. The reaction was carried out at 30°C for 2 h to obtain a reaction solution. 25 μL of the reaction solution was taken into a 96-well plate, and 90 μL of 13.4 g / L ammonium ferric sulfate-nitric acid solution (13.4 g ammonium ferric sulfate and 67.1 mL pure nitric acid, dilute to 1 L with deionized water) was added and mixed thoroughly to terminate the enzymatic reaction. Then, 10 μL of 4 g / L mercuric thiocyanate-ethanol solution (0.4 g mercuric thiocyanate was diluted to 100 mL with anhydrous ethanol) was added and mixed thoroughly. The color was developed and the plate was allowed to stand for 15 minutes. min, observe whether the reaction solution turns red, and use a microplate reader to detect its absorbance at 460 nm.

[0053] The results showed that the activity of the crude haloalkane dehalogenase solution was 6.0 U / mL.

[0054] The activity unit (U) of haloalkane dehalogenase was defined as the amount of enzyme that could convert 1 micromole (μmol) of 1,2,3-trichloropropane in 1 min.

[0055] 3. Purification of haloalkane dehalogenase

[0056] Purify the target fusion protein using Ni-NTA agarose protein purification columns from Qiagen (Germany):

[0057] (1) Pipette 1 mL of Ni-NTA solution into a 15 mL test tube. Centrifuge to remove the supernatant and add 2 mL of lysis buffer (50 mmol / L NaH2PO4, 300 mmol / L NaCl, 10 mmol / L imidazole, adjust pH to 8.0 with NaOH, balance ddH2O). Gently shake to mix. Repeat the above steps once;

[0058] (2) Add 4 mL of crude haloalkane dehalogenase enzyme solution to the above-mentioned equilibrated matrix, and add imidazole to the system to a final concentration of 5 mmol / L. Shake gently (60 r / min) on a shaker at 4 °C for 60 min to obtain a "lysate-Ni-NT" mixture;

[0059] (3) Loading the “lysate-Ni-NT” mixture into a column with a bottom outlet;

[0060] (4) Remove the bottom cover and collect the effluent, save the effluent and perform electrophoresis;

[0061] (5) Wash the precipitate twice with 2.5 mL of elution buffer (50 mmol / L NaH2PO4, 300 mmol / L NaCl, 20 mmol / L, pH adjusted to 8.0 with NaOH, balance ddH2O), collect the wash solution and perform electrophoresis;

[0062] (6) Elute the protein four times with 0.5 mL of EB buffer solution (50 mmol / L NaH2PO4, 300 mmol / L NaCl, 250 mmol / L imidazole, adjust the pH to 8.0 with NaOH, and the remainder is ddH2O). Collect the eluate and store it in four test tubes. Perform electrophoresis on the collected eluate. The experimental results are shown in Figure 2. Figure 2 shown.

[0063] The enzyme activity was detected according to the method for determining the activity of the haloalkane dehalogenase in step 2. The activity of the purified haloalkane dehalogenase (eluate) was 9.0 U / mL.

[0064] Example 2: Analysis of the Enzymatic Properties of Haloalkane Dehalogenation

[0065] (1) Optimal pH of haloalkane dehalogenase

[0066] The crude enzyme solution of haloalkane dehalogenase prepared in Example 1 was appropriately diluted with 50 mM phosphate buffer of different pH values ​​(3.0-9.0), and the activity of haloalkane dehalogenase was determined according to the method for determining the activity of haloalkane dehalogenase in step 2. The enzyme with the highest haloalkane dehalogenase activity was defined as 100%.

[0067] The experimental results show that the enzyme activity of haloalkane dehalogenase reaches a peak in both alkaline and acidic pH ranges. Under acidic conditions, the optimal reaction pH of haloalkane dehalogenase is 5.0; under alkaline conditions, the optimal reaction pH of haloalkane dehalogenase is 8.0. Figure 3 shown.

[0068] (2) Optimal reaction temperature of haloalkane dehalogenase

[0069] The crude haloalkane dehalogenase solution prepared in Example 1 was appropriately diluted with 50 mM phosphate buffer (pH = 8.0), and the activity of the haloalkane dehalogenase was measured at different temperatures (20 ° C-65 ° C) according to the method for measuring the activity of the haloalkane dehalogenase in step 2. The haloalkane dehalogenase with the highest activity was defined as 100%.

[0070] The experimental results show that the optimal reaction temperature of haloalkane dehalogenase is 45 ℃. Figure 3 shown.

[0071] Example 3: Degradation of 1,2,3-trichloropropane by haloalkane dehalogenase

[0072] (1) Degradation of 1,2,3-trichloropropane by haloalkane dehalogenase

[0073] To an inorganic salt solution (7 g Na₂HPO₄·7H₂O, 3.0 g KH₂PO₄, 5 g (NH₄)₂SO₄, 3 g NaCl, 0.7 g MgSO₄·7H₂O, distilled water to 1 L, pH 7.5), 1,2,3-trichloropropane and the crude haloalkane dehalogenase solution (6.0 U / mL) obtained in Example 1 were added to create a reaction system. The 1,2,3-trichloropropane concentration in this reaction system was 5 mM, and the haloalkane dehalogenase addition amount varied from 0 U, 1 U, 2 U, 4 U, or 6 U. The resulting reaction system was incubated at 25°C for 2 h to obtain reaction products with varying enzyme dosages. Four replicates were performed for each experiment.

[0074] (2) Analysis of 1,2,3-trichloropropane degradation efficiency

[0075] The concentration of 1,2,3-trichloropropane in the reaction solution was determined by gas chromatography-mass spectrometry, and the degradation efficiency of 1,2,3-trichloropropane was calculated according to the following formula.

[0076]

[0077] Wherein, C0 is the concentration of 1,2,3-trichloropropane before the reaction, and C2 is the concentration of 1,2,3-trichloropropane in the reaction product after the reaction.

[0078] After 2 h of degradation, the degradation efficiencies of 1,2,3-trichloropropane by adding 0 U, 1 U, 2 U, 4 U, and 6 U of haloalkane dehalogenase crude enzyme solution were 5.63%, 20.56%, 30.28%, 42.32%, and 42.63%, respectively. The experimental results are shown in Figure 2. Figure 5 As shown in the figure, haloalkane dehalogenase can rapidly degrade 1,2,3-trichloropropane. The degradation efficiency of 1,2,3-trichloropropane increased significantly with increasing enzyme dosage at enzyme addition levels of 1 to 4 units. When the enzyme dosage increased to 6 units, the degradation efficiency of 1,2,3-trichloropropane increased slightly (42.63%), but remained similar to the efficiency at 4 units (42.32%). Therefore, the optimal enzyme dosage is 4 units.

[0079] The haloalkane dehalogenase of the present invention has high degradation activity against the difficult-to-degrade, highly toxic 1,2,3-trichloropropane, degrading 42.63% of 1,2,3-trichloropropane within a 2-hour reaction time, demonstrating a rapid biodegradation rate. The recombinant bacteria, induced to express the haloalkane dehalogenase using isopropyl-β-D-thiogalactopyranoside (IPTG), achieved high enzyme activity after just 5 hours of expression. Compared to wild-type strains (which typically require fermentation for more than 24 hours), the recombinant bacteria expressed the haloalkane dehalogenase more rapidly and produced higher yields (recombinant bacteria can specifically express the haloalkane dehalogenase, while wild-type strains express multiple proteins simultaneously).

[0080] The haloalkane dehalogenase of the present invention has high activity in a relatively large pH range (3.0-9.0) and temperature range (25° C.-60° C.), and has a relatively wide range of applications.

[0081] The sequences involved in the above embodiments are as follows:

[0082] SEQ ID NO.1:

[0083] MSTIPVLDSTMAYRSRGEGTPFVLIHGNPTSSHLWRNILPQIGNLGRALAPDLIGMGQSGKPPINYGFLDTARYLDAWFDQMELDDVVLVGHDWGGALALDWAARHPDRVRGVAFFETILRPMTWDEHFPGEARARVEALRDSDTGETKVLDENFFLEIALHRTVLGEMTETDAEAYRSPYPSRESRRPLLEWPRSFPIEGTPGDVYARVAAYSDWLAKSTDVPKLLLTFSGPAELLMIGPDEVTWSRSNIANLEVEQCGPAGHLAPEDQPAAIAAAITEWTERQHCFNRE

[0084] SEQ ID NO.2:

[0085] 1ATGTCCACAA TTCCCGTGCT CGACTCGACC ATGGCCTACC GCTCGCGCGG TGAAGGAACA

[0086] 61CCCTTCGTAC TCATCCACGG AAACCCCACA TCCTCGCACT TGTGGCGAAA CATCCTGCCG

[0087] 121CAGATAGGAA ATCTAGGCCG CGCACTTGCC CCTGACCTCA TCGGAATGGG GCAGTCAGGC

[0088] 181AAACCGCCAA TCAACTACGG CTTCCTCGAC ACCGCCCGCT ACCTCGACGC CTGGTTCGAC

[0089] 241CAGATGGAAC TCGACGACGT CGTACTCGTC GGACACGACT GGGGCGGGGC ACTTGCACTG

[0090] 301GACTGGGCTG CCCGCCACCC CGATCGCGTC CGAGGTGTGG CCTTCTTCGA AACGATCCTT

[0091] 361CGTCCGATGA CCTGGGACGA ACACTTCCCG GGAGAGGCAC GGGCACGGGT GGAAGCTCTG

[0092] 421AGGGACTCCG ACACAGGAGA GACGAAGGTA CTCGACGAGA ACTTCTTTCT CGAAATAGCG

[0093] 481CTTCACAGAA CGGTTCTCGG TGAAATGACC GAAACCGATG CCGAGGCCTA TCGCTCCCCT

[0094] 541TATCCGTCAC GAGAGAGTCG CCGACCCCTT CTCGAGTGGC CACGATCCTT CCCCATCGAA

[0095] 601GGAACTCCCG GTGACGTGTA TGCACGTGTG GCGGCGTACA GCGATTGGCT CGCAAAAAGC

[0096] 661ACTGACGTAC CCAAACTTCT TCTCACCTTC AGCGGCCCCG CAGAACTTCT CATGATCGGA

[0097] 721CCTGACGAAG TCACGTGGAG CCGATCGAAT ATCGCAAATC TCGAGGTGGA ACAGTGCGGT

[0098] 781CCCGCAGGAC ATCTCGCCCC CGAGGATCAG CCTGCGGCCA TCGCGGCGGC GATCACCGAA

[0099] 841TGGACAGAGCGGCAACACTG TTTCAACCGCGAGTGA

[0100] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. A method for degrading 1,2,3-trichloropropane, comprising: Add protein to the inorganic salt solution containing 1, 2, 3-trichloropropane for reaction to achieve the degradation of 1, 2, 3-trichloropropane; The protein is as follows A1) or A2): A1) A protein with the amino acid sequence of SEQ ID NO.1; A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1).

2. The method according to claim 1, wherein: The inorganic salt solution is composed of a solvent and a solute. The solvent is water, and the solute and its concentration are 7 g / L of Na2HPO4·7H2O, 3 g / L of KH2PO4, 5 g / L of (NH4)2SO4, 3 g / L of NaCl, and 0.7 g / L of MgSO4·7H2O. The pH is adjusted to 7.5 with NaOH.

3. The method according to claim 1 or 2, characterized in that: The temperature of the reaction is 25 - 45 °C.

4. Use of the protein described in claim 1 in the degradation of 1, 2, 3-trichloropropane.

5. The application according to claim 4, characterized in that: The conditions for the degradation are a high-temperature environment, or an alkaline environment, or an acidic environment.

6. The application according to claim 4, characterized in that: The conditions for the degradation are a high-temperature alkaline environment, or a high-temperature acidic environment.

7. The application according to claim 4, wherein: The temperature for the protein described in claim 1 to degrade 1, 2, 3-trichloropropane is 25 - 60 °C.

8. The application according to claim 7, wherein: The temperature is 30 - 60 °C.

9. The application according to claim 8, wherein: The temperature is 35 - 55 °C.

10. The application according to claim 9, characterized in that: The temperature is 40 - 50 °C.

11. The application according to claim 10, wherein: The temperature is 45 °C.

12. The application according to claim 5 or 6, characterized in that: The acidic environment is pH 3 - 6.

13. The application according to claim 12, wherein: The acidic environment is pH 5.

14. The application according to claim 5 or 6, characterized in that: The alkaline environment is pH 7 - 9.

15. The application according to claim 14, characterized in that: The alkaline environment is pH 8.

16. Use of the protein described in claim 1 in the remediation of 1, 2, 3-trichloropropane pollution.

17. Preparation method of haloalkane dehalogenase, comprising: The coding gene of the protein described in claim 1 is introduced into Escherichia coli E. coli BL21(DE3) through the pET-28a(+) vector to obtain a recombinant bacterium. The coding gene is expressed under the induction of isopropyl-β-D-thiogalactoside, and the haloalkane dehalogenase is isolated.

18. The method according to claim 17, wherein: The induction time of the isopropyl-β-D-thiogalactoside is 5 h.

Images