A Phyllostachys edulis PheNAC4 gene, its encoded protein and applications

Abstract

The present invention provides a moso bamboo transcription factor and its application. The amino acid sequence of the transcription factor is as shown in the amino acid sequences SEQ ID NO: 1-2, and the nucleotide sequence is as shown in SEQ ID NO: 3-4. The present invention also provides the application of the moso bamboo transcription factor protein and its encoding gene in regulating the bolting and flowering periods of plants. By using genetic engineering techniques, the present invention has achieved the cultivation of transgenic plants of moso bamboo transcription factors PheNAC4 and PheNAC4<supgt;ES< / supgt>, which have significantly changed the bolting and flowering periods of the plants compared with the wild type, providing an important theoretical basis for regulating the bolting and flowering of plants.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an application of a bamboo transcription factor in plant cultivation. Background Art

[0002] Moso bamboo (Phyllostachys edulis) can grow up to 15-20 meters in 45 to 60 days. Bamboo plants grow fast, mature early, have high yields and abundant resources. They are widely used in food, building materials, daily necessities and handicrafts. As a perennial monocot plant, like other plants, Moso bamboo has a life history of vegetative growth and reproductive growth, but the vegetative growth period lasts for decades to hundreds of years and is uncertain. Moso bamboo only blooms once in its life. After flowering, the bamboo forest's regeneration capacity decreases, the leaves age and fall off, and individual plants die, even leading to the natural withering of the entire bamboo forest. Some moso bamboo forests in Zhejiang, Guangxi and Jiangxi provinces bloomed on a large scale in 1954, 1962, 1963 and 1973. In recent years, the International Bamboo and Rattan Center has continuously discovered the phenomenon of moso bamboo flowering in Guilin, Guangxi. The death of moso bamboo in large areas after flowering and aging has a huge impact on the economic development and ecological environment of bamboo areas. For a long time, the mechanism and regulation of moso bamboo flowering and development have been the focus and difficulty of research.

[0003] During the flowering and senescence process of plants, the chlorophyll content decreases, the photosynthesis capacity decreases, and a large number of macromolecular substances are degraded, transported and reused, so the genes encoding these reactions are upregulated or downregulated. Experiments have shown that the expression patterns of thousands of genes change during the senescence process. NAC is a transcription factor unique to plants and one of the largest transcription factor families in plants. NAC transcription factors have attracted attention because they can regulate the expression of senescence and flowering-related genes in many plants. A large number of studies have shown that NAC transcription factors can participate in the regulation of plant senescence and flowering processes. Existing research evidence shows that 30 NAC genes are significantly upregulated during the natural senescence of Arabidopsis leaves, which fully proves the importance of NAC family genes in senescence regulation. Studies have confirmed that the OsNAC2 gene cloned from rice and overexpressed the OsNAC2 gene in rice showed that the flowering time of the overexpressing transgenic plants was delayed compared with the wild-type rice, and they showed a phenotype of shorter plant height, shorter panicle length, and reduced fruit set rate; AtNAC092 / AtNAC2 / ORE1 is not only involved in the formation of Arabidopsis lateral roots, but also in the aging process of Arabidopsis leaves.

[0004] In summary, exploring the genes in the NAC transcription factor family of bamboo that regulate flowering and senescence can not only analyze the regulatory mechanism of the bamboo senescence process, but also regulate the growth and development of the plant by regulating the expression of transcription factors, which has important practical significance and application prospects. Summary of the Invention

[0005] The object of the present invention is to provide a moso bamboo transcription factor and its application in plant culture.

[0006] In order to achieve the above object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a moso bamboo transcription factor, and the transcription factor includes: PheNAC4 and / or PheNAC4 ES ;

[0008] The amino acid sequence of PheNAC4 is shown in SEQ ID NO: 1 in the sequence listing;

[0009] PheNAC4 ES The amino acid sequence of is shown in SEQ ID NO: 2 in the sequence listing.

[0010] The gene sequence of PheNAC4 is shown in SEQ ID NO: 3;

[0011] PheNAC4 ES The gene sequence of is shown in SEQ ID NO: 4 in the sequence listing.

[0012] A primer group for amplifying PheNAC4 / PheNAC4 ES The upstream and downstream primers are shown in SEQ ID NOs: 5-6 in the sequence listing.

[0013] A vector containing any one of the above transcription factors, and the vector contains PheNAC4 and / or PheNAC4 ES .

[0014] The construction method of the above vector is: designing primers according to the transcription factor gene sequence, introducing restriction enzyme sites BamHI and HindIII, and using double digestion with BamHI and HindIII to digest the binary expression vector pCAMBIA2300, and constructing an overexpression vector by double digestion and ligation.

[0015] A host bacterium containing the above vector.

[0016] The construction method of the above host bacterium is: transferring the vector into Agrobacterium tumefaciens competent cells by the freeze-thaw method, coating the transformed Agrobacterium tumefaciens competent cells on an LB medium containing kanamycin and rifampicin, culturing at 28 °C for 2 d, and picking monoclonal colonies for Agrobacterium culture to obtain the host bacterium.

[0017] The present invention also provides the application of the above moso bamboo transcription factor in plant culture.

[0018] The above application refers to regulating the bolting and flowering periods of plants by controlling the expression of the transcription factor.

[0019] Preferably, the above-mentioned control of the expression of the transcription factor refers to transferring the vector containing the transcription factor into cruciferous plants by Agrobacterium-mediated transformation to achieve overexpression of the transcription factor in cruciferous plants.

[0020] Advantages of the present invention:

[0021] (1) Through the analysis of the moso bamboo genome, the present invention discovered two transcription factors, PheNAC4 and PheNAC4 ES The expression levels of both PheNAC4ES during flower development were lower than those in mature leaves of moso bamboo, and were down-regulated during flower development. The expression level of PheNAC4 was higher than that in mature leaves of moso bamboo during the full bloom stage of flower development, while the expression levels during the flower bud formation stage, inflorescence elongation stage, and seed embryo formation stage were lower than those during the full bloom stage and mature leaves.

[0022] (2) The present invention successfully constructed transgenic Arabidopsis thaliana of PheNAC4 and PheNAC4 ES Overexpression of PheNAC4 significantly promoted the bolting and flowering of the lines, while overexpression of PheNAC4 ES significantly inhibited the bolting and flowering of the lines.

[0023] (3) The present invention provides a basis for its effective application, which is of great significance for regulating the flowering period of plants, improving the plant type, and cultivating new plant varieties. Description of the Drawings

[0024] Figure 1 : Cloning and sequence analysis of the CDS sequences of PheNAC4 and PheNAC4 ES genes (A): Cloning of the CDS sequence; (B): Intron / exon structure analysis of PheNAC4 and PheNAC4 ES ; (C) NAM domain analysis of PheNAC4 and PheNAC4ES.

[0025] Figure 2 : Expression detection of PheNAC4 and PheNAC4 ES during the mature leaves of moso bamboo and flower development.

[0026] Figure 3 : (A) Detection of PheNAC4 transgenic Arabidopsis thaliana: Lane 1 is the positive pCAMBIA2300-PheNAC4 plasmid, Lane 2 is the wild type (wt), and Lanes 3-13 are transgenic Arabidopsis thaliana; (B) PheNAC4 ESDetection of transgenic Arabidopsis thaliana: Lane 24 is positive pCAMBIA2300-PheNAC4 ES plasmid, lane 23 is wild type (wt), and lanes 14-22 are transgenic Arabidopsis thaliana.

[0027] Figure 4 : Detection of PheNAC4 transgenic Arabidopsis thaliana expression (A) and PheNAC4 ES Detection of transgenic Arabidopsis thaliana expression (B).

[0028] Figure 5 : Phenotype observation of wild-type Arabidopsis thaliana (WT), PheNAC4 and PheNAC4 ES overexpression lines. Detailed implementation manners

[0029] Considering that although the life history of Phyllostachys edulis has vegetative growth and reproductive growth, the vegetative growth period lasts for decades to hundreds of years, with strong uncertainty, and Phyllostachys edulis only flowers once in its lifetime. In order to effectively explore the influence of Phyllostachys edulis transcription factors on the flowering period of plants, the present invention collected flowering Phyllostachys edulis from Guangxi, sampled according to four stages of flower development (flower bud formation stage, inflorescence elongation stage, glume flower differentiation stage and young embryo formation stage), then extracted RNA from Phyllostachys edulis flowers at different stages and reverse-transcribed it into cDNA, and cloned the CDS sequence of the Phyllostachys edulis transcription factor through PCR. The results are as shown in the appendix Figure 1 : There are two bands. The longer one is about 1000bp, and the shorter band is between 500bp and 750bp. The two bands were respectively ligated to the pGEM-T Easy vector for sequencing. After sequencing, it was found that the longer band was 951bp, which was consistent with the genomic sequencing result and had a complete NAM domain, named PheNAC4; the shorter band was 656bp, which was caused by the skipping of the second exon, named PheNAC4 ES , which indicates that there is alternative splicing of PheNAC4 during flower development.

[0030] Based on this research finding, the present invention provides the following technical solutions:

[0031] A Phyllostachys edulis transcription factor, the transcription factor includes: PheNAC4 and / or PheNAC4 ES ;

[0032] The amino acid sequence of PheNAC4 is as shown in Sequence Listing SEQ ID NO: 1;

[0033] PheNAC4 ES The amino acid sequence of is as shown in Sequence Listing SEQ ID NO: 2.

[0034] The gene sequence of PheNAC4 is shown in SEQ ID NO: 3;

[0035] PheNAC4 ES The gene sequence is shown in Sequence Listing SEQ ID NO: 4.

[0036] A set of primers for amplifying PheNAC4 / PheNAC4 ES The upstream and downstream primers are shown in Sequence Listing SEQ ID NOs: 5 - 6.

[0037] The expression patterns of PheNAC4 and PheNAC4 ES during the development of Phyllostachys edulis flowers were analyzed by real-time fluorescence quantitative PCR, and the results are shown in the appendix Figure 2 showing that: The expression level of PheNAC4 ES during flower development (F1 - F2) is lower than that of mature leaves of Phyllostachys edulis (F0), and it is down-regulated during flower development. The expression level of PheNAC4 is higher than that of mature leaves of Phyllostachys edulis during the full bloom stage of flower development, while the expression levels during the flower bud formation stage (F1), inflorescence elongation stage (F3), and seed embryo formation stage (F4) are lower than those during the full bloom stage (F2) and mature leaves. It shows an expression pattern of first up-regulation and then down-regulation during flower development. It can be seen from this that PheNAC4 and PheNAC4 ES show different expression patterns during leaf and flower development.

[0038] Furthermore, the present invention also provides a vector containing any one of the above transcription factors, and the vector contains PheNAC4 and / or PheNAC4 ES .

[0039] The construction method of the above vector is: Design primers according to the transcription factor gene sequence, introduce restriction enzyme sites BamHI and HindIII, double-digest the binary expression vector pCAMBIA2300 with BamHI and HindIII, and construct an overexpression vector by the method of double-digest ligation.

[0040] Preferably, the upstream and downstream primers are shown in Sequence Listing SEQ ID NOs: 5 - 6;

[0041] A host bacterium containing the above vector.

[0042] The construction method of the above host bacterium is: Transfer the vector into Agrobacterium competent cells by the freeze-thaw method respectively, spread the transformed Agrobacterium competent cells on LB medium containing kanamycin and rifampicin, culture at 28 °C for 2 d, and pick monoclonal colonies for Agrobacterium culture to obtain the host bacterium.

[0043] Preferably, the kanamycin concentration is 50 mg·L -1; The rifampicin concentration is 20 mg·L -1 .

[0044] The present invention also provides the application of the above-mentioned moso bamboo transcription factor in cultivating plants.

[0045] The above-mentioned application refers to regulating the bolting and flowering periods of plants by controlling the expression of the transcription factor.

[0046] Optionally, the above-mentioned controlling the expression of the transcription factor includes: inhibiting expression and promoting expression.

[0047] Preferably, the above-mentioned controlling the expression of the transcription factor means transferring the vector containing the transcription factor into cruciferous plants by the Agrobacterium transformation method to achieve overexpression of the transcription factor in cruciferous plants.

[0048] In the present invention, unless otherwise specified, all raw material components are commercially available products well-known to those skilled in the art.

[0049] Next, the technical solutions in the present invention will be clearly and completely described in conjunction with the embodiments in the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0050] Example 1

[0051] Cloning of the moso bamboo transcription factor gene

[0052] 1. Material preparation: Samples of flowers at different developmental stages of flowering moso bamboo and leaves of non-flowering moso bamboo were collected from Guilin City, Guangxi Zhuang Autonomous Region, which is located in the southwestern part of the Nanling Mountains, and stored at -80 °C for subsequent experiments.

[0053] 2. RNA extraction

[0054] The total RNA of moso bamboo flowers was extracted with reference to the TaKaRa RNAiso Plus kit, and the specific operations are as follows:

[0055] (1) Take 0.2 - 0.3 g of the sample and grind it into powder in liquid nitrogen, and collect the powder into a 2 mL centrifuge tube;

[0056] (2) Add 1 mL of RNAiso Plus to the above centrifuge tube, quickly invert and mix well, and let it stand at room temperature for 5 min;

[0057] (3) Centrifuge at 12,000 rpm, 4 °C for 5 min, and take the supernatant to an RNase-free centrifuge tube after centrifugation;

[0058] (4) Add 200 μL of chloroform to each tube, invert and mix well for 5 min, and let stand at room temperature for 5 min;

[0059] (5) Centrifuge at 12,000 rpm at 4 °C for 15 min, and transfer the supernatant to a new RNase-free centrifuge tube;

[0060] (6) Add an equal volume of isopropanol to each tube, invert and mix well, and let stand at room temperature for 10 min;

[0061] (7) Centrifuge at 12,000 rpm at 4 °C for 10 min, and discard the supernatant after centrifugation;

[0062] (8) Add 1 mL of 75% ethanol to wash the precipitate, centrifuge at 7,500 rpm at 4 °C for 5 min, and discard the supernatant after centrifugation.

[0063] (9) Add 30 μL of RNase-free H 2 O to dissolve the precipitate.

[0064] 3. RNA Reverse Transcription

[0065] Perform the first-strand cDNA reverse transcription according to the PrimeScript TM RT reagent Kit with gDNAEraser (TaKaRa) kit:

[0066] (1) Genomic DNA Removal Reaction

[0067] Prepare the reaction mixture on ice with the following components. The PCR reaction program is: 42 °C, 2 min.

[0068] Table 1 Genomic DNA Removal Reaction System

[0069]

[0070] (2) Reverse Transcription Reaction

[0071] The reverse transcription PCR reaction program is: 37 °C, 15 min; 85 °C, 5 s; store at 4 °C.

[0072] Table 2 Reverse Transcription Reaction System

[0073]

[0074]

[0075] (3) The cDNA after reverse transcription can be diluted 10-fold and used for gene cloning.

[0076] 4. Gene Cloning

[0077] (1) The sequences of the amplification primers are as follows:

[0078] PheNAC4-cds-F: ATGTCCATGAGCTTCTTGAGCAT

[0079] PheNAC4-cds-R: CTAGAAGGGATTCATCCAAGTAGAG

[0080] (2) PCR amplification

[0081] Using the cDNA in 3 as a template, perform PCR amplification with the corresponding primers. The reaction program is: 94°C, 1 min;

[0082] 95°C, 10 s; 60°C, 30 s; 72°C, 1 min; cycle 30 times; 72°C, 10 min. Master nexus-PCR instrument. Prepare a 20 μL amplification system on ice as follows:

[0083] Table 3 20 μL PCR reaction system

[0084]

[0085] (3) Use 1% agarose gel electrophoresis to detect whether the band size meets the expectation and perform the next step of gel cutting and recovery verification.

[0086] (4) Gel recovery and purification. Perform gel recovery and purification according to the instructions of the M5 Gel ExtractionKit (with column) (Polymerase Beauty, Beijing) kit.

[0087] (5) Ligation reaction

[0088] Refer to the pGEM-T Easy instruction manual of Promega Corporation. The ligation system is as follows:

[0089] Table 4 10 μL ligation system

[0090]

[0091] (6) Transform the ligation product into Escherichia coli competent DH5α

[0092] Refer to the transformation instruction manual of Escherichia coli competent DH5α of Tiangen Biochemical Technology (Beijing) Co., Ltd. The specific steps are as follows:

[0093] ① Take the competent cells and place them in an ice bath.

[0094] ② Add the above ligation product to the competent cell suspension, mix well and let it stand in the ice bath for 30 min.

[0095] ③ After 90 s at 42 °C, leave it standing on ice for 2 min.

[0096] ④ Add 300 μL of LB medium (without antibiotics), and culture it with shaking at 180 rpm at 37 °C for 45 min.

[0097] ⑤ Pipette 100 μL of the transformed competent cells, add them onto the LB (Luria - Bertani) solid agar medium containing ampicillin, and spread evenly. Incubate the inverted plate at 37 °C for 12 - 16 h.

[0098] ⑥ Pick a monoclonal colony into an 800 - μL centrifuge tube containing liquid medium with ampicillin, culture it with shaking at 37 °C and 180 rpm for 16 h, and perform colony - PCR identification.

[0099] ⑦ Send the positive bacterial liquid identified correctly in step 6 to Genewiz (Suzhou) for sequencing. The finally cloned nucleotide and amino acid sequences of the moso bamboo flowering - related gene PheNAC4 and the alternative - splicing transcript PheNAC4 ES are as follows. The nucleotide sequence is as shown in SEQ ID NO: 3 - 4, and the amino acid sequence is as shown in SEQ ID NO: 1 - 2.

[0100] 5. Gene expression analysis

[0101] According to the moso bamboo PheNAC4 and PheNAC4 ES gene sequences, using TIP41 as an internal reference (Fan et al., 2013), analyze the expression pattern of the target gene. The qRT - PCR reaction system (20 μL): SYBR Master Mix 10 μL, 0.4 μL each of the upstream and downstream primers, 2 μL of cDNA, ddH 2 O 7.2 μL. The reaction program: 95 °C for 5 min; 95 °C for 10 s, 60 °C for 10 s, 72 °C for 20 s, for 45 cycles. The experiment is repeated three times. The 2 -△△CT method is used to calculate the relative expression level.

[0102] Example 2

[0103] Construction of plant expression vector

[0104] According to the moso bamboo PheNAC4 and PheNAC4 ES gene sequences cloned in Example 1, design primers, and choose to introduce the restriction enzyme sites BamHI and HindIII (OEPheNAC4 / PheNAC4 ES -F: CGGGATCCATGTCCATGAGCTTCTTGAGCAT and

[0105] OEPheNAC4 / PheNAC4ES -R:

[0106] CCCAAGCTTCTAGAAGGGATTCATCCAAGTAGAG), the binary expression vector Pcambia2300 was double-digested with BamHI and HindIII, and the overexpression vectors pCAMBIA2300-PheNAC4 and pCAMBIA2300-PheNAC4 were constructed by double-digestion ligation. ES .

[0107] Example 3

[0108] Arabidopsis transformation

[0109] The expression vectors pCAMBIA2300-PheNAC4 and pCAMBIA2300-PheNAC4 constructed in Example 2 were transferred to the culture medium by freeze-thaw method. ES The competent cells of Agrobacterium GV3101 were transferred to the competent cells of Agrobacterium, and the transformed competent cells of Agrobacterium were spread on LB medium containing kanamycin (50 mg·L-1) and rifampicin (20 mg·L-1), cultured at 28℃ for 2 days, and single clones were selected for Agrobacterium culture, and wild-type Arabidopsis was transformed by inflorescence infiltration method. T0 generation seeds were harvested and sown on 1 / 2 Murashigeand Skoog (MS) medium containing kanamycin (50 mg·L-1) for screening. The culture conditions were: 4℃, dark culture for 2 days, then placed at 22℃, long day (16h light, 8h dark), and the seedlings screened were transplanted to nutrient soil when the Arabidopsis seedlings grew 4 leaves (about 10 days).

[0110] Example 4

[0111] PheNAC4 and PheNAC4 ES Heterologous transformation of Arabidopsis thaliana affects flowering

[0112] (1) PCR detection of transgenic Arabidopsis

[0113] The transgenic Arabidopsis constructed in Example 3 was tested using M5 Ultramix (without extracting genomic DNA), and the steps were as follows:

[0114] ①Cut the leaves of each strain of Arabidopsis thaliana about 2mm 2 For the sample, add 20 μL of lysis buffer, grind the solid sample as much as possible, boil for 10 minutes, centrifuge at 12000 rpm for 2 minutes, and take 1-2 μL as the subsequent PCR template.

[0115] ②Use the cleavage product of step ① as a template for PCR detection, and the detection primers are: PheNAC4 / PheNAC4 ES-F: CACCATTGCCACCTCTCACT and 2300-R: GCCTCTTCGCTATTACGCCA. Finally, 11 and 9 positive lines of PheNAC4 and PheNAC4 were obtained respectively. ES As Figure 3 shown.

[0116] (2) RNA extraction and detection of PheNAC4 and PheNAC4 gene expression levels ES

[0117] ① Refer to the RNA extraction and reverse transcription methods in Example 1 to extract the total RNA of transgenic Arabidopsis thaliana and reverse transcribe it.

[0118] ② Using the reverse transcribed cDNA as a template above, detect the gene expression levels of PheNAC4 and PheNAC4 in the positive lines respectively. As can be seen from ES it, there are significant differences in the expression levels of different PheNAC4 and PheNAC4 transgenic Arabidopsis thaliana lines. Finally, according to the results of expression level determination, select the transgenic lines OW4-3, OW4-7 and OW4-11 of PheNAC4 and the transgenic lines OW4 Figure 4 of PheNAC4 ES -1, OW4 ES -2 and OW4 ES -1, OW4 ES -2 and OW4 ES -6 for subsequent experiments.

[0119] (3) Cultivation of transgenic Arabidopsis thaliana

[0120] ① Disinfect the dried seeds with 75% absolute ethanol for 30 min and then evenly sprinkle them on 1 / 2 MS medium (containing kanamycin) to germinate. At the same time, sow wild-type Arabidopsis thaliana (Col-0) as a control and place it in the dark at 4°C for 24 h for vernalization treatment.

[0121] ② Transfer to the light condition (16 h light / 8 h dark) for cultivation at a temperature of 23°C.

[0122] ③ Transplant the seedlings with 4 true leaves into small flower pots for planting, and count the flowering time and bolting time, with wild-type Arabidopsis thaliana as a control.

[0123] ④ Observe the phenotypes of different lines at 18 d and 32 d after sowing. As shown in Figure 5 , when the overexpression lines of PheNAC4 began to bolt and flower at 18 days after sowing, the wild-type and the overexpression lines of PheNAC4 ES had not started to bolt yet; at 32 days after sowing, when the wild-type began to bolt and flower, PheNAC4 ES ​The overexpression lines still did not flower. The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A Phyllostachys edulis transcription factor, characterized in that, The transcription factors include: PheNAC4 and / or PheNAC4 ES ; The amino acid sequence of PheNAC4 is shown in Sequence Listing SEQ ID NO: 1; PheNAC4 ES 's amino acid sequence is shown in Sequence Listing SEQ ID NO:

2.

2. The coding gene of the transcription factor according to claim 1, characterized in that, The coding gene sequence of PheNAC4 is shown in SEQ ID NO: 3; the PheNAC4 ES coding gene sequence is shown in Sequence Listing SEQ ID NO:

4.

3. A primer set for amplifying the coding gene according to claim 2, characterized in that, the upstream and downstream primers of the primer set are as shown in SEQ ID NO: 5-6 in the sequence listing.

4. A vector containing the coding gene according to claim 2, characterized in that, The vector contains the coding gene of PheNAC4 and / or the coding gene of PheNAC4 ES itself.

5. The construction method of the vector according to claim 4, characterized in that, Primers are designed according to the coding gene of the transcription factor, introducing restriction enzyme sites BamHI and HindIII, and the binary expression vector pCambia2300 is double digested with BamHI and HindIII, and the overexpression vector is constructed by double digestion and ligation.

6. A host bacterium containing the vector according to claim 4.

7. The construction method of the host bacterium according to claim 6, characterized in that, The vector is transferred into Agrobacterium tumefaciens competent cells by the freeze-thaw method, and the transformed Agrobacterium tumefaciens competent cells are spread on LB medium containing kanamycin and rifampicin, cultured at 28 °C for 2 d, and single colonies are picked for Agrobacterium culture to obtain the host bacterium.

8. The application of the transcription factor according to claim 1 or the coding gene according to claim 2 in regulating the bolting and flowering periods of plants, wherein the plants are Phyllostachys edulis or Arabidopsis thaliana.

9. The application according to claim 8, characterized in that, The vector containing the transcription factor is transferred into plants by Agrobacterium-mediated transformation to achieve overexpression of the transcription factor in plants.

Images