Sweet potato 9-cis-epoxycarotenoid dioxygenase encoding gene IbNCED1 and its application in regulating strain high

Abstract

The present invention relates to the research fields of molecular biology and plant genetic engineering technology, and in particular to a sweet potato 9-cis-epoxycarotenoid dioxygenase gene IbNCED1 And its application in Zhu High School. IbNCED1 The nucleotide sequence of the gene is shown in SEQ ID NO. 1. The present invention is achieved by removing the sweet potato 9-cis-epoxycarotenoid dioxygenase gene IbNCED1 The overexpression was transformed into the sweet potato variety Xushu 22 to obtain sweet potato plants. The results showed that compared with the wild type, the overexpression IbNCED1 The ABA content of sweet potatoes with the gene was significantly increased, gibberellin (GA) was significantly reduced, and the plant growth rate was significantly reduced. IbNCED1 It participates in the synthesis of ABA and GA, and then regulates the height of sweet potato plants, which will provide a reference for improving the quality of sweet potato and the breeding of new varieties.

Description

Technical Field

[0001] The present invention relates to the research fields of molecular biology and plant genetic engineering technology, and in particular to a sweet potato 9-cis-epoxycarotenoid dioxygenase encoding gene. IbNCED1 And its application in regulating strain high school. Background Art

[0002] sweet potato( Ipomoea batatas Lamb (L.) is an important food, feed, industrial raw material and new energy crop in my country. It is an annual or perennial dicotyledonous crop widely planted in more than 100 countries or regions in the world and plays a vital role in maintaining food security and energy security.

[0003] Sweet potato stems grow in a creeping or semi-erect manner. In production, if the plant height is too long, the stems will be entangled with each other, which is not conducive to mechanical harvesting and will also reduce the yield. There are many factors that control plant height. Among them, gibberellin (GA) is a growth regulator of a class of diterpenoid compounds that can promote cell elongation and stem and leaf elongation, thereby regulating the plant. Among all GA components, GA3 has the highest activity.

[0004] Abscisic acid (ABA) is a plant endogenous hormone with a sesquiterpene structure, which is widely involved in a series of important physiological and biochemical processes in plants. During plant growth and development, ABA and GA are closely related. 9-cis-epoxycarotenoid dioxygenase is a key rate-limiting enzyme in the ABA biosynthesis pathway and plays a key role in plant growth and development.

[0005] At present, the breeding process of sweet potato plant type improvement and new variety selection is cumbersome and time-consuming, consuming a lot of manpower and material resources. Summary of the invention

[0006] Aiming at the research gap in the prior art, the present invention provides a sweet potato 9-cis-epoxycarotenoid dioxygenase encoding gene IbNCED1 .

[0007] The present invention also provides a sweet potato 9-cis-epoxycarotenoid dioxygenase encoding gene IbNCED1 Application in regulating strains.

[0008] The technical solution adopted by the present invention to achieve the above-mentioned purpose is:

[0009] The invention provides a sweet potato 9-cis-epoxycarotenoid dioxygenase encoding gene IbNCED1 , whose nucleotide sequence is shown in SEQ ID NO.1.

[0010] The present invention also provides a gene encoding the sweet potato 9-cis-epoxycarotenoid dioxygenase. IbNCED1 The recombinant vector pCAMBIA1301- IbNCED1 .

[0011] The present invention further provides a gene encoding the sweet potato 9-cis-epoxycarotenoid dioxygenase. IbNCED1 of host cells.

[0012] The present invention also provides the above sweet potato 9-cis-epoxycarotenoid dioxygenase encoding gene IbNCED1 Application in regulating plant strains.

[0013] Preferably, the specific method for regulating plant height is: IbNCED1 The gene was connected to the vector and transformed into sweet potato through Agrobacterium-mediated transformation to obtain overexpressed sweet potato IbNCED1 Transgenic plants.

[0014] The present invention also provides a plant overexpression recombinant vector pCAMBIA1301- IbNCED1 Application in regulating plant strains.

[0015] The present invention uses genetic engineering technology to clone the 9-cis-epoxycarotenoid dioxygenase encoding gene from the short-vine sweet potato variety "Jishu 26" IbNCED1 The full-length gene was cloned and a cloning vector and a plant expression vector were constructed. The long-vine sweet potato variety "Xushu 22" was successfully transformed to obtain overexpression sweet potato plants. The study found that compared with the control plants, the ABA content of the transgenic sweet potato plants was significantly increased, the GA3 content was significantly reduced, and the plant height was significantly reduced. This will provide a basis for further research IbNCED1 It lays the foundation for the regulatory mechanism of genes in the growth and development of sweet potatoes, and also provides a theoretical basis for using molecular means to improve sweet potato plant types and select new varieties. It also has great application prospects.

[0016] The invention uses the cDNA of short-vine sweet potato "Jishu 26" as a template to clone and isolate the 9-cis-epoxycarotenoid dioxygenase encoding gene IbNCED1 The full length of its ORF sequence is 1764 bp, encoding 587 amino acids.

[0017] The present invention further constructs a plant overexpression recombinant vector PCAMBIA1301- IbNCED1 , transformed and overexpressed IbNCED1Sweet potato plants. The transgenic sweet potato plants were observed and the results showed that the plant height of the transgenic sweet potato lines was significantly lower than that of the wild type. The hormones were further measured and the results showed that the ABA content of the transgenic sweet potato lines was significantly increased and the GA3 content was significantly reduced compared with the wild type. This provides a basis for further research. IbNCED1 It lays the foundation for its function in regulating sweet potato plant height and also provides a reference for using molecular means to accelerate the breeding of new short-vine sweet potato varieties.

[0018] The beneficial effects of the present invention are as follows: the present invention is to synthesize the sweet potato 9-cis-epoxycarotenoid dioxygenase encoding gene IbNCED1 Transformed into the sweet potato variety "Xushu 22", a total of 8 over-expressed sweet potatoes were obtained after identification. IbNCED1 Gene-positive plants. The ABA content of the transgenic lines was significantly increased, the GA content was significantly reduced, and the plant height was significantly reduced. This indicates that the sweet potato 9-cis-epoxycarotenoid dioxygenase encoding gene IbNCED1 It is involved in regulating the synthesis pathways of ABA and GA3 hormones, and thus regulating the plant height of sweet potatoes, which will provide a technical reference for the improvement of short vines of sweet potatoes and the breeding of new varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 IbNCED1 Gene expression in different tissues of sweet potato;

[0020] Figure 2 DNA detection of transgenic sweet potato lines (A) and fluorescence quantitative PCR detection IbNCED1 Gene expression (B); where M is DNA molecule Marker, W is negative control water, and P is positive control (pCAMBIA1301- IbNCED1 ), WT is the genomic DNA of wild-type sweet potato plants, L1-L7 are the genomic DNA of transgenic IbNCED1 Genetic sweet potato positive plants;

[0021] Figure 3 Phenotype and plant height of transgenic sweet potato plants; (A1-A2) are the phenotype and plant height of tissue culture seedlings grown for 4 weeks; (B1-B2) are the phenotype and plant height of potted seedlings grown for 4 weeks. DETAILED DESCRIPTION

[0022] The present invention will be further described below in conjunction with specific embodiments.

[0023] Example 1 IbNCED1 Detection of gene expression levels in different sweet potato tissues

[0024] The materials used in this example are plant materials of various tissues of "Jishu 26" at the harvest stage, which are quickly frozen in liquid nitrogen after harvest and stored in an ultra-low temperature refrigerator (-80°C).

[0025] 1) Extraction of Total RNA from Sweet Potato Tissues

[0026] According to the instructions of TaKaRa Plant Total RNA Extraction Kit, the specific operation is as follows: ultra-low temperature frozen "Jishu 26" sweet potato tissues

[0027] Quickly transfer to a mortar pre-cooled with liquid nitrogen, and grind the tissue with a pestle, adding liquid nitrogen continuously until it is ground into powder; add the ground samples into 1.5 mL sterile tubes containing 450 μl Buffer PE, and repeatedly pipette until there is no obvious precipitation in the lysate; centrifuge the lysate at 12,000 rpm, 4℃ for 5 minutes; carefully pipette the supernatant into a new 1.5 mL sterile tube. Add 1 / 10 volume of Buffer NB to the supernatant, Vortex to mix, centrifuge at 12,000 rpm, 4℃ for 5 min; carefully pipette the supernatant into a new 1.5 mL sterile tube, add 450 μL of Buffer RL, and mix the solution evenly with a pipette; add 1.5 times the volume of anhydrous ethanol to the mixture, mix the solution evenly with a pipette, and immediately transfer all the mixture to the RNA Spin Column; centrifuge at 12,000 rpm for 1 min, discard the filtrate, and put the RNA Spin Column back into the 2 ml Collection Tube; add 600 μL of 80% ethanol to the RNA Spin Column, centrifuge at 12,000 rpm for 30 s, and discard the filtrate; add 50 μL of DNase I reaction solution to the center of the RNA Spin Column membrane and let it stand at room temperature for 15 min; add 350 μL of Buffer RWB to the center of the RNA Spin Column membrane, centrifuge at 12,000 rpm for 30 s, discard the filtrate; add 600 μL of 80% ethanol to the RNA Spin Column, centrifuge at 12,000 rpm for 30 s, and discard the filtrate; re-install the RNA Spin Column on the 2mL Collection Tube, centrifuge at 12,000 rpm for 2 min; install the RNA Spin Column on the 1.5 mL RNase Free Collection Tube, add 30 μL of RNase Free dH2O to the center of the RNA Spin Column membrane, let stand at room temperature for 5 min, and centrifuge at 12,000 rpm for 2 min to elute the RNA. The obtained RNA was tested for concentration and purity and stored in a -80℃ refrigerator for future use.

[0028] 2 μL RNA was aspirated and tested by 1% agarose gel electrophoresis. The results showed that the 28S and 18S bands were relatively clear, and the brightness of the 28S band was about twice that of the 18S band, indicating that the RNA quality was good. The RNA purity was tested by a micronucleoprotein analyzer, and the OD 260 / OD 280 and OD 260 / OD 230 All of them are between 1.8 and 2.1, with good integrity and can be used for reverse transcription.

[0029] 2) Synthesis of the first strand of reverse transcribed cDNA

[0030] Before RNA reverse transcription, electrophoresis was performed to check whether it was degraded, and the RNA concentration was calculated using an RNA / DNA calculator. The reverse transcription was performed according to the RNA reverse transcription kit's requirements for RNA. The first strand of reverse transcribed cDNA was reversed using the TaKaRa reverse transcription kit PrimeScript TM RT reagent Kit (Perfect Real Time), refer to the instructions of the kit for specific operations.

[0031] 3) Fluorescence quantitative analysis

[0032] Based on sweet potato IbNCED1 Sequencing results, using NCBI BLAST to design sweet potato IbNCED1 The fluorescent quantitative primers of the gene were used, with ACTIN as the internal reference gene. The reverse transcribed cDNA was diluted 10 times and 1 μL was taken as the template. The fluorescent quantitative primers used were as follows:

[0033] IbNCED1 -F:5'-ATTCCCACTTCAATATCCACTGCC -3'

[0034] IbNCED1- R ： 5'-TTGCCGCCGCTCTTTGC -3'

[0035] ACTIN-F: 5'-AGCAGCATGAAGATTAAGGTTTGTAGCAC-3'

[0036] ACTIN-R ： 5'- TGGAAAATTAGAAGCACTTCCTGTGAAC -3'

[0037] The reaction solution was prepared according to the instructions of the SYBR Green Pro TaqHSqPCR Kit (Acry Biotech), and the PCR program was run on a Roche Lightcycler®480 fluorescence quantitative instrument: 95°C for 2 min; 95°C for 15 s, 55°C for 15 s, 72°C for 15 s, 40 cycles; 37°C for 1 s. After the reaction was completed, the amplification curve was obtained, the data were exported, and the data were analyzed using Excel. The CT value was used as 2 -ΔΔCq The relative expression was calculated by relative quantification method. The data analysis results are shown in Figure 1 shown.

[0038] In this embodiment 1, based on the analysis of the fluorescence quantitative results, the sweet potato IbNCED1 The expression level of genes in various tissues at harvest time. Figure 1 It can be seen that sweet potato IbNCED1 The gene expression level is higher in old tissues than in young tissues, and is also higher in tuberous roots.

[0039] Example 2 Gene cloning and construction of recombinant plasmid

[0040] The plant materials used in this example are "Jishu 26" and "Xushu 22", which are preserved in this experiment. The plant expression vector used in the experiment is pCAMBIA1301, which is preserved in this experiment; the Escherichia coli strain used is Trans5α, and the Agrobacterium strain is EHA105, which are purchased from Beijing Qingke Biotechnology Co., Ltd. for vector construction and transformation of sweet potato.

[0041] 1) Design and cloning of target gene primers

[0042] According to the CDS sequence of the sweet potato IbNCED1 gene published in sweetpotato garden (see SEQ NO.1), amplification primers were designed using Prime5.0, and restriction sites (Kpn I, Sal I) were added at both ends. The primer sequences are:

[0043] IbNCED1 -Kpn I -F:5'- GG GGTACC ATGGCCAACACCATT-3' (the underlined part is the KpnI restriction site),

[0044] IbNCED1 -Sal I -R:5'-CG GTCGAC AGCTTGGGTGGATAG-3' (the underlined part is the EcoRI restriction site).

[0045] Using cDNA as template, LA Taq high-fidelity enzyme was used to clone sweet potatoIbNCED1 Gene cloning. PCR amplification system (50 μL) is: 0.5 μl LA Taq, 10 μl Mg 2+ Plus mix, 8 μL dNTP Mixture, 1 μL Forward Primer, 1 μL Reverse Primer, 2 μL Template DNA, 25.5 μL ddH2O. The PCR program was as follows: reaction conditions were 94°C pre-denaturation for 3 min, 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 2 min, 34 cycles, 72°C total extension for 10 min, and 4°C incubation.

[0046] After the PCR reaction is completed, perform agarose gel electrophoresis to detect and cut the target fragment, and then recover and purify the PCR target amplification product through gel recovery. Use the DNA gel recovery kit of Akre Biotech to purify and recover the target fragment. The specific operation is as follows: cut the single target band from the agarose gel, put it into a clean centrifuge tube, and weigh it; add 3 volumes of GSB solution to the gel block (if the gel is 0.1g, its volume can be regarded as 100μL, then add 300μL GSB solution), place it in a 55℃ water bath, and constantly and gently turn the centrifuge tube up and down until the gel block is completely dissolved; cool the melted gel solution to room temperature, add 1 volume of isopropanol (if the gel is 0.1g, then add 100μL isopropanol), and mix gently; add the mixture to the centrifuge column and place it at room temperature for 1 min, centrifuge at 12000rpm for 1min, discard the effluent, and then put the centrifuge column back into the collection tube; add 650μL solution WB to the centrifuge column, centrifuge at 12000rpm for 1min, discard the effluent; centrifuge at 12000rpm for 2min, try to remove the residual WB, place the adsorption column at room temperature with the cover open for 5min, and dry it thoroughly; place the centrifuge column in a clean centrifuge tube, add 30μL ddH2O (ddH2O needs to be preheated in a 60~70℃ water bath in advance) to the middle of the adsorption membrane, let it stand at room temperature for 2min, centrifuge at 12000rpm for 2min to collect the DNA solution. Take 2μL to recover the purified product, use 1.5% agarose for gel electrophoresis detection, and place the rest in a -20℃ refrigerator, which will be used to connect with the pCAMBIA1301 vector to construct an overexpression vector.

[0047] 3) Plasmid extraction:

[0048] Extract the plasmid according to the instructions of Tiangen Plasmid Mini-Extraction Kit. The specific steps are as follows:

[0049] Take 10mL of overnight cultured bacterial solution, centrifuge at 12000 rpm for 1min, and remove the supernatant; take 500μL P1 solution (containing RNase A) and add it to the centrifuge tube with bacterial pellet, and use a vortex instrument to thoroughly suspend the bacterial pellet; take 500μL P2 solution and add it to the centrifuge tube, gently turn it upside down to fully lyse the bacteria, take 700μL P3 solution and add it to the centrifuge tube, immediately gently turn it upside down, mix it thoroughly, and when white flocculent precipitate appears, centrifuge at 12000rpm for 10min; take 500μL balance solution BL and add it to the adsorption column CP4, centrifuge at 12000rpm for 1min, discard the waste liquid in the collection tube, put the adsorption column back into the collection tube, add the collected supernatant to the filter column CS in batches, centrifuge at 12000rpm for 2min, carefully add the solution collected in the collection tube to the adsorption column CP4 in batches, centrifuge at 12000rpm for 1min, discard the waste liquid in the collection tube, and put the adsorption column C Put P4 back into the collection tube; take 500μL of deproteinized solution PD and add it to the adsorption column CP4, centrifuge at 12000rpm for 1min, discard the waste liquid in the collection tube, and put the adsorption column CP4 back into the collection tube; take 600μl of rinse solution PW (containing anhydrous ethanol) and add it to the adsorption column CP4, centrifuge at 12000rpm for 1min, discard the waste liquid in the collection tube, put the adsorption column CP4 back into the collection tube, centrifuge at 12000rpm for 2min to remove the residual rinse liquid in the adsorption column; move the adsorption column CP4 to a new 1.5ml centrifuge tube, add 60μL ddH2O to the middle of the adsorption membrane; let it stand at room temperature for 2min, centrifuge at 12000rpm for 1min, and the solution collected in the centrifuge tube is the plasmid. Finally, measure the concentration of the plasmid to prepare for the next experiment.

[0050] 4) Double enzyme digestion reaction

[0051] The extracted pCAMBIA1301 plasmid was digested with Kpn I and Sal I at 37°C for 30 min, and the linear vector was recovered by electrophoresis and stored at -20°C for later use. The double enzyme digestion reaction system was 50 μL: 20 μL pCAMBIA1301 plasmid, 5 μL 5× buffer, 1 μL Kpn I, 1 μL Sal I, and 23 μL ddH2O.

[0052] 5) Recombination reaction

[0053] Agarose gel electrophoresis was used to detect the target gene and vector pCAMBIA1301 recovered after enzyme digestion. According to the detected purity and concentration, each reagent was added according to the ligation system. The ligation reaction system is: 7μL of linearized pCAMBIA1301 vector, 3μL of insert fragment, 4μL of T4 buffer, 2μL of T4, and 20μL of ddH2O. React at 37℃ for 30min, place at room temperature (do not cool immediately), and transform into E. coli competent Trans5α after 10min.

[0054] 6) Transform the ligation product into E. coli

[0055] Take out the competent cell Trans5α strain from the ultra-low temperature refrigerator and place it on ice to melt. Pipette 10 μL of the recombinant product and add it to 100 μL of competent cells; place the centrifuge tube on ice for 10 min; heat shock in a 42℃ water bath for 50s without shaking; then immediately place it on ice for 2 min; add 500 μL of antibiotic-free liquid culture medium in the clean bench, culture at 37℃ and 200 rpm for 60 min to recover; centrifuge at 6000 rpm for 1 min, and remove 350 μL of supernatant; resuspend the precipitated bacteria, spread on LB plates (Kana concentration is 50 mg / L), and culture at 37℃ overnight.

[0056] 7) Identification of recombinants

[0057] Pick a single colony on the plate and inoculate it into LB liquid medium containing antibiotics (Kana), and culture it overnight at 37°C and 200 rpm. Use the full-length primers of the target gene for bacterial liquid PCR to screen positive clones. The screened positive clones were sent to Qingdao Qingke Biotechnology Co., Ltd. for sequencing. After the positive clones with correct sequencing results were expanded and cultured, the plasmids were extracted using the Tiangen Plasmid Extraction Kit for transformation into Agrobacterium competent cells.

[0058] In this Example 2, the cDNA of "Jishu 26" was used as a template to clone and isolate the 9-cis-epoxycarotenoid dioxygenase encoding gene. IbNCED1 The ORF sequence was 1764 bp in length, encoding 587 amino acids, and the recombinant vector pCAMBIA1301- IbNCED1 , used for genetic transformation of sweet potato.

[0059] Example 3 Genetic transformation of sweet potato and identification of positive strains

[0060] 1) Preparation and transformation of competent cells of Agrobacterium tumefaciens EHA105

[0061] Competent preparation steps: Pick a single colony and inoculate it into 10 mL YEP liquid medium containing the antibiotic rifampicin, and shake and culture it overnight at 28°C and 180-250 rpm. Take 2 mL of the bacterial solution and transfer it to 50 mL YEP liquid medium containing the antibiotic rifampicin, and continue to culture until the OD value is 0.3-0.4. Transfer the bacterial solution to a sterile centrifuge tube and place it on ice for 30 min. Centrifuge at 5000 rpm for 10 min and remove the supernatant. Add 2 mL of pre-cooled 0.1 mol·L containing 15% glycerol. -1 The Agrobacterium suspension was dispensed into 1.5 mL sterile centrifuge tubes, 200 μL per tube, and quickly frozen with liquid nitrogen and stored in a -80°C refrigerator for later use.

[0062] Specific steps for competent transformation: Take 10 μL of plasmid DNA and add it to 200 μL of Agrobacterium competent medium thawed on ice, ice bath for 5 min, quickly freeze in liquid nitrogen for 5 min, and water bath at 37℃ for 5 min. Add 800 μL of YEP liquid medium, shake for 2~4 h at 28℃ and 100 rpm. Centrifuge at 5000 rpm, pour off most of the supernatant, keep about 50 μL, and resuspend the bacteria. Spread the bacterial liquid on YEP solid medium containing antibiotics rifampicin and kanamycin, invert and culture at 28℃ for 48~72 h until a single colony grows on the plate. Pick a single colony, extract the plasmid, and perform PCR identification of the target gene. The positive clones after identification were sent to Qingdao Qingke Biological Co., Ltd. for sequencing, and the positive colonies with correct sequencing results were selected for shaking, and an appropriate amount of sterile 50% glycerol was added, and stored at -80℃ for later use.

[0063] 2) Induction of embryonic callus and establishment of embryonic cell suspension line of sweet potato variety Xushu 22:

[0064] The harvested Xushu 22 tubers were used to provide sweet potato stem tips. The stem tip meristem was peeled and inoculated on MS solid medium containing 2.0 mg / L 2,4-D. Callus tissue was induced in the dark at room temperature of 27±1℃, and then propagated and subcultured to establish embryonic cell suspension lines for transformation.

[0065] 3) Cultivation of Agrobacterium: Activate the Agrobacterium culture on the resistance plate, pick a single colony and inoculate it into 5 mL of YEP liquid medium with the corresponding antibiotic added, and culture it at 28°C with shaking at 200 rpm until the OD 600 The value is in the range of 0.8 to 1.0.

[0066] 4) Preparation of suspension cell lines and infection with Agrobacterium tumefaciens: Select suspension cell lines that are 8-12 weeks old and in good condition for grinding. After subculture for 3 days, take out embryonic suspension cell clusters with a diameter of about 0.7-1.4 mm for Agrobacterium infection and transformation.

[0067] 5) Co-culture and delayed culture: The suspension cell lines infected with Agrobacterium were transferred to MS solid medium containing 30 mg / L acetosyringone (AS) and 2 mg / L 2,4-D for co-culture in a dark environment at 27±1°C. After 3 days of co-culture, the cell mass was washed once with MS liquid medium containing 200 mg / L cephalosporin (CS) and 2 mg / L 2,4-D, and then soaked in MS liquid medium containing 100 mg / L CS and 2 mg / L 2,4-D for 30 min. Finally, the cell mass was delayed for 1 week with MS liquid medium containing 2 mg / L 2,4-D. The culture conditions were 27±1°C, 500 Lux light (13 hours of light per day), and shaking at 100 rpm.

[0068] 6) Screening of resistant cell clusters: After delayed culture, transfer the cell clusters to MS solid medium containing 5.0 mg / L hygromycin (Hyg), 100 mg / L CS and 2 mg / L 2,4-D for dark culture at 27±1°C, and replace the medium every 2 weeks. After 4 weeks, transfer the resistant cell clusters to MS solid medium containing 10.0 mg / L Hyg, 100 mg / L CS and 2 mg / L 2,4-D and culture for 4 to 8 weeks.

[0069] 7) Induction of somatic embryos: The resistant cell clusters with good growth status were transferred to MS medium containing 1.0 mg / L ABA and 100 mg / L CS to induce somatic embryo growth. The culture conditions were 27±1℃ and 3000 Lux light (13h light per day).

[0070] 8) Regeneration and identification of pseudo-transgenic plants: The mature somatic embryos that turned green on ABA medium after 2-4 weeks of induction were transferred together with callus tissue to MS solid medium and cultured until complete plants were formed. The temperature was 27±1℃, the light intensity was 13h per day, and the light intensity was 3000 Lux to obtain pseudo-transgenic plants.

[0071] change IbNCED1 The identification of genetic plants was carried out using a combination of PCR and qRT-PCR detection.

[0072] The PCR detection method is as follows: DNA of the sweet potato variety Xushu 22 and the proposed transgenic line is extracted and PCR identification is performed. IbNCED1The vector plasmid was used as a positive control, and water and the wild-type sweet potato variety Xushu 22 were used as negative controls. The primers were as follows:

[0073] pCAMBIA1301-F: 5'- GACGCACAATCCCACTATCC -3'

[0074] IbNCED1 -R: 5'-AGCTTGGGTGGATAG-3'

[0075] The amplified PCR products were separated by electrophoresis in 1% (w / v) agarose gel. The PCR-positive plants had a specific electrophoresis band, and the strain number of the PCR-positive plants was recorded.

[0076] The qRT-PCR detection method was as follows: RNA was extracted from the sweet potato transgenic positive plants, and cDNA was obtained by reverse transcription, and qRT-PCR was performed, with Xushu 22 as the control WT.

[0077] In this embodiment 3, the sweet potato IbNCED1 pCAMBIA1301- IbNCED1 The overexpression recombinant vector was transferred into sweet potato. Figure 2 As shown, the results showed that only the positive control and the pseudo-transgenic lines L1-L7 had electrophoresis bands around 1800 bp, while the wild-type sweet potato and the negative control had no bands. It was preliminarily determined that the present invention obtained the sweet potato transgenic positive plants L1-L7 ( Figure 2 A). qRT-PCR test results showed that the positive transgenic sweet potato lines IbNCED1 The gene expression level was significantly increased ( Figure 2 B).

[0078] Example 4 Sweet potato IbNCED1 Identification of functions regulating plant height

[0079] The phenotypes of transgenic plants and controls were observed. Figure 3 As shown, the plant height of transgenic sweet potato lines was significantly reduced compared with the wild type ( Figure 3 ). The hormone content of the plants was further measured, and the results showed that compared with the wild-type sweet potato WT, the ABA content of the transgenic sweet potato lines was significantly increased, and the GA3 content was significantly reduced (Table 1).

[0080] Table 1 Transfer IbNCED1 Determination of hormone content in genetically modified sweet potato plants and wild-type sweet potato plants

[0081]

Claims

1. A sweet potato 9-cis-epoxycarotenoid dioxygenase encoding gene IbNCED1 , characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. A method comprising the sweet potato 9-cis-epoxycarotenoid dioxygenase encoding gene as claimed in claim 1 IbNCED1 Plant overexpression recombinant vector pCAMBIA1301- IbNCED1 , characterized in that, Prepared by the following steps: 1) Double enzyme digestion reaction The plasmid pCAMBIA1301 was digested with Kpn I and Sal I at 37°C for 30 min, and the linear vector was recovered by electrophoresis and stored at -20°C for later use; the double enzyme digestion reaction system was 50 μL: pCAMBIA1301 plasmid 20 μL, 5× buffer 5 μL, Kpn I 1 μL, Sal I 1 μL, ddH2O 23 μL; 2) Recombination reaction Agarose gel electrophoresis to detect the target gene recovered after enzyme digestion IbNCED1 and vector pCAMBIA1301, add each reagent according to the ligation reaction system; the ligation reaction system is: 7 μL of linearized pCAMBIA1301 vector, 3 μL of insert fragment, 4 μL of T4 buffer, 2 μL of T4, and 20 μL of ddH2O; react at 37°C for 30 min, leave at room temperature, and transform into Escherichia coli competent Trans5α after 10 min.

3. A method comprising the sweet potato 9-cis-epoxycarotenoid dioxygenase encoding gene as claimed in claim 1 IbNCED1 of host cells.

4. A sweet potato 9-cis-epoxycarotenoid dioxygenase encoding gene as claimed in claim 1 IbNCED1 Application in regulating sweet potato strains.

5. The use according to claim 4, characterized in that: The specific method is: IbNCED1 The gene was connected to the vector and transformed into sweet potato through Agrobacterium-mediated transformation to obtain overexpressed sweet potato IbNCED1 Transgenic plants.

6. Use of the plant overexpression recombinant vector pCAMBIA1301-IbNCED1 as claimed in claim 2 in regulating the growth of sweet potato plants.

Images