An engineered exosome that can be applied to anti-calcification of autologous blood vessels and small-caliber tissue engineering blood vessels, and its preparation method and application

Abstract

The present invention relates to the technical field of tissue-engineered blood vessels, and specifically relates to an engineered exosome that can be applied to autologous blood vessels and small-caliber tissue-engineered blood vessels for anti-calcification, and a preparation method and application thereof. An engineered exosome has an E7 mesenchymal stem cell affinity peptide modified on its surface; and lncRNA-ANCR is encapsulated inside it. This engineered exosome can target Gli1+ cells in vivo and regulate their differentiation trend, and can reverse vascular calcification caused by chronic kidney disease; the small-caliber tissue-engineered blood vessels modified by it can accelerate the reconstruction of the smooth muscle layer of vascular grafts, have mechanical strength similar to that of natural blood vessels in vivo, and effectively inhibit the calcification of vascular grafts under normal and diabetic conditions by regulating the differentiation of smooth muscle progenitor cells. This solution can solve the technical problems of low efficiency of smooth muscle reconstruction in tissue-engineered blood vessels or autologous blood vessels and easy calcification of blood vessels, and at the same time meet the requirements of early cell reconstruction and long-term inhibition of calcification.

Description

Technical Field

[0001] The present invention relates to the technical field of tissue engineering blood vessels, and in particular to an engineered exosome that can be applied to the anti-calcification of autologous blood vessels and small-caliber tissue engineering blood vessels, and a preparation method and application thereof. Background Art

[0002] The morbidity and mortality of cardiovascular diseases are increasing year by year worldwide. Tissue-engineered blood vessels (TEBVs) can be used for cell reconstruction and eventually fully recellularize in vivo, making them promising candidates for vascular replacement therapy. However, after TEBV implantation, the reconstruction rate of smooth muscle cells (SMCs) is extremely slow. Smooth muscle cells are very important for maintaining the mechanical strength of blood vessels and the active response of blood vessels. In vascular grafts, with the successful reconstruction of the smooth muscle layer, the secretion of elastin provides sufficient ECM proteins; multi-layered vascular smooth muscle cells can provide contractile functions close to those of native arteries. In existing tissue-engineered vascular grafts, abnormal reconstruction of smooth muscle cells often leads to intimal hyperplasia, and the vascular media cannot be supported by smooth muscle cells of sufficient strength. The low mechanical strength of the graft will lead to the occurrence of aneurysms.

[0003] In addition, after TEBV is implanted in the body, calcification is very likely to occur. Vascular calcification is a common pathological manifestation of atherosclerosis, hypertension, diabetic vascular disease, vascular injury, chronic kidney disease and aging. It is mainly manifested by increased stiffness of the vascular wall and decreased compliance. Calcium deposition in the vascular wall and phenotypic transformation of the smooth muscle in the middle membrane will lead to reduced vascular elasticity and brittleness. Abnormal phenotypic changes in some smooth muscle cells in the vascular wall can lead to vascular calcification. It is generally believed that the differentiation of smooth muscle cells into osteoblast-like cells is considered to be the main cell source of calcification during vascular graft reconstruction, especially in vascular calcification aggravated by chronic diseases such as diabetes. Due to the calcification of TEBV, the graft failure is ultimately caused, with an incidence rate of up to 68%. There is currently no effective method to promote the reconstruction of SMCs in TEBV and resist long-term calcification in the body. At the same time, vascular calcification is also the most common complication of diabetes, chronic kidney disease, etc., because related metabolic and inflammatory factors accelerate vascular calcification.

[0004] Based on the above-mentioned obstacles encountered in the research and development of tissue engineering blood vessels, it is urgent to take effective measures to find targets that affect smooth muscle reconstruction and vascular calcification, and then develop new preparations to improve the success rate of tissue engineering blood vessel transplantation and alleviate the harm caused by vascular calcification. Summary of the invention

[0005] The present invention aims to provide an engineered exosome to solve the technical problems in the prior art that smooth muscle reconstruction efficiency of tissue engineered blood vessels (TEBV) or autologous blood vessels is low and blood vessels are prone to calcification.

[0006] In order to achieve the above object, the present invention adopts the following technical scheme:

[0007] An engineered exosome, whose surface is modified with E7 mesenchymal stem cell affinity peptide; and whose interior is encapsulated with lncRNA-ANCR.

[0008] The present technical solution also provides a method for preparing engineered exosomes, comprising the following steps performed in sequence:

[0009] S1: Construction of plasmid expressing E7-lamp2b fusion protein;

[0010] S2: using the plasmid to transfect human bone marrow mesenchymal stem cells to obtain expression cells; inducing the expression cells to secrete exosomes, and obtaining empty exosomes through separation and purification;

[0011] S3: lncRNA-ANCR was introduced into empty exosomes to obtain engineered exosomes.

[0012] This technical solution also provides an application of engineered exosomes in the preparation of tissue engineering blood vessels.

[0013] This technical solution also provides an application of engineered exosomes in the preparation of vascular calcification inhibitory drugs.

[0014] The principle and beneficial effects of this technology are:

[0015] The present technical solution provides an engineered exosome that can be applied to the anti-calcification of autologous blood vessels and small-caliber tissue engineering blood vessels. The exosomes are prepared by the following method: the gene sequence of the mesenchymal stem cell affinity peptide E7 is directionally inserted into the gene sequence of the exosome membrane protein lamp2b to obtain a fusion protein expression vector. The prepared fusion protein vector and packaging plasmid are introduced into HuBM-MSCs by transfection, and the expression is induced to obtain exosomes. Then, the long-chain non-coding RNA-ANCR is loaded into the E7 exosomes obtained above by electrotransfection, and finally the engineered exosomes ANCR / E7-EXO are obtained. The engineered exosomes ANCR / E7-EXO can target Gli1 + Cells, inhibit their osteogenic differentiation and promote the formation of smooth muscle cells in the vascular media. Using engineered exosomes to treat tissue-engineered blood vessels can effectively promote the successful transplantation of tissue-engineered blood vessels. Using engineered exosomes to administer to organisms can effectively avoid the occurrence of vascular calcification.

[0016] Gli1 +Cells are key targets for vascular calcification and smooth muscle cell reconstruction, which was first discovered and proposed by the inventor in this patent scheme. Vascular calcification has long been a factor that threatens human health and affects the success rate of tissue engineering vascular transplantation. Its occurrence and development mechanism and its key targets have not been reported in the prior art. Mesenchymal stromal cells (MSCs) are a type of pericyte located in the perivascular niches of multiple human organs. As a reservoir of primitive progenitor cells, they may be involved in vascular calcification and vascular cartilage metaplasia. Gli1 is one of the specific selective markers of vascular MSCs. + The cells expressed typical MSC and osteoblast markers and had tri-lineage differentiation capacity. + Cells are a subpopulation of MSCs around blood vessels. Studies have found that in chronic vascular damage or diabetes, Gli1 + Differentiation of Gli1 cells into osteoblast-like cells is responsible for calcification of the vascular media and intima. + Differentiation of cells into osteoblast-like cells and promotion of their differentiation into SMCs may be the key targets for inhibiting vascular calcification and promoting smooth muscle reconstruction in TEBV.

[0017] In summary, the engineered exosomes obtained by the present invention can target Gli1 in vivo + The modified small-caliber tissue-engineered blood vessels can accelerate the reconstruction of the smooth muscle layer of vascular grafts, have mechanical strength similar to that of natural blood vessels in vivo, and effectively inhibit the calcification of vascular grafts in normal and diabetic conditions by regulating the differentiation of smooth muscle progenitor cells.

[0018] Furthermore, the gene sequence of the E7-lamp2b fusion protein is shown in SEQ ID NO.3; the gene sequence of lncRNA-ANCR is shown in SEQ ID NO.1.

[0019] Using the above technical scheme, long noncoding RNA (Lnc-RNA) regulates the expression of protein-coding genes at the transcriptional and post-transcriptional levels and plays an important role in the regulation of growth, development and cell differentiation. During the differentiation of human osteoblasts, the expression of lncRNA-ANCR inhibits osteoblast differentiation by recruiting the enhancer EZH2 (18). Both in vitro and in vivo experiments have shown that silencing lncRNA-ANCR promotes osteoblast osteogenesis. The prior art has not reported whether ANCR also regulates Gli1 + This technical scheme applies lncRNA-ANCR to Gli1 + In the regulation of osteogenic differentiation of cells, it effectively promotes smooth muscle reconstruction and inhibits vascular calcification.

[0020] E7 peptide to Gli1 + Cells have a special affinity for Gli1 + Cell homing. Therefore, the constructed E7 vector was introduced into human bone marrow mesenchymal stem cells (HuBM-MSCs), and ANCR was introduced into HuBM-MSCs-derived E7-EXO by electroporation to construct engineered exosomes-ANCR / E7-EXO, which can effectively target Gli1 + cells to achieve the desired effect.

[0021] Furthermore, in SS1, the blood vessels are cleaned to remove blood, and the vascular adventitia and connective tissue are stripped to obtain the vascular matrix; in SS2, the engineered exosomes are stained: the engineered exosomes are stained with PKH67.

[0022] Furthermore, the tissue engineered blood vessel is used to prepare a tissue engineered blood vessel for use by diabetic patients. See Example 2 for details of the in vivo experimental data.

[0023] Furthermore, the vascular calcification is caused by chronic kidney disease. See Example 3 for details of the in vivo experimental data.

[0024] Furthermore, the engineered exosomes are used for smooth muscle cell reconstruction after tissue engineering blood vessel transplantation and for inhibiting calcification of tissue engineering blood vessels.

[0025] Furthermore, the engineered exosomes are used to inhibit Gli1 + Osteogenic differentiation of cells and promotion of Gli1 + Differentiation of cells into smooth muscle cells.

[0026] In summary, the beneficial effects of this technical solution are:

[0027] Exosomes have shown improved safety and efficacy in regenerative medicine and are promising nanoscale vesicles for the transport of drugs and nucleic acids. In a rat model of chronic kidney disease, aortic calcification was reversed by ANCR / E7-EXO. ANCR / E7-EXO was modified on TEBV by electrostatic self-assembly to regulate Gli1 + The cells differentiate into contractile SMCs in a high-glucose environment, inhibiting their osteogenic differentiation, promoting SMC reconstruction of TEBV, and effectively inhibiting calcification after TEBV transplantation. The beneficial effects of this scheme are:

[0028] (1) The small-caliber tissue-engineered blood vessels of the present invention have mechanical properties similar to those of natural blood vessels. The cross-linked engineered exosomes can effectively promote the early reconstruction of the vascular smooth muscle layer and inhibit the expression of Gli1 +Osteogenic differentiation of mesenchymal stem cells; small-caliber tissue-engineered blood vessels modified with engineered exosomes can effectively inhibit calcification after transplantation. This tissue-engineered blood vessel has good application prospects in the field of clinical vascular transplantation.

[0029] (2) Compared with the small-caliber tissue engineering blood vessels of the prior art, the present invention simplifies the preparation of the decellularized vascular matrix. Trypsin is used as a highly efficient decellularization agent, which removes vascular cell components by controlling time and temperature with little effect on the extracellular matrix.

[0030] (3) Stem cell-derived exosomes are a very promising cell-free therapy in regenerative medicine. They can secrete cytokines to play a role in the repair of vascular damage. At the same time, exosomes are an effective and safe nano-delivery platform that can deliver drugs and nucleic acids during disease damage. The E7 polypeptide has affinity for mesenchymal stem cells both in vitro and in vivo and can promote the homing of mesenchymal stem cells. IncRNA-ANCR can inhibit the differentiation of osteoblasts. Therefore, the ANCR / E7-EXO we designed can promote Gli1 in vivo. + Cell homing and inhibition of Gli1 + Differentiation of cells into osteoblast-like cells in pathological conditions such as chronic kidney disease and diabetes.

[0031] (4) The engineered exosomes constructed by the present invention not only exert the therapeutic properties of the exosomes themselves, but also target and regulate specific cells, greatly improving the treatment efficiency and effect, and overcoming the technical bottlenecks of the prior art. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is the preparation process and use of ANCR / E7-EXO of Example 1.

[0033] Figure 2 This is a map of the plasmid expressing the E7-lamp2b fusion protein in Example 1.

[0034] Figure 3 This is a map of the pEX-3 plasmid used to integrate the lncRNA-ANCR gene sequence in Example 1.

[0035] Figure 4 This is a scanning electron microscope image of the exosomes and engineered exosomes of Example 1.

[0036] Figure 5 The particle size analysis results of the exosomes and engineered exosomes in Example 1.

[0037] Figure 6 This is the WB image of the exosomes and engineered exosomes in Example 1.

[0038] Figure 7 This is a fluorescent image of the distribution of exosomes in the exosome-modified blood vessels of Example 1.

[0039] Figure 8 Fluorescence images showing the effects of different modification methods on the distribution of exosomes in blood vessels in Example 1.

[0040] Fig. 9 This is a histological staining image of a cross section of a small-caliber tissue-engineered blood vessel in Example 2 at eight weeks after transplantation.

[0041] Fig.10 This is the immunofluorescence staining of smooth muscle cells on the section of the small-caliber tissue-engineered blood vessel in Example 2 at six weeks after transplantation.

[0042] Fig.11 This is the immunofluorescence staining of the cross-section of the small-caliber tissue-engineered blood vessel of Example 2 at eight weeks after transplantation.

[0043] Fig.12 This is a statistical graph of immunofluorescence staining of the small-caliber tissue engineering blood vessel section at eight weeks after transplantation in Example 2 (mean±SD, n=5; * indicates p<0.05; ** indicates p<0.01; *** indicates p<0.001; significance test method: two-sided t-test).

[0044] Fig.13 The calcification of TEBV was observed at different time points after the common decellularized vascular matrix of Example 2 (not modified with engineered exosomes) was transplanted into normal rats and diabetic rats (Alizarin red and calcium salt staining).

[0045] Fig.14 The common decellularized vascular matrix of Example 2 (not modified with engineered exosomes) was transplanted into normal rats and diabetic rats at different time points. + Observation results of cell distribution (scale: 20 μm for the whole image, 100 μm for the enlarged image; statistical form of data: mean ± SD, n = 3; * indicates p < 0.05; ** indicates p < 0.01; *** indicates p < 0.001; **** indicates p < 0.0001; significance test method: two-sided t test).

[0046] Fig.15 The atomic force microscopy imaging and Young's modulus test results of the vascular graft of Example 2 at eight weeks after transplantation (mean±SD, n=5; * indicates p<0.05; significance test method: two-sided t-test).

[0047] Fig.16 These are the experimental results of carotid artery ultrasound and Micro-CT at the eighth week after transplantation in Example 2.

[0048] Fig.17 The in vivo fluorescence of the aorta of the CKD rats in Example 3 after 13 weeks of treatment and the statistical graph (mean±SD, n=3; * indicates p<0.05; significance test method: two-sided t-test).

[0049] Fig.18 This is the immunofluorescence of the aorta section of the CKD rats in Example 3 after treatment for 13 weeks.

[0050] Fig.19 This is the immunofluorescence statistical diagram of the aorta section of the CKD rats in Example 3 after 13 weeks of treatment (showing Gli1 in the media layer). + The number of cells co-localized with α-SMA or OPN; mean±SD, n=4; * indicates p<0.05; ** indicates p<0.01; *** indicates p<0.001; **** indicates p<0.0001; significance test method: two-sided t test). DETAILED DESCRIPTION

[0051] The present invention is further described in detail below in conjunction with examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the technical means used in the following examples and experimental examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used can be obtained from commercial sources.

[0052] Example 1: Preparation of engineered exosome-modified tissue engineered blood vessels (TEBV)

[0053] (I) Preparation of tissue-engineered blood vessels modified with engineered exosomes

[0054] The tissue-engineered blood vessels of this embodiment are taken from SD rats, and vascular matrix and decellularized vascular matrix are prepared. Then, the decellularized vascular matrix is ​​modified with engineered exosomes to obtain engineered exosome-modified tissue-engineered blood vessels. The tissue-engineered blood vessels are transplanted into the carotid arteries of rats for experimental research, which proves that the tissue-engineered blood vessels of this technical solution have an ideal anti-calcification effect. The specific preparation method is as follows:

[0055] (1) Preparation of vascular matrix: Carefully dissect the neck of a 250g SD rat under sterile conditions, fully separate the common carotid artery from the vagus nerve, remove the carotid artery, and immediately place it in PBS at 4°C. Use PBS to thoroughly rinse the remaining blood in the vascular cavity, and use sterile surgical instruments to peel off the vascular adventitia and its connective tissue. Avoid clamping and damaging the vascular matrix during the process. The obtained vascular matrix is ​​temporarily stored in PBS at 4°C. This technical solution uses ex vivo blood vessels to prepare tissue engineering blood vessels and does not involve surgical procedures. The raw materials for blood vessels used in the preparation of tissue engineering blood vessels can come from different animals or humans in order to obtain the cell skeleton-free part of the blood vessel. It has a wide source and can be industrialized. This technical solution specifically uses rat-derived blood vessels for illustration.

[0056] (2) Preparation of decellularized vascular matrix: The vascular matrix obtained in step (1) was placed in a trypsin diluent (20% trypsin) prepared by a volume ratio of 1:4 of trypsin and PBS, and after shaking and digesting at 4°C for 2 hours, the blood vessels were removed and washed with 4°C physiological saline for 1 hour to obtain decellularized vascular matrix. The decellularized vascular matrix process was carried out in a sterile environment. The obtained decellularized vascular matrix was temporarily stored in PBS at 4°C.

[0057] (3) Preparation of engineered exosomes:

[0058] (3.1) Preparation of HuBM-MSCs transfected with a plasmid expressing E7-lamp2b fusion protein

[0059] By conventional means of the prior art, the plasmid expressing the E7-lamp2b fusion protein is introduced into HuBM-MSCs (human bone marrow mesenchymal stem cells) using EntransterTM-H4000 transfection agent (Engreen). The specific process is as follows: HuBM-MSCs are planted in a 24-well plate one day before transfection, and cell culture is carried out using α-MEM complete medium containing 10% FBS, with the cell density at the time of transfection being preferably about 60%. 0.8 μg of the plasmid of the E7-lamp2b fusion protein is fully mixed with 25 μl of α-MEM medium to prepare a nucleic acid diluent. 2 μl of EntransterTM-H4000 is diluted with 25 μl of α-MEM medium, and fully mixed to prepare an EntransterTM-H4000 diluent. After standing at room temperature for 5 minutes, the EntransterTM-H4000 diluent is added to the nucleic acid diluent, fully mixed, and standing at room temperature for 15 minutes, and the transfection complex is prepared. Add the transfection complex to the culture container containing HuBM-MSCs and α-MEM complete medium with 10% FBS, mix gently, and place in the incubator for culture. Observe after 4-6 hours. If the cells have no adverse conditions such as toxicity, continue to culture, and DNA expression can be detected after 24-48 hours. Through the above process, HuBM-MSCs transfected with a plasmid expressing E7-lamp2b fusion protein are obtained.

[0060] (3.2) Preparation of engineered exosomes (ANCR / E7-EXO)

[0061] The transgenic HuBM-MSCs were then cultured in α-modified basic culture medium (α-MEM) at 37°C and a humid environment with 5% carbon dioxide for 48 hours, and the HuBM-MSCs supernatant was taken. The α-modified basic culture medium also contains 10% exosome-free fetal bovine serum (BI) and 2% penicillin-streptomycin. The collected cell supernatant was filtered using a 0.22 μm filter to remove residual cell debris. Exosomes were obtained by ultracentrifugation at 110,000g for 120 minutes at 4°C using an ultrahigh-speed centrifuge. The obtained exosomes were loaded with long-chain non-coding RNA-ANCR onto the exosomes using conventional electrofection methods in the prior art to obtain engineered exosomes (ANCR / E7-EXO). The preparation process of ANCR / E7-EXO is detailed in Figure 1 A, its use is detailed in Figure 1 B and Figure 1 C.

[0062] Among them, the specific process of electrotransfection is: a total of 25g of the prepared exosomes and 25g of ANCR plasmid are gently mixed in 100μl electroporation buffer to load the exosomes prepared in step (2) with the ANCR plasmid. Electroporation is performed on an electroporation tube at 100V and 50uF using a Gene PulserII electroporator (Bio-Rad, USA). After electroporation, the mixture is immediately placed at 37°C for 30 minutes to fully restore the exosome membrane, i.e., to obtain engineered exosomes. The complete engineered exosome membrane is confirmed by TEM, and the ANCR / E7-exosomes are washed twice with PBS and centrifuged at 100,000×g for 70 minutes to remove the ANCR plasmid that is not incorporated into the exosomes.

[0063] (3.3) Sequence information and related plasmid information

[0064] Among them, the coding gene sequence of long non-coding RNA-ANCR is shown as SEQ ID NO.1; the gene sequence of mesenchymal stem cell affinity peptide E7 is shown as SEQ ID NO.2; the NCBI reception number of the gene sequence of lamp2b protein is: NM_017068.2 (see website: https: / / www.ncbi.nlm.nih.gov / nucleotide / NM_017068.2); the gene sequence of E7-lamp2b fusion protein is shown as SEQ ID NO.3.

[0065] SEQ ID NO.1 (lncRNA-ANCR, 5'→3'):

[0066] GTTGCGGTCGACCCACCGGAACCGATCTCCACTGCCCAAGCTGTGCTGCTGCTGCCTCGGATAGAAGCGCAGGTTGAAAACTGCGGGAAAGAAACTCGCGAGCTGAATGGCTCCAAGGTGAAGTAGTCGCACATTTAATGACCCCGCTTGCCTGGATCCCACCCTAGGCTTAGTGAACTGAAGTAGGTGAAGTCCATTTTACAGATTGAGATTGGGGGCCATGTGAGAGTATCCTTGAATGGCCTTGAAGTAATTGATTAAACTGAAGGTAATTTCCTAAAATTTTTACCAAGGTACTAGGATCCGGTCTCCCCCCAACCCCTTCTCTATTTCTGGGTGTCCTGGAATCAGATCCACCTGACTATGACATGGGGTTTTAAAGGTGCAAACAGGGTATTTTAAGGATGTTCATGCTAGATCGTTAGAATGTTTGAATCTGGCCTGCGTGTTTGGACAAGTTCTTTGCTAGTAGGTCATGTGCTGGTAGTCACCGTGTTTTAACTTGTACATTGTTTCCCATGAGTAATTTTCCATAATCTTCAATAAAGGCTTTTCCTATGTCAATTCCA;

[0067] SEQ ID NO.2 (E7, 5’→3’): GAACCTCTGCAGCTGAAAATG;

[0068] SEQ ID NO.3 (E7-lamp2b, 5’→3’, underlined shows the position of E7):

[0069] ATGTGCCTCTCTCCGGTTAAAGGCGCAAAGCTCATCCTGATCTTTCTGTTCCTAGGAGCCGTTCAGTCCAATGCATTGATAGTTAATTTGACAGATTCAAAGGGTACTTGCCTTTATGCTCGA GAACCTCTGCAGCTGAAAATG

[0070] Plasmid expressing E7-lamp2b fusion protein (see Figure 2 ) was commissioned to a third party company, the basic plasmid used was: pEGFP-C1, SEQ ID NO.3 (E7-lamp2b gene sequence) was integrated into the multiple cloning site of pEGFP-C1 by conventional means of the prior art, and the restriction sites used were: NheI / EcoRI.

[0071] The ANCR plasmid was commissioned by a third party company, and the basic plasmid used was: pEX-3 (pGCMV / MCS / Neo, Shanghai Jima Pharmaceutical Technology Co., Ltd., Figure 3 ), SEQ ID NO.1 (lncRNA-ANCR gene sequence) was integrated into the multiple cloning site of pEX-3 by conventional means in the prior art, and the restriction sites used were: XhoI / EcoRI.

[0072] (4) Preparation of engineered exosome-modified decellularized vascular matrix:

[0073] First, the process of staining the engineered exosomes with PKH67 was as follows: PKH67 was diluted with 1 ml PBS at a ratio of 1:200 (mass ratio), 25 μg / μl 500 μg engineered exosomes were centrifuged at 100,000 × g for 70 minutes, and the supernatant was removed. 1 ml PKH67 dilution was added to the centrifuged engineered exosomes for staining for 20 minutes, and then the engineered exosomes were centrifuged at 100,000 × g for 70 minutes to remove the stain, and the engineered exosomes stained with PKH67 were obtained after resuspending in sterile PBS. The decellularized vascular matrix prepared in step (2) was placed in a 4 mg / ml collagen solution and incubated for 24 h. After rinsing twice with PBS, 200 μl 0.1 M EDC (carbodiimide), 200 ul 0.7 M NHS (N-hydroxysuccinimide) and 500 μg of stained engineered exosomes were incubated in 1 ml sterile PBS at 4 ° C for 48 hours. After the incubation was completed, the engineered exosome-modified decellularized vascular matrix was washed once with PBS. The obtained engineered exosome-modified decellularized vascular matrix was temporarily stored in 4 ° C PBS. ANCR / E7-EXO-modified TEBV was obtained through this step.

[0074] (5) Rat carotid artery transplantation: Male SD rats (230-250g) were intraperitoneally injected with 40mg / kg of 1% sodium pentobarbital. After the rats were anesthetized, the skin, subcutaneous tissue, and muscle layer were cut along the trachea in turn to expose and free the carotid artery. The two ends of the common carotid artery on one side were separated with forceps, blocked with an artery clamp, and cut from the middle. The broken ends of the carotid artery were clamped out and turned over in a homemade cannula. The two ends of the engineered exosome-modified decellularized vascular matrix (1cm long, 1mm diameter, soaked in 50U / mL sodium heparin) prepared in step (4) were anastomosed with the ends of the carotid artery. The vascular sutures were ligated at the anastomosis and the vascular clamps were loosened (6 rats per group).

[0075] (II) Detection and characterization of exosomes and tissue-engineered blood vessels

[0076] (1) Detection of engineered exosomes

[0077] Scanning electron microscopy: MSC-EXO and ANCR / E7-EXO were observed using a Hitachi scanning electron microscope. MSC-EXO refers to exosomes secreted by HuBM-MSCs that were not transfected with a plasmid expressing the E7-lamp2b fusion protein.

[0078] Particle size analysis: The size of ANCR / E7-EXO nanoparticles and MSC-EXO was analyzed using a NanoFCM particle size analyzer.

[0079] WB detection: Total protein was extracted from HuBM-MSCs and exosomes using RIPA lysis buffer, and the concentration was determined by BCA assay (Beyotime). Proteins were separated by electrophoresis and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were incubated with the following primary antibodies: rabbit anti-Lamp-2b antibody (1:400, Santa Cruz); rabbit anti-CD63 antibody (1:500, Bioss); overnight at 4°C, followed by incubation with the corresponding secondary antibodies for 2 hours at room temperature. The blots were observed by enhanced chemiluminescence (GelDoc 2000 gel imaging system, BIO-RAD). It was found that the engineered exosome membrane proteins CD63 and Lamp-2b were positively expressed.

[0080] (2) Morphological observation of tissue-engineered blood vessels modified with engineered exosomes

[0081] Small-caliber tissue-engineered blood vessels were frozen sections with a thickness of 10-20 μm, sealed with anti-fading sealing agents, and observed under a laser scanning confocal microscope. Quantitative statistics of fluorescence images were analyzed using ImageJ software.

[0082] (3) In vivo imaging:

[0083] The decellularized vascular matrix was placed in a 4 mg / ml collagen solution and incubated for 24 h. After rinsing twice with PBS, the engineered exosomes stained with 0.1 M EDC, 0.7 M NHS and 25 μg / μl 500 μg DIR fluorescent probe were incubated in sterile PBS at 4 ° C for 48 h and washed with PBS. The obtained DIR fluorescent probe-labeled ANCR / E7-EXO-modified TEBV was implanted into the carotid artery of rats.

[0084] (III) Test results

[0085] (1) Detection of engineered exosomes

[0086] Electron Microscope: Scanning electron microscope shows as shown in the attached Figure 4 As shown, the engineered exosomes have typical exosome cup-shaped and saucer-like structures, and are similar in morphology and size to MSC-derived exosomes.

[0087] Particle size analysis: Particle size analysis results are as attached Figure 5 It was shown that the size of ANCR / E7-EXO nanoparticles was similar to that of MSC-EXO, with a particle size distribution in the range of ( ) and a peak value of 136 nm.

[0088] WB test: as attached Figure 6 As shown, the exosome surface markers CD63 and Lamp-2b were positively expressed on the surface of the engineered exosome membrane.

[0089] (2) Morphological observation of tissue-engineered blood vessels modified with engineered exosomes

[0090] Fluorescence microscope: as attached Figure 7 and 8 It is shown that Accelular refers to decellularized vascular matrix without treatment with exosomes or other reagents. Figure 8 The effects of EDC / NHS+PEI / AuNP on ANCR / E7-EXO-modified TEBV and EDC / NHS on ANCR / E7-EXO-modified TEBV were compared. The test results showed that the EDC / NHS self-assembly strategy cross-linked as many ANCR / E7-EXO as possible to TEBV, thereby constructing ANCR / E7-EXO-modified TEBV. After labeling ANCR / E7-EXO with PKH67, a large amount of ANCR / E7-EXO was present in the middle and outer membranes of the engineered exosome-modified TEBV compared with the decellularized vascular matrix without considering the autofluorescence of the blood vessels. This result shows that this simple self-assembly strategy successfully modified ANCR / E7-EXO onto TEBV.

[0091] Among them, the specific process of using EDC / NHS+PEI / AuNP method to achieve ANCR / E7-EXO modification of TEBV is as follows:

[0092] The prepared decellularized vascular matrix was placed in a 4mg / ml collagen solution and incubated for 24h. After rinsing with PBS twice, it was soaked in 4ml sterile PBS. 200μl 0.1M EDC (carbodiimide), 200μl 0.7M NHS (N-hydroxysuccinimide), 500μg of stained engineered exosomes and 160μg PEI / AuNP were added to the decellularized vascular matrix and mixed well, then ultrasonicated for 30s. The engineered exosome-modified decellularized vascular matrix was washed with PBS. The obtained engineered exosome-modified decellularized vascular matrix was temporarily stored in PBS at 4°C. Among them, PEI / AuNP was obtained by the following method: PEI / AuNP was synthesized by a one-step method, 1.44mL of 1% PEI solution was added to 25mL of 28×10 -3 m HAuCl4 aqueous solution and stirred at room temperature for 24 h to form PEI / AuNPs. Afterwards, the mixture was centrifuged at 20000g for 10 min at 4°C, washed three times with distilled water, and freeze-dried.

[0093] (3) In vivo imaging of tissue-engineered blood vessels modified with engineered exosomes after transplantation

[0094] The fluorescence intensity of the rat neck was observed weekly from 1 to 6 weeks after implantation. The monitoring results showed that the fluorescence intensity of the rat carotid artery gradually weakened, and at the sixth week, the ANCR / E7-EXO retention signal in the neck could still maintain a certain intensity. This shows that after transplantation, under the flushing of high-speed blood flow in the carotid artery, the engineered exosomes can still remain in situ in the body for more than 6 weeks, thus providing sufficient time for the reconstruction of the vascular smooth muscle layer and the inhibition of long-term calcification.

[0095] Example 2: Performance study of ANCR / E7-EXO modified TEBV prepared in Example 1 (see schematic diagram Figure 1 B)

[0096] 1. Establishment of diabetic rat model

[0097] Referring to (1)-(5) of "(i) Preparation of engineered exosome-modified tissue-engineered blood vessels" in Example 1, ANCR / E7-EXO-modified TEBVs were prepared and transplanted into rats. After transplantation, Doppler ultrasound was performed every two weeks after surgery to detect vascular patency. After six and eight weeks after surgery, the rats were euthanized and the transplanted blood vessels were removed for observation under ordinary optical microscope, fluorescence microscope and atomic force microscope. A diabetic rat model was established using the transplanted rats for experimental observation. The general process of modeling was as follows: After the operation described in step (5), the rats were intraperitoneally injected with streptozotocin for 7 consecutive days to establish a diabetic rat model.

[0098] (II) Detection method

[0099] (1) Morphological examination of blood vessels

[0100] HE staining: paraffin sections were dewaxed to water: the sections were placed in an oven for 1 hour, xylene I for 20 minutes, xylene II for 20 minutes, 100% ethanol I, 100% anhydrous ethanol II, 95%, 85%, 75%, distilled water, PBS ethanol gradient dehydration for 5 minutes each. Hematoxylin staining for 3-5 minutes, tap water washing for 1 minute, under the microscope if the cytoplasm appears very deep blue, then use 0.5% hydrochloric acid ethanol to wash for 10 seconds, tap water washing again for 10 minutes, 70%, 80%, 90% ethanol soaked for 2 minutes in turn, red staining for 6 minutes, 100% ethanol soaked for 1.5 minutes, slightly dried surface ethanol, then immersed in xylene for 10 minutes, and sealed with neutral gum.

[0101] Immunofluorescence staining: After paraffin sections were dewaxed to water, tissue sections were permeabilized with 0.5% Triton X-100, then boiled and repaired with 0.5% 40X antigen repair solution for 20 minutes, and blocked with 10% goat serum for 2 hours. a-SMA primary antibody, Gli primary antibody, thrombospondin primary antibody, Runx2 primary antibody, and osteopontin (OPN) primary antibody were diluted with primary antibody diluent at a ratio of 1:200 and incubated with tissues at 4°C overnight, and washed three times with PBS. Subsequently, fluorescently labeled secondary antibodies were used for incubation at room temperature in the dark for 2 hours, and washed 5 times with PBS. The sections were sealed with anti-fading mounting medium containing DAPI and observed under a laser scanning confocal microscope. Quantitative statistics of fluorescence images were analyzed using ImageJ software.

[0102] Atomic force microscopy: A section of transplanted blood vessels removed from the neck of rats was directly embedded in OCT and sliced ​​at a thickness of 40 μm. Immediately after slicing, the machine was tested, and the atomic force microscope (AFM) (JPK NanowizardNanoOptics, Germany) was used to measure the vascular stiffness and scan the vascular medium. The optical microscope (Eclipse-Ti-S, Nikon, Japan) combined with the AFM can control the positioning of the tip and the sample. All measurements were performed using the same soft cantilever (MLCT Bio, Bruker, nominal spring constant 0.01 N / m). Four areas were measured for each blood vessel, top, bottom, left and right. Each area was measured 50-60 times, and then the average Young's modulus was calculated. After the measurement, the surface of the blood vessel was scanned within a 30 μm area.

[0103] (2) Vascular patency testing

[0104] Doppler ultrasound: 1% sodium pentobarbital was used to anesthetize rats after TEBV transplantation in each group. The rats were fixed on the mouse board in supine position. After skin preparation, ultrasound gel was evenly applied. The color Doppler ultrasound instrument was first set to a frequency of 13.0 MHz, a depth of 2.5 cm, a mechanical index of M10.4, and a grayscale of 46. The probe was placed close to the rat skin so that its long side was perpendicular to the rat's common carotid artery. The angle and direction of the probe were adjusted to find the red and blue dots that were regularly enlarged and reduced. The red dots were positive blood flow toward the probe, and the blue dots were blood flow away from the probe. Several cardiac cycles were observed continuously, and the Doppler mode was clicked to obtain the common carotid artery ultrasound spectrum and save the image to analyze the carotid blood flow velocity.

[0105] Micro-CT: After anesthetizing the rats, the rat chest cavity was opened and 5 ml of 300 mg / ml vascular contrast agent iohexol was injected into the left ventricle. The patency of TEBV in each group was characterized using a Bruker micro-CT instrument for small animal carotid arteries.

[0106] (III) Test results

[0107] (1) Results of vascular morphology test

[0108] The rats were divided into 4 groups according to the type of TEBV and whether the diabetic model was established after transplantation:

[0109] Group 1: Normal acellular vascular matrix transplanted in normal rats (N-TEBV);

[0110] Group 2: conventional acellular vascular matrix transplanted in diabetic rats (D-TEBV);

[0111] Group 3: ANCR / E7-EXO modified acellular vascular matrix transplanted in normal rats (N-TEBV-ANCR / E7-EXO);

[0112] Group 4: ANCR / E7-EXO modified acellular vascular matrix transplantation in diabetic rats (D-TEBV-ANCR / E7-EXO).

[0113] The experimental results of HE staining, Masson staining, Alizarin red staining and Von Kossa staining are as follows:

[0114] At the eighth week after transplantation, the transplanted blood vessels harvested from each group were rinsed with physiological saline, fixed with 4% paraformaldehyde, embedded in paraffin, and cut into 5-micron thick sections. The paraffin sections were stained with hematoxylin-eosin (H&E), Masson's trichrome, Von Kossa, and alizarin red, and the images were observed under a Japanese Olympus VS200 bright field microscope. Fig. 9 As shown, HE staining showed that the first and second groups had severe intimal hyperplasia and luminal stenosis, while the third and fourth groups had better vascular morphology and cell reconstruction. The results of Masson staining showed that the third and fourth groups had less collagen fiber deposition during cell regeneration. Alizarin red and Von Kossa staining showed that the first and second groups had severe vascular calcification in the intima and media, while the third and fourth groups had no visible calcification.

[0115] The results of immunofluorescence staining are as follows:

[0116] At the sixth week after transplantation, the transplanted blood vessels harvested from each group were rinsed with normal saline, fixed with 4% paraformaldehyde, embedded in paraffin, and cut into 5-micron thick sections. The paraffin sections were dewaxed. After washing twice with PBS, they were permeabilized and blocked with 0.05% TritonX-100 (Solarbio, 30 min, room temperature) and 10% goat serum (Solarbio, 40 min, 37°C) in PBS, respectively. The samples were then incubated with antibodies overnight at 4°C. The primary antibody used was mouse anti-α-SMA (Boster, 1:300), and the secondary antibody was Alexa Fluor 488-conjugated antibody. Staining with DAPI was performed for 5 min at room temperature. As shown in the attached Fig.10As shown in the figure (A is the adventitia, M is the media, and I is the intima; from left to right are the first, second, third, and fourth groups), the expression of α-SMA (α-smooth muscle actin) in the tunica media of the transplanted blood vessels in groups 3 and 4 was significantly higher than that in groups 1 and 2. In the diabetic rat model, the number of contractile smooth muscle cells in the tunica media of the transplanted blood vessels in group 4 was 17.13 times that of group 2. This indicates that ANCR / E7-EXO promotes the rapid remodeling of the vascular smooth muscle layer in vascular grafts.

[0117] In the eighth week after transplantation, Fig.11 (Typical images of fluorescent staining) and Fig.12 (Statistics of the number of cells expressing specific proteins in the tunica media of transplanted blood vessels) shows that the number of α-SMA-positive cells in the tunica media of the transplanted blood vessels in groups 3 and 4 was 53.92 and 8.38 times that of groups 1 and 2, respectively, while the number of thrombospondin + The number of cells decreased by 8.14% and 24.92% compared with group 1 and group 2, respectively. OPN and Runx2 staining were used to observe the inhibitory effect of ANCR / E7-EXO on vascular calcification. Immunofluorescence staining showed that Gli1 + Cells and OPN colocalized more in groups 1 and 2, but there was almost no Gli1 in groups 3 and 4. + Cells and OPN signals. The Runx2 fluorescence intensity of group 1 and group 2 was 12.86 times and 4.22 times that of group 3 and group 4, respectively.

[0118] The inventors found that Gli1 + Cells are key targets for tissue engineering blood vessels that are prone to calcification, and by inhibiting Gli1 + Osteogenic differentiation of cells can effectively alleviate vascular calcification. TEBV is prone to calcification after implantation, and calcification is accelerated under high glucose conditions. First, TEBV was stained with Alizarin Red and Von Kossa at different times after TEBV implantation in normal and diabetic rats. The staining showed that calcified nodules were visible in both groups, and full-thickness calcification occurred in diabetic rats, with severe luminal stenosis at 6 weeks ( Fig.13 At different time points after TEBV transplantation, alizarin red and calcium salt staining revealed that TEBV in the normal group and the diabetic group had varying degrees of calcification). The results showed that TEBV is prone to calcification regardless of normal or pathological conditions. + Cells exist in the adventitia of arteries. It is unclear whether they can dedifferentiate into osteoblasts under pathological conditions in TEBV. + There is no prior art report on whether Gli1 is related to TEBV calcification or whether it is a key factor in TEBV calcification. +Spatial distribution of cells at each time point after TEBV implantation. + The number of cells increased over time, but the TEBV calcification was more serious in the diabetic group than in the normal group. + More cells ( Fig.14 , GLi1 was found at different time points after TEBV transplantation + It is positively correlated with TEBV calcification. In the early stage of TEBV transplantation, there is a large amount of GLi1 + express OPN). Fig.14 A shows the Gli1 in the cross-section of TEBV in each group at different time points after TEBV implantation. + Immunofluorescence staining (DAPI, blue; Gli1 + , red). The white dotted lines in A show the vascular adventitia, media, and intima separately (scale bar: 20 μm for the whole image, 100 μm for the enlarged image). BE represents the total Gli1 in TEBVs + Cell number and Gli1 in the inner, middle and outer membranes + F and H represent the cross-section of TEBV in each group after TEBV implantation. + Co-localization immunofluorescence staining of Gli1 and OPN (osteopontin) (DAPI, blue; + red; OPN, green). G and I indicate Gli1 in cross-sectioned TEBVs + The results showed that: at 14 days, Gli1 + The total number of cells was about 2.65 times that of the normal group. + The number of cells still showed a similar trend. + The number of cells was 1.38 times that of the normal group, and the diabetic group had a higher expression of Gli1 in the intima of TEBV. + The number of cells in the TEBV outer membrane was about 4 times that of the normal group. We also observed that there were more Gli1 + The co-expression of Gli1 and osteopontin (OPN) signals in TEBV increased with the development of diabetes. + The temporal and spatial distribution of cells is positively correlated with the degree of TEBV calcification. +Gli1 cells may be the main cell source of TEBV calcification. Before this study, it was not clear which factors were related to TEBV calcification, which made the problem of TEBV calcification difficult to solve. It is an important technical contribution of this study to clarify that TEBV calcification is related to specific cells. In addition, there are many cells in the human body with osteogenic differentiation potential, but previous reports did not mention which specific cells are related to TEBV calcification. This technical solution discovered for the first time that Gli1 + Cells are the key targets of TEBV calcification, creating conditions for improving the transplantation effect of TEBV.

[0119] This technical solution uses ANCR / E7-EXO to modify TEBV, and E7-EXO targets Gli1 + Cells, ANCR achieves Gli1 + Inhibition of osteogenic differentiation of cells. ANCR / E7-EXO promotes Gli1 in vivo + Cell homing and inhibition of Gli1 + Cells differentiate into osteoblast-like cells under pathological conditions such as chronic kidney disease and diabetes. In addition, ANCR / E7-EXO-modified TEBV also promoted the expression of α-SMA (α-smooth muscle actin), that is, promoted the proliferation of smooth muscle cells in the middle membrane. Smooth muscle cells are very important for maintaining the mechanical strength of blood vessels and the active response of blood vessels. In vascular grafts, with the successful reconstruction of the smooth muscle layer, the secretion of elastin provides sufficient ECM proteins; multi-layered vascular smooth muscle cells can provide contraction functions close to those of native arteries. In existing tissue-engineered vascular grafts, abnormal reconstruction of smooth muscle cells often leads to intimal hyperplasia, and the vascular middle membrane cannot be supported by smooth muscle cells of sufficient strength. The low mechanical strength of the graft will lead to the occurrence of aneurysms.

[0120] The results of atomic force microscopy observations are as follows:

[0121] At 8 weeks after transplantation, the grafted blood vessels harvested from each group were rinsed with saline, embedded in cryogen, cut into 40-μm-thick sections, and observed using an atomic force microscope. Fig.15 As shown, the morphological characteristics and height characteristics showed that the grafted blood vessels of the third and fourth groups had regular fiber arrangement in the media part similar to that of natural blood vessels, while the grafted blood vessels of the first and second groups showed disordered fiber arrangement in the media part.

[0122] Results of mechanical strength test of blood vessels:

[0123] At 8 weeks after transplantation, the grafts harvested from each group were rinsed with saline, embedded in cryogen, and cut into 40 μm thick sections. Atomic force microscopy was used to measure the vessel stiffness and scan the vascular media. The positioning of the tip and sample was controlled by combining optical microscopy with atomic force microscopy. The same soft cantilever was used for all measurements. Four points were measured for each vessel. A total of 50-60 points were measured and the average Young's modulus was calculated. AFM force measurements were performed on the medium within a range of 30 μm. As shown in the attached figure. Fig.15 As shown, the results showed that the stiffness of Groups 1 and 2 increased compared to the values ​​of native blood vessels, which were 3325 kPa and 3729 kPa, respectively, while the stiffness of Groups 3 and 4 was similar to that of native blood vessels.

[0124] (2) Vascular patency test results

[0125] Doppler ultrasound and Micro-CT results are shown in the attached Fig.16 As shown, at the 8th week after transplantation, the rats in each group were anesthetized and the neck skin was prepared. Ultrasound gel was evenly applied to the neck of the rats, and color Doppler ultrasound examination was performed, with the frequency set to 13.0MHz, the depth set to 2.5cm, the mechanical index set to 10.4MHz, and the grayscale set to 46. After continuous observation of several cardiac cycles, the Doppler mode was selected to obtain the ultrasound spectrum of the common carotid artery, and the image was saved. The peak velocity of the carotid artery and the blood flow of the transplanted sdTEVGs were measured. The results showed that the blood flow velocity of Group 3 was stable at 81.20±21.51cm / s, while the blood flow velocity of Group 4 was stable at 70.27±15.73cm / s, both of which were much higher than those of Groups 1 and 2, indicating that the decellularized vascular matrix modified by ANCR / E7-EXO maintained more stable hemodynamics under normal physiological conditions or high glucose conditions.

[0126] At 8 weeks after transplantation, rats in each group were anesthetized and injected with 1 ml of heparin via the tail vein. Five minutes later, the chest cavity was opened and the vascular contrast agent iohexol was injected into the left ventricle. After small animal CT scanning (Bruker Micro-CT), the patency of sdTEVGs in each group was evaluated using CT images, and the vascular model was reconstructed. The results showed that the TEBV in groups 3 and 4 remained patency and good shape under normal and high glucose conditions, while there was no vascular contrast agent signal in the control group.

[0127] Example 3: Application of engineered exosomes in vascular calcification caused by chronic kidney disease (schematic diagram see Figure 1 C)

[0128] (I) Modeling and treatment plan

[0129] (1) Establishment of rat model of chronic kidney disease: Male SD rats (230-250 g) were intraperitoneally injected with 1% sodium pentobarbital 40 mg / kg. Two-step subtotal nephrectomy (5 / 6NX) was performed, and right subtotal nephrectomy was performed one week after left subtotal nephrectomy. Throughout the study, calcification was accelerated by feeding rats a high-phosphorus diet (1.2% PI). The CKD model was successfully established by increasing serum urea nitrogen levels.

[0130] (2) Engineered exosome treatment: 10 mg / kg ANCR / E7-EXO was injected via the tail vein once every 5 days for a total of 13 weeks.

[0131] (II) Detection method

[0132] (1) In vivo fluorescence

[0133] Aortic calcification was detected by a bisphosphonate derivative near-infrared fluorescent imaging agent (Osteosense 750EX, PerkinElmer, Boston), which was injected into rats via the tail vein 24 hours before imaging. Rats were euthanized and the aorta was perfused with saline. After dissection, near-infrared fluorescence signals were mapped using fluorescence reflectance imaging (FRI) (NEWTON 7.0FT-100.VILBER).

[0134] (2) Immunofluorescence

[0135] After paraffin sections were dewaxed to water, a-SMA and osteopontin (OPN) staining was performed. The tissue was permeabilized with 0.5% Triton X-100, and then boiled and repaired with 0.5% 40X antigen repair solution for 20 minutes, and blocked with 10% goat serum for 2 hours. The a-SMA primary antibody and OPN primary antibody were diluted with primary antibody diluent at a ratio of 1:200 and incubated with the tissue overnight at 4°C, and washed three times with PBS. Subsequently, the fluorescently labeled secondary antibody was used to incubate at room temperature in the dark for 2 hours, and then washed 5 times with PBS. The sections were sealed with anti-fading sealing agent containing DAPI and observed under a laser scanning confocal microscope. Quantitative statistics of fluorescence images were analyzed using ImageJ software.

[0136] (III) Experimental results

[0137] (1) In vivo fluorescence detection:

[0138] As attached Fig.17 As shown, after the 13th week of CKD modeling, according to near-infrared spectroscopy analysis, the calcium tracer showed that the hydroxyapatite signal in the treatment group was 60% of that in the control group, indicating that after ANCR / E7-EXO treatment, the degree of vascular calcification caused by CKD was significantly reduced.

[0139] (2) Immunofluorescence staining:

[0140] As attached Fig.18 and 19 As shown, after 13 weeks of CKD modeling, immunofluorescence staining showed that Gli1 + Cells and contracting SMCs coexist in the media. Gli1 expressing α-SMA in the media of vascular grafts + The number of cells was 110.4, which was 2.94 times that of the control group. + Cells colocalize with osteoblast-like cells, Gli1 + The number of cells expressing OPN was 49.94, which was 6.39 times that of the treatment group. The above results show that ANCR / E7-EXO inhibits Gli1 in autologous blood vessels + Osteogenic differentiation of cells promotes Gli1 + Cells differentiate into contractile SMCs.

[0141] The above is only an embodiment of the present invention, and the common knowledge such as the known specific technical solutions and / or characteristics in the solution is not described in detail here. It should be pointed out that for those skilled in the art, without departing from the technical solution of the present invention, several modifications and improvements can be made, which should also be regarded as the protection scope of the present invention, and these will not affect the effect of the implementation of the present invention and the practicality of the patent. The scope of protection required by this application shall be based on the content of its claims, and the specific implementation methods and other records in the specification can be used to interpret the content of the claims.

Claims

1. An engineered exosome, characterized in that: Its surface is modified with E7 mesenchymal stem cell affinity peptide; its interior is encapsulated with lncRNA-ANCR as shown in SEQ ID NO.1; Engineered exosomes were prepared by the following method: S1: constructing a plasmid expressing E7-lamp2b fusion protein; the gene sequence of the E7-lamp2b fusion protein is shown in SEQ ID NO.3; S2: using the plasmid to transfect human bone marrow mesenchymal stem cells to obtain expression cells; inducing the expression cells to secrete exosomes, and obtaining empty exosomes through separation and purification; S3: lncRNA-ANCR was introduced into empty exosomes to obtain engineered exosomes.

2. The method for preparing engineered exosomes according to claim 1, characterized in that: The method includes the following steps in sequence: S1: constructing a plasmid expressing E7-lamp2b fusion protein; the gene sequence of the E7-lamp2b fusion protein is shown in SEQ ID NO.3; S2: using the plasmid to transfect human bone marrow mesenchymal stem cells to obtain expression cells; inducing the expression cells to secrete exosomes, and obtaining empty exosomes through separation and purification; S3: lncRNA-ANCR was introduced into empty exosomes to obtain engineered exosomes.

3. The use of an engineered exosome in the preparation of tissue engineering blood vessels according to claim 1, characterized in that: The method includes the following steps in sequence: SS1: The blood vessels are pretreated to obtain the vascular matrix; the vascular matrix is ​​treated with pancreatic enzymes to obtain the decellularized vascular matrix; SS2: The decellularized vascular matrix is ​​incubated with a collagen solution to obtain a pretreated decellularized vascular matrix; and then EDC, NHS, engineered exosomes and the pretreated decellularized vascular matrix are co-incubated to obtain ANCR / E7-EXO modified tissue engineered blood vessels.

4. The use of engineered exosomes in preparing tissue engineering blood vessels according to claim 3, characterized in that: In SS1, the blood vessels are cleaned to remove blood, and the vascular adventitia and connective tissue are stripped to obtain the vascular matrix; in SS2, the engineered exosomes are stained: the engineered exosomes are stained with PKH67.

5. The use of engineered exosomes in preparing tissue engineering blood vessels according to claim 3, characterized in that: The tissue engineered blood vessel is used for preparing a tissue engineered blood vessel for diabetic patients.

6. The use of engineered exosomes in preparing tissue engineering blood vessels according to claim 3, characterized in that: The engineered exosomes are used for smooth muscle cell reconstruction after tissue engineering blood vessel transplantation and for inhibiting calcification of tissue engineering blood vessels.

7. The engineered exosome according to claim 1 in the preparation of Gli1 + Application of drugs in inhibiting vascular calcification caused by osteogenic differentiation of cells.

8. The engineered exosome according to claim 7 is used to prepare Gli1 + The invention relates to a drug for inhibiting vascular calcification caused by osteogenic differentiation of cells, characterized in that: The engineered exosomes are used to inhibit Gli1 + Osteogenic differentiation of cells and promotion of Gli1 + Differentiation of cells into smooth muscle cells.

9. The engineered exosome according to claim 8 in the preparation of Gli1 + The invention relates to a drug for inhibiting vascular calcification caused by osteogenic differentiation of cells, characterized in that: The vascular calcification is caused by chronic kidney disease.

Images