Gel response distance sensor based on crisper / cas12a combined with strand displacement amplification and its application in biological detection

Abstract

The application provides a gel response distance sensor based on combination of CRISPR / Cas12a and strand displacement amplification reaction. The application uses two-step reactions of strand displacement amplification and CRISPR / Cas12a non-specific cutting for target recognition and signal amplification, loads hydrogel such as gelatin on filter paper as a cutoff module, uses a hydrophilic cotton thread as a one-dimensional channel as a distance signal output carrier, and constructs a gel response distance sensor. Taking detection of miRNA as an example, the presence of the target triggers the strand displacement amplification reaction to generate a large amount of dsDNA, and then the dsDNA activates the Cas12a enzyme to non-specifically cut the single-stranded DNA in the magnetic bead-single-stranded DNA-enzyme complex in the system, so that the enzyme is released into the supernatant. The supernatant containing the enzyme can specifically enzymatically hydrolyze the hydrogel to change the permeability of the cutoff module, thereby realizing the control of the liquid volume flowing into the one-dimensional channel and converting the target concentration into a distance signal output. The sensor provided by the application has the advantages of device-independent signal output, naked-eye quantification, high sensitivity and small required sample volume.

Description

Technical Field

[0001] This invention belongs to the field of biosensing and biochemical analysis, specifically relating to the construction of a gel-responsive distance sensor and its application in biomarker detection. Background Technology

[0002] Point-of-care testing (POCT) is a novel method that provides rapid test results immediately at the sampling site, representing a rapidly developing field in diagnostic testing. POCT offers advantages such as rapid results, portability, ease of operation, low cost, and no need for specialized technical personnel, making it easier to popularize in ordinary households and remote, economically underdeveloped areas. Furthermore, POCT plays a significant role in the prevention of infectious diseases and preventing their further spread. However, in practical testing, the target analytes are often present in minute quantities and in complex environments, and the sensitivity and selectivity of most POCT methods cannot meet the testing requirements. More importantly, the quantitative analysis of target analytes by most POCT methods often relies on additional electronic equipment, such as ultraviolet analyzers and fluorescence spectrometers. These issues limit its application and development in practical testing.

[0003] Point-of-care testing (POCT) devices based on distance signal output can effectively overcome the above shortcomings. Similar to the signal readout method of a mercury thermometer, these devices convert the content of the target analyte into a distance signal. The content of the target analyte can be obtained by reading the distance, quantifying the target analyte without the need for additional electronic equipment. Furthermore, compared to common colorimetric methods, they are less susceptible to variations in individual user interpretation. In addition, introducing a signal amplification step is considered an effective strategy for improving sensor detection sensitivity. Therefore, there is an urgent need to develop a device-free, naked-eye quantitative POCT detection method with high sensitivity. Summary of the Invention

[0004] This invention addresses the problems of insufficient detection sensitivity and the need for additional electronic devices to quantify target analytes in existing POCT methods. It proposes a gel-response distance sensor based on the combination of CRISPR / Cas12a and chain displacement amplification (SDA) reaction and its construction method, which can realize instantaneous, highly sensitive, naked-eye quantitative detection of target analytes.

[0005] The technical solution adopted by the present invention to solve the above-mentioned problems is as follows:

[0006] A gel-response distance sensor based on the combination of CRISPR / Cas12a and SDA reaction includes a target recognition and signal amplification module, a flow interception module, and a signal output carrier. The target recognition and signal amplification module is composed of an SDA solution system, a CRISPR / Cas12a solution system, and a signal reporter molecule, used for pretreatment of the sample solution before it is added to the flow carrier module. The signal reporter molecule is a magnetic bead-single-stranded DNA-enzyme complex, wherein the enzyme is capable of degrading the hydrogel on the flow carrier module. The flow interception module is a paper substrate loaded with hydrogel, which overlaps the starting end of the signal output carrier. The signal output carrier is a one-dimensional hydrophilic channel made of a hydrophilic material capable of generating capillary action.

[0007] The target of this gel-responsive distance sensor is a molecule that can directly or indirectly open the circular structure of hDNA in the SDA solution system and trigger a non-specific cleavage reaction of SDA and Cas12a, thereby cleaving the single-stranded DNA in the signal reporter molecule, releasing the enzyme from the signal reporter molecule, and then specifically enzymatically digesting the hydrogel on the current-carrying module to change its permeability, generating a distance signal in the one-dimensional hydrophilic channel, and performing quantitative analysis of the target molecule based on the distance signal.

[0008] According to the above scheme, the hydrogel is a hydrogel capable of sealing the porous structure of the paper substrate and producing a flow interception effect, such as gelatin hydrogel or hyaluronic acid gel. Specifically, when the hydrogel is a gelatin hydrogel, the enzyme in the magnetic bead-single-stranded DNA-enzyme is trypsin; when the hydrogel is a hyaluronic acid gel, the enzyme in the magnetic bead-single-stranded DNA-enzyme is hyaluronidase.

[0009] According to the above scheme, the paper substrate is a hydrophilic paper with a large pore size, good mechanical strength, and the ability to maintain its integrity when soaked in a solution for a long time. For example, filter paper that is not easily rotten when soaked in a solution can have a pore size of 30-150μm, preferably 80-120μm, which can achieve a solution retention effect when loaded with hydrogel and a solution permeation effect after enzymatic hydrolysis of hydrogel; the one-dimensional hydrophilic channel is a material with hydrophilicity such as mercerized cotton thread that can produce capillary action.

[0010] According to the above scheme, the gel response distance sensor also includes a bracket and a length measuring tool; the bracket is used to fix the flow interception module and the signal output carrier, and the length measuring tool is used to measure the output distance signal and is fixed at the starting point of the one-dimensional hydrophilic channel extending out of the paper substrate.

[0011] According to the above scheme, the gel response distance sensor also includes a color indicator, which is added to the sample solution after it has been processed by the target recognition and signal amplification module, and is used for color development of the signal output carrier.

[0012] The main steps of the above-mentioned method for constructing a gel-responsive distance sensor based on the combination of CRISPR / Cas12a and SDA reaction are as follows:

[0013] (1) Prepare a paper substrate loaded with hydrogel as a retention module;

[0014] (2) The paper substrate loaded with hydrogel is overlapped above the starting end of the one-dimensional hydrophilic channel of the signal output carrier, so that the starting end of the one-dimensional hydrophilic material points to or passes through the center of the paper substrate.

[0015] (3) Covalently couple an enzyme (such as trypsin) to single-stranded DNA (ssDNA) to obtain a Trypsin-ssDNA complex. Then, fix the Trypsin-ssDNA onto streptavidin magnetic beads (MBs) to obtain MB-ssDNA-trypsin, which serves as a signal reporter molecule.

[0016] (4) A mixed solution containing hairpin DNA (hDNA), polymerase (KFP), and deoxyribonucleoside triphosphates (dNTPs) is used as the SDA solution system; Cas12a and crRNA are mixed in a buffer solution and incubated to obtain a Cas12a / crRNA solution, which is used as the CRISPR / Cas12a solution system; the CRISPR / Cas12a solution system, the SDA solution system, and the signal reporter molecule are combined to form a target recognition and signal amplification module for processing the test solution.

[0017] According to the above scheme, in step (3), the Trypsin-ssDNA complex can be prepared by covalently coupling the two through the amine-thiol crosslinking agent Sulfo-SMCC or click chemistry. When covalently coupling trypsin and ssDNA, the molar ratio of trypsin to ssDNA should be greater than 1:1.

[0018] According to the above scheme, in step (3), the ssDNA is a poly(T) sequence with a sequence length of 25 bases, taking the sequence 5'-Biotin / TTTTTTTTTTTTTTTTTTTTTTTTT / SH C6-3' as an example; the size of MBs is 0.3μm-1μm; when the Trypsin-ssDNA complex interacts with MBs, the Trypsin-ssDNA complex is in excess to ensure that the streptavidin site on MBs reacts completely.

[0019] The main steps of the above-mentioned method for detecting trace biomarkers in biological samples using a gel-response distance sensor based on the combination of CRISPR / Cas12a and SDA reaction are as follows:

[0020] a) Add different concentrations of target analyte standards to an SDA solution system containing hDNA, KFP, and dNTPs, and react at 37°C for a period of time to obtain the SDA solution system; the target analyte is a biomarker;

[0021] b) Mix Cas12a and crRNA in 1X buffer r2.1 solution and react at 37°C for a period of time to obtain Cas12a / crRNA solution, which is used as CRISPR / Cas12a solution system;

[0022] c) Mix the SDA solution system obtained in step a), the CRISPR / Cas12a solution system obtained in step b), and the signal reporter molecule, namely the magnetic bead-single-stranded DNA-enzyme complex, and react at 37°C for a period of time. After the reaction is complete, add dye as a color indicator.

[0023] d) The supernatant of the mixture obtained in step c) is taken by magnetic separation and added to the interception module. After a period of time, the color development length on the one-dimensional hydrophilic channel is recorded. Then, a standard curve is plotted with the logarithm of the target concentration as the abscissa and the color development length of the one-dimensional hydrophilic channel as the ordinate.

[0024] e) Under conditions parallel to steps a)-d), test the color development length of the biological sample to be tested, and then calculate the content of the target substance in the biological sample to be tested based on the standard curve.

[0025] According to the above scheme, in step a), the final concentration of hDNA is 10 nM-1 mM, the content of KFP is 0.05-0.4 U / μL, the final concentration range of the target analyte is above 10 pM, generally 10 pM-10 nM, and the reaction time is 50-70 min.

[0026] According to the above scheme, in step b), the molar ratio of Cas12a to crRNA is 1:1; the reaction time of Cas12a and crRNA is at least 15 min.

[0027] According to the above scheme, in step c), the final concentration range of Cas12a is 10-80 nM, and the final concentration range of MB-ssDNA-trypsin is 0.25-1.5 mg / mL; the reaction time is at least 40 min; the volume of dye added should not exceed 10% of the total volume; the dye is a water-soluble dye that is miscible with aqueous solution in any proportion and has no significant effect on trypsin activity.

[0028] According to the above scheme, the color indicator can be added after the reaction is completed in step c), or after magnetic separation in step d), for color development of the signal output carrier.

[0029] According to the above scheme, in step d), the mixed system can be separated into solid and liquid by methods such as magnetic separation and centrifugation to obtain supernatant. To avoid the use of centrifuge, magnetic separation is preferred, and the magnetic separation time is generally 30-60s.

[0030] According to the above scheme, in step d), the optimal color development time is the time when the difference in color development length is the largest when the concentration of the target substance standard is the highest and the concentration of the target substance is 0.

[0031] According to the above scheme, in step d), the supernatant is dripped onto the intercepting module and cannot directly contact the one-dimensional hydrophilic channel. The size of the intercepting module and the length of the one-dimensional hydrophilic channel depend on the volume of supernatant dripped onto the current-carrying module. The area S1 of the current-carrying module is equal to or slightly larger than the contact area S2 between the supernatant and the current-carrying module (generally S1 does not exceed 1.1 times S2). The length of the one-dimensional hydrophilic channel is sufficient to ensure that the supernatant that has permeated down is completely wicked up and a distance signal is generated.

[0032] According to the above scheme, this invention provides one specific sequence each for the target compound, hDNA, and crRNA; wherein, the target compound, taking miRNA-let-7a as an example, has a sequence of 5'-UGAGGUAGUAGGUUGUAUAGUU-3'; the hDNA sequence is 5'-GTCCGCATGAGGTTTACATCTCATACCAGCTTATAACTATACAACCTAC TACCTCATGCGGACGTC-3'; and the crRNA sequence is 5'-UAAUUUCUACUAAGUGUAGA UCAUCUCAUACCAGCUUAUUC-3'. The hDNA sequence can be modified according to the target compound sequence, and should satisfy the requirement that its circular portion can directly or indirectly hybridize with the target compound to open the circular structure, and that the sequence contains a 5'-TTTN-3' Cas12a recognition domain and a GACGTC palindromic sequence at the 3' end; the crRNA sequence can be modified according to the hDNA sequence, and should satisfy the requirement that it can hybridize with the complementary strand of the hDNA.

[0033] Furthermore, the detection targets of this invention are not limited to miRNA. Other targets, such as proteins, small molecules, and metal ions, that can directly or indirectly open the circular structure of hDNA and trigger SDA reactions or CRISPR / Cas12a non-specific cleavage reactions, are all within the scope of the detection targets of this invention.

[0034] The technical concept of the gel-response distance sensor based on the combination of CRISPR / Cas12a and SDA reaction described in this invention is as follows: Figure 1As shown, this invention uses hydrophilic cotton thread as a signal output carrier and a one-dimensional hydrophilic channel, with gelatin hydrogel loaded on filter paper as a cutoff module, MB-ssDNA-trypsin as a signal reporter molecule, and SDA reaction and CRISPR / Cas12a system as target recognition and signal amplification systems. The target is a molecule that can directly or indirectly open the circular structure of hDNA and trigger the SDA reaction and Cas12a non-specific cleavage reaction. During detection, the sample solution to be tested is added to the SDA reaction system for target recognition and signal amplification. Subsequently, the SDA solution system, MB-ssDNA-trypsin signal reporter molecule, and CRISPR / Cas12a solution system are mixed for secondary signal amplification. Finally, the supernatant of the mixture is mixed with dye and dropped onto the cutoff module. After a period of time, the colorimetric length on the one-dimensional hydrophilic channel is read.

[0035] The working principle of the aforementioned gel-response distance sensor is as follows: When a target analyte (such as miRNA) is present, it can open the circular structure of hDNA, triggering an SDA reaction to generate a large amount of double-stranded DNA (dsDNA). The generated dsDNA acts as an activator, and the DNA undergoes base pairing with crRNA, thereby activating the Cas12a enzyme. The activated Cas12a enzyme has non-specific cleavage activity and can cleave the surrounding ssDNA. Therefore, the ssDNA in the MB-ssDNA-trypsin signal molecule is cleaved, and trypsin is released from the surface of MBs into the supernatant. At this time, through magnetic separation, the supernatant containing trypsin is mixed with dye and dropped onto filter paper (intercepting module) loaded with gelatin. Since trypsin can specifically enzymatically hydrolyze gelatin, the permeability of the intercepting module is changed, realizing the control of the amount of liquid flowing into the one-dimensional channel and generating a distance signal in the one-dimensional hydrophilic channel. The concentration of the target analyte is converted into a distance signal output, thereby realizing the quantitative analysis of the target analyte. This gel-response distance output sensor, based on the combination of CRISPR / Cas12a and SDA, enables instantaneous, highly sensitive, and naked-eye quantitative detection of target analytes.

[0036] Compared with the prior art, the beneficial effects of the present invention are:

[0037] 1. The gel-response distance sensor described herein uses distance as the output signal. By changing the permeability of the filter paper (intercepting module) loaded with hydrogel, the color development length of the one-dimensional hydrophilic channel is controlled to output a distance signal, which can be directly read to quantify the concentration of the target substance. This avoids the introduction of additional signal output devices, realizes naked-eye quantification of target substance concentration without device dependence, and has good selectivity, repeatability, and good anti-interference ability and accuracy. It has the potential to detect trace biomarkers in complex biological samples.

[0038] 2. This invention utilizes a two-step signal amplification strategy—the SDA reaction and the non-specific cleavage activity of Cas12a—to enhance the sensitivity of the device. In the SDA reaction, trace amounts of the target substance (such as miRNA) are recycled and, under the catalysis of KFP, generate a large amount of dsDNA. Simultaneously, the target substance is converted into dsDNA that can activate Cas12a, which is the first step of the signal amplification strategy. The generated dsDNA can activate Cas12a to non-specifically cleave the ssDNA in the surrounding MB-ssDNA-trypsin, allowing one dsDNA to induce hundreds or thousands of trypsins to detach from the surface of MBs, which is the second step of the signal amplification strategy. Attached Figure Description

[0039] Figure 1 This is a schematic diagram of a gel-response distance sensor based on the combination of CRISPR / Cas12a and SDA.

[0040] Figure 2 The images are scanning electron microscope (SEM) images of the filter paper before and after loading gelatin hydrogel.

[0041] Figure 3 The diagram shows the solution retention effect before and after the filter paper is loaded with gelatin hydrogel.

[0042] Figure 4 The color development length of different concentrations of miRNA on cotton thread, as captured by a mobile phone, and the corresponding standard curves.

[0043] Figure 5 This is a graph from a selective experiment.

[0044] Figure 6 This is a diagram of a reproducibility experiment. Detailed Implementation

[0045] To better understand the present invention, the following embodiments further illustrate the content of the present invention, but the present invention is not limited to the following embodiments.

[0046] The following embodiments describe the construction method of a gel-response distance sensor based on the combination of CRISPR / Cas12a and SDA, with the following main steps:

[0047] (1) Dissolve gelatin in PBS buffer solution, heat and stir at 35-50℃ for 1-2 hours to prepare gelatin solution; then, fully immerse a 6 mm diameter circular filter paper (using rapid qualitative filter paper) in the gelatin solution, and after a period of time, take out the filter paper and air dry it at room temperature to obtain filter paper loaded with gelatin hydrogel.

[0048] The PBS buffer solution has a concentration of 10 mM and a pH of 7.2-7.6. The concentration of the gelatin solution that can form a solid gel varies at different temperatures. The minimum gel concentration that can form a solid gel at the experimental temperature should be selected. Generally, the minimum gel concentration that can form a solid gel at 20°C for gelatin with a gel strength of 250g Bloom is 4%. The gelatin is heated and stirred for 1-2 hours at a temperature that allows the gelatin of the corresponding concentration to remain in a flowable solution state, generally 35-50°C.

[0049] (2) Overlap the filter paper loaded with gelatin hydrogel onto the starting end of a 6cm long hydrophilic mercerized cotton thread, so that the diameter of the cotton thread coincides with that of the filter paper loaded with gelatin.

[0050] The sensor support is constructed using building blocks. Two rectangular blocks, each 0.8cm wide and of equal height, are fixed parallel to each other on the base plate, spaced 4.85cm apart. Double-sided tape is attached to the top surfaces of the two blocks. The ends of a cotton thread are then fixed to the two parallel blocks. Filter paper loaded with gelatin covers the starting end of the cotton thread, with the diameter of the thread coinciding with that of the filter paper. A graduated piece of paper is fixed at the point where the cotton thread extends beyond the filter paper, serving as a length measuring tool. The graduations are perpendicular to the cotton thread, and the "0" graduation should be located at the point where the filter paper and the cotton thread extend beyond the filter paper begin.

[0051] A gelatin-loaded filter paper is placed over one end of a cotton thread. Ideally, the diameters of the cotton thread and the gelatin-loaded filter paper should coincide. This ensures that the length of the cotton thread covered by the filter paper is the same (same diameter as the circular filter paper), and a longer covered length facilitates more sensitive detection of the solution permeating from the intercepting module. In parallel experiments, ensuring consistent coverage of the cotton thread by the filter paper will not significantly affect the quantification of the target analyte content. This is because the actual color development length depends on the length of the cotton thread covered by the filter paper. However, the starting point of the cotton thread extending from the filter paper can be used as the "0" mark. The length of the cotton thread covered by the filter paper only affects the position of the standard curve in the coordinate system, without altering the correlation or linearity of the standard curve.

[0052] (3) Trypsin was covalently coupled to single-stranded DNA (ssDNA) to obtain the Trypsin-ssDNA complex. Then, the Trypsin-ssDNA complex was immobilized onto streptavidin magnetic beads MBs (using streptavidin magnetic beads from the XinGu Valley brand, with a particle size of 1μm) through the interaction between streptavidin and biotin to obtain MB-ssDNA-trypsin, which serves as a signal reporter molecule.

[0053] (4) The sample solution to be tested is reacted with an SDA reaction system containing hDNA, Klenow Fragment (exo-) polymerase (KFP) and dNTP for a period of time to obtain an SDA solution system; then the SDA solution system is combined with the Cas12a / crRNA solution system to form a target recognition and signal amplification module and mixed with a color indicator for subsequent color development of cotton thread, making it easy to read the distance signal.

[0054] The following embodiments also provide a method for rapid detection of biomarkers using the gel-response distance sensor based on the combination of CRISPR / Cas12a and SDA, which can realize real-time quantitative detection of biomolecules without the naked eye. Taking the biomarker miRNA-let-7a as the target, the specific detection steps are as follows:

[0055] a) Add different concentrations of the target miRNA-let-7a to an SDA reaction system containing hDNA, KFP, and dNTPs, and react at 37°C for 1 h;

[0056] b) Mix Cas12a and crRNA in 1X buffer r2.1 solution and react at 37°C for at least 15 min to obtain Cas12a / crRNA solution;

[0057] c) Mix the solutions obtained in steps a) and b) with MB-ssDNA-trypsin and react at 37°C for at least 40 min. After the reaction is complete, add the dye to the mixture.

[0058] If the dye volume is too large, it may dilute the trypsin content in the solution and affect the experimental results. Therefore, the smaller the dye volume, the better. Commercially available liquid dyes, such as red ink, can be used directly.

[0059] d) The supernatant of the mixture obtained in step c) is obtained by magnetic separation (the volume of the supernatant added to the gelatin-loaded filter paper is about 20 μL, and the filter paper diameter is 6 mm). The supernatant is added to the gelatin-loaded filter paper and the timing is started. The color development length on the one-dimensional hydrophilic channel is recorded after 15 min. Then, a standard curve is plotted with the logarithm of the target concentration as the abscissa and the color development length of the one-dimensional hydrophilic channel as the ordinate.

[0060] In this process, the supernatant is directly dripped onto the gelatin-loaded filter paper and should not come into direct contact with the cotton thread. The size of the filter paper and the length of the cotton thread depend on the volume of the supernatant dripped onto the filter paper. The area of ​​the filter paper is slightly larger than the contact area between the supernatant and the filter paper. The length of the cotton thread is sufficient to ensure that the supernatant that has permeated down is completely wicked up and generates a distance signal.

[0061] e) Under conditions parallel to steps a)-d), test the color development length of the biological sample to be tested, and then calculate the content of the target substance in the biological sample to be tested based on the standard curve.

[0062] In the following examples, the dissolution and dilution of miRNA, hDNA, and crRNA were performed using DEPC-treated water.

[0063] Example

[0064] 1. Preparation of gelatin solution: Weigh 0.4g of gelatin and dissolve it in 10mL of PBS buffer. Heat and stir at 40℃ for 2h to obtain gelatin solution, and store at 4℃ for later use.

[0065] The prepared gelatin solution is in a flowable sol state at 40°C and transforms into a solid gel state at 20°C.

[0066] The PBS components in this step are: NaCl 137mM, KCl 2.68mM, Na2HPO4 8.1mM, KH2PO4 1.76mM, pH=7.4.

[0067] 2. Treatment of gelatin-loaded filter paper: Soak the circular filter paper in the above gelatin solution, shake it on a shaker at 40°C and 100 rpm / min for 15 minutes to ensure that the gelatin is completely and evenly loaded onto the filter paper. Finally, take out the filter paper and let it air dry at room temperature overnight.

[0068] SEM images of the prepared gelatin hydrogel-loaded filter paper are shown below. Figure 2 As shown.

[0069] The effect of the prepared gelatin hydrogel-loaded filter paper on solution interception is shown in the figure below. Figure 3 As shown.

[0070] 3. Preparation of Trypsin-ssDNA: Mix 30 μL DNA-SH (100 μM), 4 μL TCEP (300 mM), and 2 μL phosphate buffer (1 M, pH = 5.5) and react at 25 °C for 1 h. Then, ultrafilter the solution using an Amicon-3K ultrafiltration tube and centrifuge at 12000 rpm / min for 20 min to remove excess TCEP. Add buffer A to the ultrafiltration tube and centrifuge again; repeat this process 8 times. Collect the supernatant, which is the TCEP-activated DNA-SH solution. Simultaneously, dissolve 0.8 mg trypsin and 0.2 mg sulfo-SMCC separately in 20 μL buffer A and mix them. Pipette the mixture for 5 min to promote the dissolution of sulfo-SMCC, then react the mixture at 25 °C for 1 h. After the reaction is complete, centrifuge the solution and collect the supernatant to remove undissolved sulfo-SMCC. Next, the supernatant was ultrafiltered and centrifuged at 10,000 rpm for 20 min using an Amicon-10K ultrafiltration tube, and washed 8 times with buffer A to obtain the activated trypsin solution. Then, the activated DNA-SH solution was mixed with the trypsin solution and reacted at 25°C for 48 h. Finally, the solution was ultrafiltered and centrifuged using an Amicon-30K ultrafiltration tube, and washed 8 times with buffer A to remove unreacted DNA-SH and trypsin. The supernatant was collected as the Trypsin-ssDNA complex solution and stored at 4°C for later use.

[0071] In this step, buffer A consists of: Na₂HPO₄ 81mM, KH₂PO₄ 17.6mM, NaCl 100mM, and pH = 7.3.

[0072] In this step, the DNA-SH sequence is: 5'-Biotin / TTTTTTTTTTTTTTTTTTTTTTTTTTT / SH C6-3', which is the ssDNA sequence.

[0073] 4. Preparation of MB-ssDNA-trypsin: First, add 2.5 μL of 10 mg / mL MBs to 25 μL of 1X RNase-free PBS solution and vortex to mix. Then, remove the supernatant by magnetic separation and wash three times with 1X RNase-free PBS. Next, disperse the MBs in 25 μL of RNase-free 1X PBS, add 1 μL of Trypsin-ssDNA complex, and react at 37°C for 1 h. Finally, remove the supernatant by magnetic separation and wash three times with 25 μL of 1X RNase-free PBS to remove excess Trypsin-ssDNA complex, obtaining the MB-ssDNA-trypsin complex.

[0074] 5. Construction of standard curve: Mix 1 μL of DEPC-treated water, 1 μL of 10X KFP buffer, 1 μL of 1 mM dNTPs, 1 μL of 3 U / μL KFP, 1 μL of 500 nM hDNA, and 5 μL of miRNAs of different concentrations (0 nM, 0.01 nM, 0.05 nM, 0.1 nM, 1 nM, 5 nM, 10 nM), and react at 37 °C for 1 h to obtain the SDA solution system.

[0075] Meanwhile, 6 μL of DEPC water, 2 μL of 10X buffer r2.1, 1 μL of 500 nM Cas12a and 1 μL of 500 nM crRNA were mixed and reacted at 37 °C for 15 min to obtain the Cas12a / crRNA solution system.

[0076] Subsequently, 10 μL of SDA solution, 10 μL of Cas12a / crRNA solution, and 25 μg of MB-ssDNA-trypsin were mixed and reacted at 37 °C for 1 h. After the reaction was complete, the reaction system was magnetically separated using a magnet. 1 μL of red non-carbon ink was added to the supernatant as an indicator, and 20 μL was dropped onto gelatin-loaded filter paper. Timing was started, and the color development length on the cotton thread was recorded after 15 min. Then, a standard curve was obtained by plotting the color development length as the ordinate and the logarithm of the target miRNA-let-7a concentration as the abscissa. Figure 4 The linear regression equation was calculated based on the standard curve as L = 8.37lgC + 20.97 (where L is the color development length on the cotton thread recorded at 15 min, and C is the concentration of the target miRNA-let-7a), and the linear correlation coefficient R0 was [value missing]. 2 =0.988.

[0077] In this step, the sequence of miRNA-let-7a is: 5'-UGAGGUAGUAGGUUGUAUAGUU-3';

[0078] The hDNA sequence is: 5'-GTCCGCATGAGGTTTACATCTCATACCAGCTTATAACTATACAACCTACTACCTCATGCGGACGTC-3'; the crRNA sequence is: 5'-UAAUUUCUACUAAGUGUAGAUCAUCUCAUACCAGCUUAUUC-3'.

[0079] 6. Selectivity Experiment: The selectivity of the sensor was verified using the target miRNA-let-7a, non-target miRNA-10b, miRNA-21, miRNA-27a, and a blank control group, all at a concentration of 10 nM. The detection method was the same as that used to construct the standard curve. Figure 5 As shown, the distance signal did not change significantly in the presence of miRNA-10b, miRNA-21, and miRNA-27a, and was comparable to that of the control group. However, the distance signal increased significantly in the presence of the target miRNA-let-7a. These findings indicate that the distance sensor exhibits good selectivity for detecting the target miRNA-let-7a due to the high sequence dependence of base pairing between nucleic acids.

[0080] In this step, the sequence of miRNAlet-7a is: 5'-UGAGGUAGUAGGUUGUAUAGUU-3'; the sequence of miRNA-10b is: 5'-UACCCUGUAGAACCGAAUUUGUG-3'; the sequence of miRNA-21 is: 5'-UAGCUUAUCAGACUGAUGUUGA-3'; and the sequence of miRNA-27a is: 5'-UUCACAGUGGCUAAGUUCCGC-3'.

[0081] 7. Reproducibility Experiment: The sensor established in this invention was used to detect different concentrations of the target miRNA-let-7a. Each concentration was detected six times using six independent sensors. The detection conditions were the same as those used to establish the standard curve. Figure 6 As shown, at the same concentration, the distance length values ​​generated by the sensor are consistent. For the target miRNA-let-7a at concentrations of 0.1 nM, 1 nM, 5 nM, and 10 nM, the standard deviations of the six repeated measurements are 9.75%, 4.49%, 6.72%, and 4.08%, respectively, indicating that the distance output sensor constructed in this invention has good repeatability.

[0082] 8. Determination of target miRNA-let-7a in serum: Serum was diluted to 10%, and 0.05 nM, 1 nM, and 5 nM of target miRNA-let-7a were added as standard samples. The detection method was the same as the method for establishing the standard curve. Using the distance sensor constructed in this invention, the color development length on the cotton thread was measured, and the concentration of target miRNA-let-7a in serum was calculated using the standard curve. As shown in Table 1, for serum samples containing different concentrations of miRNA-let-7a, the recovery rate of the detection method established in this invention in serum was 90-105%, and the relative standard deviation between multiple detection results was less than 5%, indicating that the sensing method of this invention has good anti-interference ability and accuracy, and has the potential to detect trace biomarkers in complex biological samples.

[0083] Table 1. Recovery assay of miRNA spiked in serum samples

[0084]

[0085] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A gel-response distance sensor based on a combination of CRISPR / Cas12a and chain displacement amplification (SDA) reaction, characterized in that, It includes a flow interception module, a signal output carrier, a target recognition and signal amplification module; the flow interception module is a paper substrate loaded with hydrogel, which is attached above the starting end of the signal output carrier; the paper substrate has a porous structure; the hydrogel is a hydrogel capable of sealing the porous structure of the paper substrate and producing a flow interception effect; the signal output carrier is a one-dimensional hydrophilic channel used to generate capillary output distance signals; The target recognition and signal amplification module is composed of an SDA solution system, a CRISPR / Cas12a solution system, and a signal reporter molecule, used to process the sample solution to be tested. The signal reporter molecule is a magnetic bead-single-stranded DNA-enzyme complex, serving as a Cas12a cleavage substrate, wherein the enzyme is capable of degrading the hydrogel on the interception module. The SDA solution system is a mixed solution containing hDNA, polymerase, and dNTPs, where the hDNA is hairpin DNA. The CRISPR / Cas12a solution system is obtained by incubating Cas12a and crRNA mixed in a buffer solution. The circular portion of the hDNA sequence can hybridize with the target to open the circular structure, and the sequence contains a 5'-TTTN-3' Cas12a recognition domain, with a GACGTC palindromic sequence at the 3' end. The crRNA sequence can hybridize with the complementary strand of the hDNA. The target of this gel-responsive distance sensor can open the hDNA circular structure in the SDA solution system and trigger strand displacement amplification and Cas12a non-specific cleavage reaction. It releases the enzyme from the signal reporter molecule and specifically enzymatically digests the hydrogel on the intercept module to change its permeability, thereby controlling the amount of liquid flowing into the one-dimensional hydrophilic channel and converting the target concentration into a distance signal output.

2. The gel-response distance sensor based on CRISPR / Cas12a combined with chain substitution amplification SDA reaction as described in claim 1, characterized in that, The gel-response distance sensor also includes a color indicator, which is added to the sample solution after it has been processed by the target recognition and signal amplification module. Used for color development of signal output carriers.

3. The gel-response distance sensor based on the combination of CRISPR / Cas12a and chain substitution amplification SDA reaction as described in claim 1, characterized in that, It also includes a bracket and a length measuring tool; the bracket is used to fix the current interception module and the signal output carrier, and the length measuring tool is used to measure the output distance signal.

4. The method for constructing the gel-response distance sensor according to claim 1, characterized in that, The steps are as follows: (1) Prepare a paper substrate loaded with hydrogel as a retention module; (2) The paper substrate loaded with hydrogel is overlapped above the starting end of the one-dimensional hydrophilic channel of the signal output carrier, so that the starting end of the one-dimensional hydrophilic channel points to or passes through the center of the paper substrate. (3) Covalently couple the enzyme with ssDNA to obtain an enzyme-ssDNA complex, and then fix the enzyme-ssDNA complex onto magnetic beads to obtain magnetic bead-ssDNA-enzyme, which serves as a signal reporter molecule; (4) The mixed solution containing hDNA, polymerase and dNTP is used as the SDA solution system; Cas12a and crRNA are mixed in a buffer solution and incubated to obtain the Cas12a / crRNA solution, which is used as the CRISPR / Cas12a solution system. A target recognition and signal amplification module, consisting of an SDA solution system, a CRISPR / Cas12a solution system, and a signal reporter molecule, is used to process the sample solution to be tested.

5. The method for constructing a gel-response distance sensor according to claim 4, characterized in that, In step (3), the ssDNA has a poly(T) sequence; when the enzyme is covalently coupled with the ssDNA, the molar ratio of the enzyme to the ssDNA is greater than 1:1; the diameter of the magnetic bead is 0.3μm-1.5μm; when the enzyme-ssDNA complex interacts with the magnetic bead, the enzyme-ssDNA complex is in excess.

6. The use of the gel-response distance sensor according to claim 2 for preparing and detecting trace biomarkers in biological samples, characterized in that, The following steps are included: a) Add different concentrations of target analyte standards to an SDA solution containing hDNA, polymerase, and dNTPs, and react at 36-38°C; the target analyte is a biomarker. b) Mix Cas12a and crRNA in a buffer solution and react at 36-38℃ to obtain a Cas12a / crRNA solution, which serves as the CRISPR / Cas12a solution system; c) Mix the SDA solution system obtained in step a) and the CRISPR / Cas12a solution system obtained in step b) with the signal reporter molecule, namely magnetic bead-ssDNA-enzyme, and react at 36-38℃. After the reaction is complete, add a color indicator. d) The supernatant of the mixture obtained in step c) is magnetically separated and added to the interception module. Timing is started, and the color development length on the one-dimensional hydrophilic channel is recorded at 10-20 min. Then, a standard curve is plotted with the logarithm of the target concentration as the abscissa and the color development length of the one-dimensional hydrophilic channel as the ordinate. e) Under conditions parallel to steps a)-d), test the color development length of the biological sample to be tested, and then calculate the content of the target analyte in the biological sample to be tested based on the standard curve.

7. The use of the gel-response distance sensor according to claim 6 in preparing and detecting trace biomarkers in biological samples, characterized in that, In step a), the final concentration of hDNA is 10 nM-1 mM, the polymerase content is 0.05-0.4 U / μL, the final concentration of dNTPs is 20 μM-1 mM, and the final concentration of the target analyte is above 10 pM.

8. The use of the gel-response distance sensor according to claim 6 in preparing and detecting trace biomarkers in biological samples, characterized in that, In step b), the molar ratio of Cas12a to crRNA is 1:1, and the concentrations in the buffer solution are both in the range of 1-100 nM; the reaction time of Cas12a and crRNA is at least 15 min.

9. The use of the gel-response distance sensor according to claim 6 in preparing and detecting trace biomarkers in biological samples, characterized in that, In step c), the final concentration range of hDNA and Cas12a is 10-80 nM, and the final concentration range of magnetic bead-single-stranded DNA-enzyme is 0.25-2.5 mg / mL; the reaction time is at least 40 min; the volume of the added color indicator should not exceed 10% of the total volume; the color indicator is a water-soluble dye and has no significant effect on enzyme activity.

10. The use of the gel-response distance sensor according to claim 6 in preparing a device for detecting trace biomarkers in biological samples, characterized in that, The target compound was miRNA-let-7a, with the sequence 5'-UGAGGUAGUAGGUUGUAUAGUU-3'; the hDNA sequence was 5'-GTCCGCATGAGGTTTACATCTCATACCAGCTTATAACTATACAACCTACTACCTCATGCGGACGTC-3'; the crRNA sequence was 5'-UAAUUUCUACUAAGUGUAGAUCAUCUCAUACCAGCUUAUUC-3'; and the ssDNA sequence was 5'-Biotin / TTTTTTTTTTTTTTTTTTTTTTTT / SH C6-3'.

Images