PCR primer set, kit and method for quickly identifying Opsariichthys bidens, Parazacco spilurus and their hybrids

By designing the PCR primer set and performing PCR amplification and electrophoresis detection, the problem of identification of hybrids between marmot and sprigated leptoplasm was solved, and rapid and accurate germplasm identification was achieved, making up for the shortcomings of morphological identification.

CN116676396BActive Publication Date: 2025-07-22ZHEJIANG YULAODA AGRI TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310749099.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-25
Publication Date
2025-07-22
Estimated Expiration
2043-06-25

AI Technical Summary

Technical Problem

The prior art is difficult to effectively identify the marmot and the sprigillus and their hybrids, especially in the seedling stage, which leads to ecological germplasm safety risks.

Method used

A PCR primer set was designed, including forward primer F and reverse primer R, amplified by PCR and detected by agarose gel electrophoresis. The band-shaped characteristics of the amplified products distinguish between marnias, sprigillus and their hybrids.

Benefits of technology

It has achieved rapid and accurate identification of marmot, sprigillus and their hybrids, making up for the shortcomings of morphological identification and providing a reliable method for germplasm identification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116676396B_ABST
    Figure CN116676396B_ABST
Patent Text Reader

Abstract

PCR primer set, kit and method for quickly identifying Opsariichthys bidens, Parazacco spilurus and their hybrids, belonging to the technical field of molecular biology identification. The PCR primer set includes a forward primer F and a reverse primer R. When using this PCR primer set for amplification, if the amplification product is a single band of 167-173 bp, it is determined to be Opsariichthys bidens; if the amplification product is a single band of 565-573 bp, it is determined to be Parazacco spilurus; if the amplification product is double bands of 167-173 bp and 565-573 bp, it is determined to be a hybrid. The present invention has the characteristics of being fast, accurate and efficient, making up for the deficiencies in morphological identification and being a reliable germplasm identification method.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology identification, and specifically relates to a PCR primer set, a kit and a method for rapidly identifying Opsariichthys bidens, Parazacco spilurus and their hybrids. Background Art

[0002] Opsariichthys bidens ( Opsariichthys bidens ) and Parazacco spilurus ( Zacco acanthogenys ) are two small stream fish species, which belong to the genus Opsariichthys ( Opsariichthys ) of the subfamily Opsariichthyinae and the genus Parazacco ( Zacco ) of the family Xenocyprididae in the order Cyprinoidei respectively, and are small fish species endemic to East Asia. Because of its tender and delicious meat and rich in DHA, Opsariichthys bidens has become one of the representative varieties of stream fish for mountain tourism consumption, and the consumer market is expanding day by day. The research on its reproductive biology and artificial breeding technology has attracted much attention in recent years, and a certain regional industrial scale has been formed. The male fish of Opsariichthys bidens and Parazacco spilurus have bright colors, especially Parazacco spilurus has become a new emerging native ornamental fish variety.

[0003] At present, some aquaculture operators have carried out cross-breeding and cultivation of Opsariichthys bidens and Parazacco spilurus in order to cultivate new varieties with better production and breeding performance and ornamental advantages. The adult morphological characteristics of the hybrids of Opsariichthys bidens and Parazacco spilurus are partly similar to Opsariichthys bidens and partly similar to Parazacco spilurus, with obvious differentiation and difficult to identify. And it is even more difficult to distinguish Opsariichthys bidens, Parazacco spilurus and their hybrids at the seedling stage. Therefore, there is a lack of effective means to identify their hybrids with Parazacco spilurus in the proliferation and release of Opsariichthys bidens, and there are risk loopholes in ecological germplasm safety.

[0004] The present invention starts from the newly published whole genome sequence of Opsariichthys bidens, and through bioinformatics technologies such as MISA, batch primer design, and in-silico PCR, a large number of SSR primers of Opsariichthys bidens are screened. By selecting 50 pairs of primers to verify Opsariichthys bidens, Parazacco spilurus and their hybrids, a PCR primer set, a kit and a method for rapidly identifying Opsariichthys bidens, Parazacco spilurus and their hybrids are screened out. Summary of the Invention

[0005] Aiming at the problems existing in the prior art, the purpose of the present invention is to design and provide a technical solution for a PCR primer set, a kit and a method for rapidly identifying Opsariichthys bidens, Parazacco spilurus and their hybrids. Through the verification of a batch of Opsariichthys bidens, Parazacco spilurus and their hybrids, the rapid identification of Opsariichthys bidens, Parazacco spilurus and their hybrids is realized.

[0006] The present invention specifically adopts the following technical solutions:

[0007] In the first aspect of the present invention, a set of PCR primers for quickly identifying Opsariichthys bidens, Parazacco spilurus and their hybrids is provided. The primer set includes a forward primer F and a reverse primer R. The nucleotide sequence of the forward primer F is shown in SEQ ID No.1, and the nucleotide sequence of the reverse primer R is shown in SEQ ID No.2.

[0008] In the second aspect of the present invention, a kit for quickly identifying Opsariichthys bidens, Parazacco spilurus and their hybrids is provided. It includes a forward primer F and a reverse primer R. The nucleotide sequence of the forward primer F is shown in SEQ ID No.1, and the nucleotide sequence of the reverse primer R is shown in SEQ ID No.2.

[0009] Furthermore, the kit further includes 2×Taq PCR Mix and ddH2O.

[0010] In the third aspect of the present invention, the application of the above PCR primer set or the above kit in quickly identifying Opsariichthys bidens, Parazacco spilurus and their hybrids is provided.

[0011] In the fourth aspect of the present invention, a method for quickly identifying Opsariichthys bidens, Parazacco spilurus and their hybrids by using the above PCR primer set is provided. It includes the following steps:

[0012] 1) Extract the DNA of Opsariichthys bidens, Parazacco spilurus and their hybrids;

[0013] 2) Using the DNA in step 1) as a template, perform PCR amplification with the PCR primer set, and after the PCR amplification is completed, detect it by agarose gel electrophoresis;

[0014] 3) If the amplification product is a single band of 167 - 173 bp, it is determined to be Opsariichthys bidens; if the amplification product is a single band of 565 - 573 bp, it is determined to be Parazacco spilurus; if the amplification product is a double band of 167 - 173 bp and 565 - 573 bp, it is determined to be a hybrid.

[0015] Furthermore, in this method, the reaction system of the PCR is: genomic DNA with a concentration of 50 ng·µL -1 0.5 µL, 2×Taq PCR Mix 10 µL, upstream and downstream primers with a concentration of 10 µmol·µL -1 0.8 µL each, and ddH2O is added to make up to 20 µL.

[0016] Furthermore, in this method, the reaction conditions of the PCR are: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s; annealing at 64°C for 30 s; extension at 72°C for 50 s; a total of 30 cycles; and finally extension at 72°C for 5 min.

[0017] The present invention has developed a PCR primer set for quickly identifying Opsariichthys bidens, Parazacco spilurus and their hybrids. Through this primer set, simple PCR amplification can be used to quickly identify Opsariichthys bidens, Parazacco spilurus and their hybrids, and distinguish Opsariichthys bidens, Parazacco spilurus and their hybrids at the molecular level. This method is fast, accurate and efficient, making up for the deficiencies in morphological identification and is a reliable germplasm identification method. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is the PCR electrophoresis detection result in the embodiment.

[0019] In the figure: SSR detection diagrams of 16 Opsariichthys bidens, Parazacco spilurus and their hybrids respectively. Among them, the band of Opsariichthys bidens is around 169 bp, the band of Parazacco spilurus appears at around 565 bp, and the hybrid shows two bands. DETAILED DESCRIPTION OF THE INVENTION

[0020] The present invention will be further described below through the following specific embodiments, but the content of the present invention is not limited thereto at all.

[0021] Example 1: Screening of SSR Loci of Opsariichthys bidens

[0022] Download the genome of Opsariichthys bidens with a total length of 818.78 Mb that has been published, an N50 value of 25.29 Mb, and is mapped to 39 pairs of chromosomes. Use the MISA software (https: / / webblast.ipk-gatersleben.de / misa / ) to screen SSRs in the whole genome of Opsariichthys bidens. The screening criteria are that dinucleotides have at least 8 repeats, trinucleotides and tetranucleotides have at least 6 repeats, pentanucleotides and hexanucleotides have at least 5 repeats, and two SSRs less than 100 bp apart are regarded as 1 SSR. A total of 304,870 SSRs were screened in the whole genome of Opsariichthys bidens. The length of the SSR sequences is 800,442 bp, accounting for 0.10% of the total genome length, and the total frequency is 372.35 per Mb. -1 .

[0023] Example 2: Design of SSR Primers for Opsariichthys bidens and e-PCR

[0024] Extract 250 bp sequences upstream and downstream of the SSR loci, and use the primer3 software for batch primer design. Among them, the amplified fragment length is 150 - 250 bp, the primer size is 20 - 27 bp, the primer GC content is 35 - 45%, the optimum is 50%, the TM value is 50 - 65°C, the optimum is 57°C, and 3 pairs of primers are designed for each SSR locus. Use the e-PCR software to detect the number of potential binding sites of the designed primers. A total of 148,885 SSR loci successfully designed primers.

[0025] Example 3: Screening of SSR Loci for Identification of Opsariichthys bidens, Parazacco spilurus and Their Hybrids

[0026] Fifty pairs of primers suitable for e-PCR detection were screened. First, ordinary primers were synthesized, and the DNA of one Opsariichthys bidens, one Parazacco spilurus and one hybrid were used for preliminary detection. The PCR reaction system was 0.5 μL of genomic DNA (concentration 50 ng·µL-1), 10 μL of 2×Taqplus PCRMix (Tiangen Biochemical Technology (Beijing) Co., Ltd.), 0.8 μL of each upstream and downstream primer (concentration 10 μmol·µL-1), and ddH2O was added to make up to 20 μL. The PCR reaction conditions were pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at the appropriate annealing temperature of 64°C for 30 s, extension at 72°C for 50 s, for a total of 30 cycles; finally, extension at 72°C for 5 min and stored at 4°C for standby. Take 5 μL of the reaction product and check it by 1.5% agarose gel electrophoresis, with a voltage of 120V and an electrophoresis time of 30 min, and then take a gel imaging photo. One SSR identification site was screened out by preliminary detection, with the repeat core (GT)12, located on chromosome 26 of Opsariichthys bidens, starting site 6458138 and ending site 6458161. Forward primer F: GTCAACACCTGTCTTCCTCA (shown in SEQ ID NO.1), reverse primer R: TTCACCCTCTTGCTCTTTCC (shown in SEQ ID NO.2). The amplified product size in Opsariichthys bidens is about 169bp, and the amplified product size in Parazacco spilurus is about 565bp.

[0027] HEX-labeled fluorescent primers were further synthesized to test the range of amplified products of multiple individuals. The amplified product types of 30 individuals in Opsariichthys bidens were tested as 169bp (167-173bp); the amplified product types of 30 individuals in Parazacco spilurus were tested as 565bp (565-573bp).

[0028] Example 4: Accuracy Test for Identification of Opsariichthys bidens, Parazacco spilurus and Their Hybrids

[0029] Sixteen Opsariichthys bidens, sixteen Parazacco spilurus and sixteen of their hybrids were collected from the breeding base, fin clips were cut to extract genomic DNA, and standardized to 50 ng·µL -1 . PCR amplification and electrophoresis detection were carried out on 48 DNA samples of the samples. The PCR amplification, electrophoresis and gel imaging test conditions were the same as the third point.

[0030] As Figure 1 The results showed that the amplified product of 16 Opsariichthys bidens was a single band of about 169bp, the amplified product of 16 Parazacco spilurus was a single band of about 565bp, and the amplified product of the hybrid was a double band of about 169bp and 565bp. The accuracy rate of identifying Opsariichthys bidens, Parazacco spilurus and their hybrids at this locus was 100%.

[0031] The present invention is not limited to the scope of the above specific embodiments. The above embodiments are merely for the purpose of being able to explain in detail the use process of the present invention, and production methods and technical details with equivalent functions also belong to a part of the content of the present invention. In fact, those skilled in the art can find different adjustment solutions according to their respective needs based on the foregoing description, and these adjustments should all be within the scope of the appended claims of this article.

Claims

1. Application of a PCR primer set for rapidly identifying Opsariichthys bidens, Parazacco spilurus and their hybrids in identifying Opsariichthys bidens, Parazacco spilurus and their hybrids, the PCR primer set comprising a forward primer F and a reverse primer R, the nucleotide sequence of the forward primer F being as shown in SEQ ID No.1, and the nucleotide sequence of the reverse primer R being as shown in SEQ ID No.

2.

2. A method for rapidly identifying Opsariichthys bidens, Parazacco spilurus and their hybrids by using a PCR primer set for rapidly identifying Opsariichthys bidens, Parazacco spilurus and their hybrids, characterized in that, The PCR primer set comprises a forward primer F and a reverse primer R, the nucleotide sequence of the forward primer F being as shown in SEQ ID No.1, and the nucleotide sequence of the reverse primer R being as shown in SEQ ID No.2, and comprises the following steps: 1) Extract the DNA of Opsariichthys bidens, Parazacco spilurus and their hybrids; 2) Using the DNA in step 1) as a template, perform PCR amplification with the PCR primer set, and perform detection by agarose gel electrophoresis after the PCR amplification is completed; 3) If the amplification product is a single band of 167-173 bp, it is determined to be Opsariichthys bidens; if the amplification product is a single band of 565-573 bp, it is determined to be Parazacco spilurus; if the amplification product is a double band of 167-173 bp and 565-573 bp, it is determined to be a hybrid.

3. The method according to claim 2, wherein The reaction system of the PCR is as follows: 0.5 μL of genomic DNA with a concentration of 50 ng·µL -1 , 10 μL of 2×Taq PCR Mix, 0.8 μL of each upstream and downstream primer with a concentration of 10 μmol·µL -1 , and made up to 20 μL with ddH2O.

4. The method according to claim 2, wherein The reaction conditions for the PCR are: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s; annealing at 64°C for 30 s; extension at 72°C for 50 s; a total of 30 cycles; and finally extension at 72°C for 5 min.