Use of agpg as a therapeutic target for endocrine-resistant, estrogen receptor-positive breast cancer

By using long non-coding RNA AGPG as a therapeutic target, AGPG inhibitors such as siRNA and shRNA were designed to solve the treatment challenge of endocrine-resistant estrogen receptor-positive breast cancer, and to effectively inhibit the proliferation of breast cancer cells and tumor growth.

CN116726174BActive Publication Date: 2026-02-17NANJING JIEYIN DIAGNOSTIC TECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310569187.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-19
Publication Date
2026-02-17
Estimated Expiration
2043-05-19

AI Technical Summary

Technical Problem

In the existing technology, the efficacy of anti-estrogen drugs such as tamoxifen and fulvestrant in endocrine-resistant estrogen receptor-positive breast cancer is limited, and there is an urgent need for new therapeutic targets to overcome endocrine resistance.

Method used

By using long non-coding RNA AGPG as a therapeutic target, AGPG inhibitors such as siRNA and shRNA are designed to inhibit AGPG expression. These inhibitors can be used in combination with anti-estrogenic drugs to significantly inhibit the proliferation of breast cancer cells and tumor growth.

Benefits of technology

AGPG inhibitors significantly inhibited the proliferation of MCF7 and T47D breast cancer cells, reduced the proportion of cells in the G0/G1 phase of the cell cycle, and effectively inhibited tumor growth in nude mice, demonstrating their effectiveness in the treatment of endocrine-resistant estrogen receptor-positive breast cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004237789940000041
    Figure BDA0004237789940000041
  • Figure HDA0004237789960000011
    Figure HDA0004237789960000011
  • Figure HDA0004237789960000021
    Figure HDA0004237789960000021
Patent Text Reader

Abstract

The application discloses application of AGPG in treatment of endocrine-resistant estrogen receptor positive breast cancer, and finds that AGPG can promote in-vitro endocrine-resistant cell cycle progression and cell proliferation through stable knockout research. Finally, a small interfering RNA drug is tested in an in-vivo experiment, and it is further proved that down-regulation of AGPG mediated by the small interfering RNA can significantly inhibit growth of tamoxifen-resistant MCF7 xenografts.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological medicine, and particularly relates to application of long non-coding RNA (lncRNA) AGPG in preparation of a drug for treating endocrine-resistant estrogen receptor-positive breast cancer. BACKGROUND

[0002] Breast cancer is the most common and deadly type of cancer in women, with about 685,000 people dying from breast cancer worldwide in 2020. Estrogen receptor-positive breast cancer subtype (ERa + Breast cancer) is the most common type of breast cancer. Endocrine therapy based on anti-estrogen drugs is the first-line treatment for ERa + Breast cancer patients, accounting for more than 70% of breast cancer cases. However, the efficacy of anti-endocrine drugs such as tamoxifen and fulvestrant is limited by primary and acquired resistance of endocrine-resistant estrogen receptor-positive breast cancer cells. Therefore, it is urgent to further study the mechanism of endocrine resistance and develop new anti-therapy failure targets. SUMMARY

[0003] The present application aims to solve the problem of treating endocrine-resistant estrogen receptor-positive breast cancer, and specifically provides long non-coding RNA (lncRNA) AGPG as an endocrine-resistant estrogen receptor-positive breast cancer drug treatment target.

[0004] The long non-coding RNA (lncRNA) AGPG sequence of the present application is shown in SEQ ID NO. 1.

[0005] One of the technical solutions of the present application is the application of AGPG as a breast cancer treatment target. In some embodiments, the breast cancer is endocrine-resistant estrogen receptor-positive breast cancer.

[0006] In other embodiments, the breast cancer is drug-resistant endocrine-resistant estrogen receptor-positive breast cancer. The drug resistance can be primary or acquired drug resistance, and is usually referred to as anti-endocrine drug resistance, such as tamoxifen-resistant estrogen receptor-positive breast cancer or fulvestrant-resistant estrogen receptor-positive breast cancer.

[0007] The second technical solution of the present application is the application of AGPG inhibitors in the preparation of a drug for treating breast cancer. In some embodiments, the breast cancer is endocrine-resistant estrogen receptor-positive breast cancer.

[0008] In some embodiments, the breast cancer is endocrine resistant estrogen receptor positive breast cancer. The endocrine resistance can be primary or acquired, and is typically resistance to anti-endocrine drugs, such as tamoxifen resistant estrogen receptor positive breast cancer or fulvestrant resistant estrogen receptor positive breast cancer.

[0009] The AGPG inhibitors of the present application can be designed according to the conventional methods in the art, and can be small molecule compounds, small interfering RNAs, etc., which are capable of inhibiting the expression of AGPG and are within the scope of the present application. For example, they can be conventional reagents capable of inhibiting or silencing AGPG, such as siRNA, shRNA, etc.

[0010] The siRNAs and shRNAs capable of inhibiting or silencing AGPG are within the scope of the present application, and in one specific example of the present application, some specific small interfering RNAs of AGPG are provided, and the nucleotide sequences are shown below, but the present application is not limited to these specific small interfering RNAs:

[0011] AGPG siRNA: 5'-GCACATGCAAAGCTGGCTT-3' (SEQ ID NO. 2);

[0012] shRNA1-AGPG: 5'-CCGGAAGCACATGCAAAGCTGGCTTCTCGAGGTATAGCTTAACGTAGGCATTTTTTTG-3' (SEQ ID NO. 3);

[0013] shRNA2-AGPG: 5'-CCGGAAGACTTTGTTAACCGTTCCCTCTCGAGGTATAGCTTAACGTAGGCATTTTTTTG-3' (SEQ ID NO. 4).

[0014] The small interfering RNAs of the present application can be prepared according to the conventional methods in the art, and can be further modified with cholesterol.

[0015] The third aspect of the present application is that the AGPG inhibitors can be used in combination with other anti-estrogen drugs, and are used in the treatment of breast cancer. In some embodiments, the breast cancer is endocrine resistant estrogen receptor positive breast cancer.

[0016] In other embodiments, the breast cancer is an endocrine resistant, endocrine resistant estrogen receptor positive breast cancer. The resistance can be primary or acquired, and generally refers to resistance to an endocrine drug, such as tamoxifen resistant estrogen receptor positive breast cancer or fulvestrant resistant estrogen receptor positive breast cancer. The AGPG inhibitor can be as described above.

[0017] The anti-estrogen drug described in the present application is an anti-estrogen drug commonly used in the art, including but not limited to tamoxifen or fulvestrant.

[0018] The AGPG inhibitor described in the present application can be taken simultaneously with other anti-estrogen drugs, or taken sequentially, and the dosage used can be a therapeutically effective amount of dosage commonly used in the art.

[0019] Knocking out AGPG significantly inhibits the proliferation of MCF7 and T47D breast cancer cells. The above findings are further confirmed in nude mice carrying tamoxifen-resistant MCF7 xenografts, and injection of cholesterol-modified AGPG siRNA strongly inhibits the growth of xenografts. This study fully demonstrates that knocking out AGPG is effective for treating breast cancer, especially endocrine-resistant estrogen receptor positive breast cancer, with significant inhibition. That is, AGPG can be used as a therapeutic target for breast cancer, especially endocrine-resistant estrogen receptor positive breast cancer. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 Figure A is a graph showing the results of knocking out AGPG in MCF7 and T47D cell lines using shRNA, which shows that shRNA can significantly reduce the expression of AGPG in MCF7 and T47D cells. Figure B is a graph showing the results of knocking out AGPG in tamoxifen- and fulvestrant-resistant MCF7 cell lines using shRNA, which shows that shRNA can significantly reduce the expression of AGPG in tamoxifen- and fulvestrant-resistant MCF7 cells.

[0021] Figure 2 Figure A is a graph showing the results of knocking out AGPG in MCF7 and T47D cell lines using shRNA, which shows that shRNA can significantly reduce the expression of AGPG in MCF7 and T47D cells. Figure B is a graph showing the results of knocking out AGPG in tamoxifen- and fulvestrant-resistant MCF7 cell lines using shRNA, which shows that shRNA can significantly reduce the expression of AGPG in tamoxifen- and fulvestrant-resistant MCF7 cells.

[0022] Figure 3Figure 1 is a cell cycle result graph; Figure (A-B) is a flow cytometry detection experimental result graph, the results show that AGPG shRNA causes MCF7, T47D cells to increase in G0 / G1 phase.

[0023] Figure 4 Figure 1 is a tumor growth result graph; Figure (A-B) is a mouse tumor size statistical graph, the results show that AGPG shRNA, cholesterol modified AGPG siRNA strongly inhibits the growth of tumors in nude mice. DETAILED DESCRIPTION

[0024] The present application is further illustrated by the following examples and figures, which facilitate a better understanding of the present application, but do not limit the present application.

[0025] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0026] The biological materials, reagents and kits used in the present application can be obtained through conventional commercial channels, and the experimental techniques used are conventional operations in the art or are operated according to the instructions of the corresponding goods.

[0027] The MCF7, T47D, 293T cell lines used in the following examples are purchased from the American Type Culture Collection (ATCC, Manassas, VA) unless otherwise specified.

[0028] The construction method of tamoxifen or fulvestrant resistant MCF7 cell sublines in the following examples is as follows unless otherwise specified: MCF7 cells are cultured in RPMI1640 medium (Biological Industries, Beit Haemek, Israel) without phenol red / glutamine, and 10% charcoal-stripped fetal bovine serum (Biological Industries), GlutaMax (Gibco) are added; tamoxifen (Selleck, Houston, TX) is added at a gradient concentration of 0.1, 0.2, 1 μM in sequence, or fulvestrant (Selleck) is added at a gradient concentration of 0.01, 0.05, 0.1 μM in sequence, each concentration lasts for 4 months, and a total of 12 months of culture, and the resulting cells are tamoxifen or fulvestrant resistant MCF7 cell sublines. Tamoxifen or fulvestrant resistant MCF7 cell sublines continue to be maintained in the above-mentioned 1 μM tamoxifen or 0.1 μM fulvestrant culture medium, and other conditions not specifically mentioned are the same as the culture of conventional MCF7 cells.

[0029] Example 1: Construction of MCF7, T47D, tamoxifen, fulvestrant resistant MCF7 cell lines with AGPG knockdown

[0030] 1. Establishment of AGPG knockdown cell lines

[0031] According to the sequence of long non-coding RNA (lncRNA) AGPG, shRNA for knocking down AGPG expression was designed according to the conventional method. The shRNA target sequence used in this example is shown in Table 1 below:

[0032] Table 1

[0033]

[0034] The full-length and shRNA of AGPG were synthesized by GeneWiz (Suzhou, China) and ligated to pLVX-PURO and pLKO vectors. (pLVX-PURO and pLKO were purchased from Addgene) to form recombinant vectors pLVX-PURO-AGPG or pLKO.1-shRNA.

[0035] 2. Lentivirus infection of cells

[0036] The plasmids psPAX2, pDM2.G and pLVX-PURO-AGPG or pLVX-PURO or pLKO.1-AGPG-shRNA1 or pLKO.1-CtrshRNA (Ctr shRNA sequence as SEQ ID NO. 5) were co-transfected into 293T cells by Lipofectamine 3000 reagent (Invitrogen; Thermo Fisher Scientific). The first batch of lentivirus was harvested 24 hours after transfection, and the second batch of lentivirus was harvested 48 hours after transfection.

[0037] 3. Infection

[0038] MCF7, T47D, tamoxifen, fulvestrant-resistant MCF7 cells were cultured in medium containing lentivirus for 24 hours, and then cultured in complete medium containing 2 μg / mL puromycin (Thermo Fisher Scientific) for 48 hours to obtain AGPG-knockdown MCF7, T47D, tamoxifen, fulvestrant-resistant MCF7 cell lines.

[0039] 4. RT-qPCR verification

[0040] Total RNA of step 3 infected MCF7, T47D, tamoxifen, fulvestrant-resistant MCF7 cells was extracted with TRNzol Universal (TIANGEN) reagent. The concentration and quality of RNA were measured with NanoDrop 2000 spectrophotometer. RNA was reverse transcribed into first strand cDNA with HiScript II first strand cDNA synthesis kit (+gDNA wiper) (Vazyme). RT-qPCR reaction was performed with ChamQ universal SYBR-qPCR mixture reagent (Vazyme) on 7500 fluorescence quantitative PCR system. The qRT-PCR primer sequences are shown in Table 2 below:

[0041] Table 2

[0042] Gene Primer forward Primer reverse AGPG GGAGGCGGAGGTTGTAGTGAA TTGTGGGAGGGAAGTCTGTGG 18S GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG

[0043] The reaction was performed on a fluorescence quantitative PCR instrument according to the following set program: pre-denaturation, 95℃, 30 sec; denaturation, 95℃, 10 sec, annealing, 60℃, 30 sec. (denaturation, annealing, 40 cycles).

[0044] The results are shown in Figure 1 AGPG knockdown in MCF7, T47D, tamoxifen, fulvestrant-resistant MCF7 cell lines infected with lentivirus, and the results showed that compared with the control group Ctr sh, sh1 group and sh2 group achieved ideal effect on AGPG knockdown in MCF7, T47D, tamoxifen, fulvestrant-resistant MCF7 cells.

[0045] Cell proliferation detection of Example 2

[0046] Cell viability assay experiment: the MCF7, T47D, tamoxifen, fulvestrant-resistant MCF7 cells with AGPG knockdown obtained in Example 1 were collected, and each group of cells was inoculated in a 96-well plate at 5000 cells per well. 10 μL CCK-8 solution (Dojindo, Tokyo, Japan) was mixed with 90 μL culture medium and added to each group of cells for 2 hours. The absorbance at 450 nm of each well was detected with a microplate spectrophotometer to reflect the cell viability.

[0047] The results are shown in Figure 2 (A-B) shows that the knockdown of AGPG significantly inhibited the cell proliferation in MCF7, T47D, tamoxifen, fulvestrant-resistant MCF7.

[0048] Colony formation assay: AGPG knockdown MCF7, T47D cells obtained from Example 1 were seeded in 6-well plates at a density of 500 cells / well. Cells were cultured for 10 days, then fixed with 4% paraformaldehyde solution (PFA) and stained with 0.1% crystal violet (Solarbio). Colony counting was performed using Image J software.

[0049] Results are shown in Figure C, downregulation of AGPG significantly inhibited colony formation of MCF7, T47D cells. Figure 2

[0050] Example 3 Targeted inhibition of AGPG inhibits cell cycle

[0051] Cell cycle analysis experiment: For cell cycle analysis, 10 ^6 Example 1 were treated with 75% ethanol and fixed at 4°C for 2 hours. Fixed cells were incubated in 200 μL propidium iodide (PI) (MCE) containing RNAase for 0.5 hours. Stained cells were subjected to flow cytometry analysis on a flow cytometer (Becton Dickinson, Franklin Lakes, NJ). Data were analyzed using ModFit LT V.3.1 software.

[0052] Results are shown in Figure D, AGPG shRNA led to an increase in the proportion of G0 / G1 phase cells in MCF7, T47D. Figure 3

[0053] Example 4 Targeted inhibition of AGPG inhibits tumor growth

[0054] Mouse tumorigenesis experiment: Animal experiments were performed in accordance with the guidelines of Yangzhou University. Five-week-old female nude mice were purchased from the Yangzhou University Animal Center, and estradiol pellets (0.72 mg, NE-121, Innovative Research of America, Florida, USA) were implanted subcutaneously into the back of five-week-old female nude mice.

[0055] One week later, the mice were randomly divided into two groups, the first group, Ctr shRNA; the second group, AGPG shRNA1, 10 ^7 Example 1 were injected subcutaneously into the armpit of mice.

[0056] ​​Two weeks later, when the tumor formation was touched, the mice were given intraperitoneal injection of tamoxifen (20 mg / kg, twice a week) in the fourth week. The nude mice were weighed every week and the size of the tumor was measured with vernier caliper during the continuous administration for 6 weeks. In the tenth week, the mice were transferred to the dissecting room for unified execution, the subcutaneous tumor was dissected and weighed, the length and width of the tumor were measured to record the relevant data, and the tumor size was calculated by (length* width2) / 2.

[0057] Results are shown in Figure 4 As shown in Figure A, AGPG shRNA and cholesterol-modified AGPG siRNA strongly inhibited the growth of tumors.

[0058] Example 5 Targeted inhibition of AGPG inhibits the growth of tumors

[0059] 1. Preparation of AGPG siRNA

[0060] (1) Synthesis of lipophilic H-phosphonate

[0061] Imidazole (1 g, 14.5 mmol) was dissolved in 20 ml of acetonitrile and cooled to 0°C. To this solution was added triethylamine (TEA, 2 ml, 14.0 mmol) and PCl3 (0.4 ml, 4.5 mmol), and then stirred at 0°C for 25 min. 1 mmol of cholesterol was dissolved in 10 ml of dichloromethane and added dropwise to the mixture under argon for 40 min. The reaction mixture was stirred at room temperature for 1 hour under the control of TLC, and then 3 ml of water was added and then evaporated. The residue was dissolved in 30 ml of dichloromethane, washed with 20 ml of water twice, dried over sodium sulfate, filtered, and then evaporated under reduced pressure. The crude product was dissolved in CH3OH / CH2Cl2 (10 / 90), and then subjected to silica gel chromatography (eluted with CH3OH / CH2Cl2 10 / 90 to 70 / 30, with the addition of 0.1% TEA), to obtain the lipophilic H-phosphonate. l2 10 / 90 to 70 / 30, with the addition of 0.1% TEA), to obtain the lipophilic H-phosphonate.

[0062] (2) Synthesis of oligonucleotide lipophilic conjugate

[0063] The 4.5 mmol of lipophilic H-phosphonate prepared in step (1) was dissolved in 150 ml of dichloromethane. 15 mg of siRNA (shown in SEQ ID NO. 2: 5'-GCACATGCAAAGCTGGCTT-3') was added and mixed evenly. Then, valeryl chloride (1.3 ul, 12.5 umol, dissolved in 150 ul of pyridine / acetonitrile, 2 / 1) was reacted for 5 min, washed with acetonitrile, and the condensation reaction was repeated twice. After washing with acetonitrile, 0.2 ml of I2 solution (0.1 M, pyridine / water, 98 / 2) was reacted for 20 min, washed with acetonitrile, acetone, and ether, and dried to obtain the cholesterol-modified siRNA.

[0064] 2. In vivo experiments

[0065] Mouse tumorigenic experiment: Animal experiments were performed according to the guidelines of Yangzhou University. Five-week-old female nude mice were purchased from the Animal Center of Yangzhou University. Estradiol pellets (0.72 mg, NE-121, Innovative Research of America, Florida, USA) were implanted subcutaneously into the back of five-week-old female nude mice.

[0066] One week later, 10 ^7 MCF7 cells that were resistant to tamoxifen (MCF7-TAMR) were injected subcutaneously into the back of the estradiol-treated nude mice.

[0067] When tumors were palpable two weeks later, the mice were randomly divided into four groups: the first group, Vehicle + Cholesterol-Ctr siRNA; the second group, Vehicle + Cholesterol-AGPG siRNA1; the third group, tamoxifen + Cholesterol-Ctr siRNA; and the fourth group, tamoxifen + Cholesterol-AGPG siRNA1. Each group was injected intratumorally with cholesterol-modified AGPG siRNA or Ctr siRNA (GenePharma) (250 nM / kg, twice per week), and the third and fourth groups were injected intraperitoneally with tamoxifen (20 mg / kg, twice per week). The mice were weighed and the size of the tumors was measured with a vernier caliper every week for six weeks. At the end of the tenth week, the mice were transferred to a dissecting room and sacrificed, and the subcutaneous tumors were dissected and weighed. The length and width of the tumors were measured, and the tumor size was calculated as (length * width2) / 2.

[0068] The results are shown in Figure B. AGPG shRNA and cholesterol-modified AGPG siRNA strongly inhibited tumor growth. Figure 4 B.

Claims

1. The application of AGPG inhibitors in the preparation of drugs for treating breast cancer, characterized in that, The AGPG sequence is shown in SEQ ID NO.1, the breast cancer is endocrine-resistant estrogen receptor-positive breast cancer, and the AGPG inhibitor is the small interfering RNA shown in SEQ ID NO.3 or SEQ ID NO.

4.

2. The application according to claim 1, characterized in that, The breast cancer mentioned is either tamoxifen-resistant estrogen receptor-positive breast cancer or fulvestrant-resistant estrogen receptor-positive breast cancer.

3. Application of AGPG inhibitors and anti-estrogenic drugs in the combined preparation of drugs for treating breast cancer, wherein the AGPG sequence is shown in SEQ ID NO.1, the breast cancer is endocrine-resistant estrogen receptor-positive breast cancer, and the AGPG inhibitor is a small interfering RNA shown in SEQ ID NO.3 or SEQ ID NO.

4.

4. The application according to claim 3, characterized in that, The breast cancer mentioned is either tamoxifen-resistant estrogen receptor-positive breast cancer or fulvestrant-resistant estrogen receptor-positive breast cancer.

5. The application according to claim 3, characterized in that, The anti-estrogenic drugs mentioned are tamoxifen or fulvestrant.

6. The application according to any one of claims 1 to 5, characterized in that, The small interfering RNA was modified with cholesterol.

Citation Information

Patent Citations

  • Application of molecular target in prognosis prediction and treatment of esophageal squamous cell carcinoma

    CN109735620A

  • SiRNA of targeting ARG2 gene and application of siRNA in improvement of breast cancer drug resistance

    CN115820647A