A biomarker for predicting unexplained recurrent spontaneous abortion and application thereof

Abstract

The application discloses a biomarker for predicting unexplained recurrent spontaneous abortion and application thereof, and belongs to the technical field of molecular diagnosis and molecular biology. By comparing serum detection of 45 unexplained recurrent spontaneous abortion patients, it is found that the expression level of miR-142-3p in the serum of the unexplained recurrent spontaneous abortion patients is obviously higher than that of normal pregnant women. Compared with the normal pregnant women, the peripheral blood CD4 + CD25 + Treg cell level of the unexplained recurrent spontaneous abortion patients is significantly increased. By detecting the expression level of miR-142-3p, the unexplained recurrent spontaneous abortion patients can be pre-judged, so that the miR-142-3p can be used as an important index for clinically diagnosing and evaluating unexplained recurrent spontaneous abortion.

Description

Technical Field

[0001] This invention relates to the fields of molecular diagnostics and molecular biology, and more specifically to a biomarker for predicting unexplained recurrent miscarriage and its application. Background Technology

[0002] Unexplained recurrent miscarriage refers to two or more consecutive spontaneous abortions with the same sexual partner, unrelated to chromosomal abnormalities, anatomical structures, endocrine disorders, autoimmune abnormalities, or reproductive tract diseases. It accounts for approximately 40% to 50% of all spontaneous abortions and is one of the most common pregnancy-related conditions among women of childbearing age. Early prediction and timely intervention may reduce the incidence of unexplained recurrent miscarriages.

[0003] Currently, clinical practice mainly relies on ultrasound indicators and serum biochemical markers to predict miscarriage. However, serum hCG and progesterone levels are not very effective in predicting miscarriage. Some literature reports that serum CA125 can be used to predict miscarriage, with a sensitivity of 90% and a specificity of 88%. However, serum CA125 levels are associated with various diseases, and its specificity for predicting miscarriage is not high. Other studies have found that fetal bradycardia among ultrasound indicators is an important indicator for predicting miscarriage, with a sensitivity of up to 84.18%. However, its sensitivity in predicting unexplained recurrent miscarriage is poor.

[0004] MicroRNAs (miRNAs) are a class of endogenous single-stranded non-coding RNAs of approximately 21-25 nucleotides found in animals and plants. Current reports indicate a significant correlation between serum miRNA levels and unexplained recurrent miscarriage. Therefore, this invention, starting with clinical samples, explores the correlation between immune dysfunction and serum miRNA levels and the pathogenesis of unexplained recurrent miscarriage, aiming to preliminarily clarify its pathogenesis and provide a reference for the clinical treatment of unexplained recurrent miscarriage.

[0005] In summary, how to provide a novel miRNA as a serum biomarker for predicting unexplained recurrent miscarriage is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides a biomarker for predicting unexplained recurrent miscarriage and its application.

[0007] Existing technologies mainly predict miscarriage through ultrasound indicators and serum biochemical marker levels. However, due to the poor effectiveness of serum hCG and progesterone levels in predicting miscarriage and the low sensitivity of fetal bradycardia in ultrasound indicators for predicting unexplained miscarriage, there is currently a lack of effective predictive indicators. This invention provides a biomarker for predicting unexplained recurrent miscarriage using serum extracellular miRNA and its application.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] A biomarker for predicting unexplained recurrent miscarriage, the biomarker being miR-142-3p, has the following nucleotide sequence:

[0010] AAGTGAATCCCAGCTGATAG, SEQ ID NO. 1.

[0011] Furthermore, miR-142-3p was obtained from the serum of patients with unexplained recurrent miscarriage before they had a miscarriage.

[0012] Compared to healthy individuals, patients with unexplained recurrent miscarriage showed upregulated expression of miR-142-3p in their serum.

[0013] The primer pairs used to detect the above biomarkers have the following nucleotide sequences:

[0014] Pre-primer: 5'-CGCCGTGTAGTGTTTCCTAC-3', SEQ ID NO.2;

[0015] Back primer: 5'-CAGTGCAGGGTCCGAGGT-3', SEQ ID NO.3.

[0016] This serum biomarker is particularly useful for predicting or assisting in the prediction, diagnosis, or diagnosis of adverse outcomes in patients with unexplained recurrent miscarriages before embryonic arrest.

[0017] The above-mentioned biomarkers are used in the preparation of products for predicting or diagnosing unexplained recurrent miscarriage.

[0018] Furthermore, the product includes a detection device for detecting the expression level of the biomarker based on high-throughput sequencing methods and / or quantitative PCR methods and / or probe hybridization methods.

[0019] Examples include detection devices, kits, and equipment, such as oligonucleotide probes or their integration, high-throughput miRNA detection chips on chip substrates or detection bases, and microfluidic detection chips.

[0020] As can be seen from the above technical solution, compared with the prior art, the beneficial effects achieved by the present invention are as follows:

[0021] 1. This invention uses transcriptomic sequencing of serum miRNAs from patients with unexplained recurrent miscarriage before miscarriage and from patients continuing pregnancy in early pregnancy to screen for differentially expressed miRNAs and verify them, demonstrating that serum miR-142-3p is a biomolecular marker for predicting unexplained recurrent miscarriage.

[0022] 2. The specimens collected in this invention are maternal peripheral blood before miscarriage, which can better predict adverse outcomes before embryonic arrest, allowing for timely intervention and treatment, and potentially reducing unnecessary embryo loss and thus improving pregnancy outcomes.

[0023] 3. This invention has found that miR-142-3p may be related to the mechanism of miscarriage, providing new ideas and evidence for future clinical treatment and intervention. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0025] Figure 1 For each group of CD4 in Embodiment 1 of the present invention + CD25 + The statistical results of Treg cell proportions were as follows: control group n=40, miscarriage group n=45, *P<0.05;

[0026] Figure 2 The values ​​of peripheral blood IFN-γ, IL-2, IL-4, and IL-10 cytokines in Example 1 of this invention are shown in Figure 1. *P < 0.05.

[0027] Figure 3 The expression level of miR-142-3p in peripheral blood in the control group and the miscarriage group in Example 1 of this invention is shown in Figure 1. ***P<0.001;

[0028] Figure 4 The images show ROC curves of patients with unexplained recurrent miscarriage and women with normal pregnancies in Example 1 of this invention. In the image, A is the ROC curve of miR-142-3p, and B is the ROC curve of progesterone. Detailed Implementation

[0029] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0030] The reagents required for this invention are conventional experimental reagents, purchased from commercially available channels; the experimental methods not mentioned are conventional experimental methods, and will not be described in detail here.

[0031] Example 1

[0032] 1. Inclusion and exclusion criteria for experimental subjects:

[0033] (a) Source of cases:

[0034] All cases were from 45 female patients with unexplained recurrent miscarriages who were treated at the outpatient and inpatient departments of the University of Chinese Academy of Sciences Shenzhen Hospital (Guangming) between September 2016 and December 2017. Blood samples from normal controls were obtained from women undergoing normal pregnancy checkups at the University of Chinese Academy of Sciences Shenzhen Hospital (Guangming), who were free from heart, brain, lung, liver, kidney diseases, thrombotic diseases, and any known diseases affecting the study indicators; a total of 40 cases were included.

[0035] (II) Selection Criteria:

[0036] ① Early miscarriages all occur within 3 months;

[0037] ② The number of consecutive spontaneous abortions has exceeded two or more;

[0038] ③ Both husband and wife have normal DNA chromosomes, and the male's semen is normal;

[0039] ④ Individuals with normal thyroid function, fasting blood glucose, and sex hormone secretion;

[0040] ⑤ The blocking antibody test was negative;

[0041] ⑥ Platelet aggregation test (PagT), D-dimer, coagulation series and other coagulation function indicators are all normal;

[0042] ⑦ No history of allergy to any of the test drugs;

[0043] ⑧ Those who have not participated in other drug clinical trials within the past month.

[0044] (III) Exclusion Criteria:

[0045] ① Those who do not meet the diagnostic criteria for unexplained recurrent miscarriage;

[0046] ② Individuals with concurrent endocrine system diseases, hematological diseases, infectious diseases, or malignant tumors;

[0047] ③ Individuals with concurrent diseases of the heart, liver, kidneys, or other organs;

[0048] ④ Individuals with concurrent genital tract infections such as chlamydia, mycoplasma, HIV, and syphilis;

[0049] ⑤ Those whose reproductive tract malformations are shown on ultrasound examination;

[0050] ⑥ Cases with missing clinical or pathological data;

[0051] ⑦ Subjects whose condition changes significantly during the trial should be excluded;

[0052] ⑧ Those whose family members do not accept the research method.

[0053] 2. Method:

[0054] (I) General Clinical Indicator Testing:

[0055] Demographic data, including age, height, weight, waist circumference, hip circumference, body mass index and waist-to-hip ratio, ethnicity, and occupation, were recorded and registered using methods such as inquiry and measurement.

[0056] (II) Flow cytometry detection of peripheral blood CD4 + CD25 + Treg cells:

[0057] Fasting venous blood was collected from volunteers in the morning and placed in heparin anticoagulant tubes. Red blood cell lysis buffer was added, and the tubes were incubated at 37°C for 2 min, centrifuged, and washed with PBS. 5 μL each of CD4-FITC and CD25-PE antibodies were added, and the tubes were incubated at room temperature in the dark for 20 min. 2 mL of cell staining buffer was added, and the tubes were centrifuged to remove the supernatant. 500 μL of cell staining buffer was added, and the tubes were analyzed by flow cytometry.

[0058] (III) ELISA method for detecting Th1 / Th2 cytokines:

[0059] Peripheral blood was collected, centrifuged for 10 minutes, and the supernatant was collected. The expression levels of IFN-γ, IL-2, IL-4, and IL-10 in both groups were determined using ELISA, strictly following the kit instructions. The main steps are as follows:

[0060] First, add 100 μL of sample release solution to each well, then add 50 μL of standard, positive or negative control, or test sample, and incubate with shaking at room temperature for 2 hours. After washing, add 200 μL of conjugated antibody, incubate with shaking at room temperature for 2 hours, wash again, add 200 μL of substrate reaction solution, incubate in the dark for 30 minutes, and then add 50 μL of stop solution to terminate the reaction. Measure the absorbance of each well using a microplate reader. Plot a standard curve based on the standard concentrations and absorbance values; calculate the concentrations of IFN-γ, IL-2, IL-4, and IL-10 in each sample based on the standard curve.

[0061] (iv) Detection of miR-142-3p in serum by quantitative real-time PCR:

[0062] Total RNA was extracted from serum using Trizol reagent, and RNA purity was determined using a spectrophotometer at 260 / 280. Then, 1 mg of RNA was reverse transcribed into cDNA. Real-time PCR was performed using a SYBR Green PCR kit on a Bio-Red C1000 microarray. Primer sequences are as follows:

[0063] miR-142-3p, front primer: 5'-CGCCGTGTAGTGTTTCCTAC-3', SEQ ID NO.2;

[0064] Back primer: 5'-CAGTGCAGGGTCCGAGGT-3', SEQ ID NO.3;

[0065] The universal reverse primer U6 was used as the endogenous standard. Quantitative analysis was performed using the ΔCt method.

[0066] 3. Experimental Results

[0067] (I) General Clinical Indicator Testing:

[0068] This study included 45 cases of unexplained recurrent miscarriage (pregnant but with failed pregnancy) and 40 cases of normal pregnancy (pregnant and successfully delivered). Statistical analysis of height, weight, body mass index, waist circumference, hip circumference, and waist-to-hip ratio (Table 1) revealed no significant differences in these factors between the two groups (P>0.05), suggesting that these factors are not related to the incidence of recurrent miscarriage.

[0069] Table 1. Basic clinical information of the study sample (mean ± SD)

[0070]

[0071]

[0072] (II) Flow cytometry detection of peripheral blood CD4 + CD25+ Treg cells:

[0073] CD4+ staining of peripheral blood in each group was performed using flow cytometry. + CD25 + The results of Treg cell detection are as follows: Figure 1 As shown. Control group CD4 + CD25 + The proportion of Treg cells was approximately (7.95±1.13)%, and the CD4+ cell count in the miscarriage group was... + CD25 + The proportion of Treg cells was approximately (4.06±1.53)%, with a significant difference between groups (P<0.05).

[0074] (III) ELISA method for detecting Th1 / Th2 cytokines:

[0075] Compared with the control group, the levels of IFN-γ and IL-2 were significantly increased in the miscarriage group (P<0.05), while the levels of IL-4 and IL-10 were significantly decreased (P<0.05). Figure 2 Meanwhile, the IFN-γ / IL-4 ratio in the control group was 0.41±0.15, while that in the miscarriage group was 0.89±0.21; the IL-2 / IL-10 ratio in the control group was 0.43±0.18, while that in the miscarriage group was 0.96±0.19. Both ratios showed significant differences between the two groups (P<0.05).

[0076] (iv) Detection of miR-142-3p in serum by quantitative real-time PCR:

[0077] Real-time quantitative PCR was performed to detect miR-142-3p in serum, and the expression levels of miR-142-3p in the serum of the normal group and the miscarriage group were compared. Results are as follows: Figure 3 As shown, the relative expression level of miR-142-3p in the serum of the miscarriage group (45 cases) (13.29±5.01) was significantly higher than that in the normal group (1.89±1.24), and the difference was statistically significant (P<0.001).

[0078] To increase the sample size, the concentration of miR-142-3p in peripheral blood was quantified by fluorescent PCR. ROC curves were plotted between peripheral blood miR-142-3p and the probability of unexplained recurrent miscarriage, and the AUC was calculated. Results are as follows: Figure 4As shown, the area under the ROC curve for miR-142-3p was 0.913, which was higher than that of progesterone (0.739), P < 0.05. A relative expression level of miR-142-3p above 13.29 was diagnostic of unexplained recurrent miscarriage; a relative expression level below 13.29 was not diagnostic of unexplained recurrent miscarriage; the diagnostic efficiency was 94.51%. It is believed that maternal serum miR-142-3p has high predictive value for the occurrence of recurrent miscarriage in patients with recurrent miscarriage.

[0079] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0080] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. The application of primer pairs for detecting biomarkers in the preparation of products for predicting or diagnosing unexplained recurrent miscarriage, characterized in that, The biomarker is miR-142-3p, and its nucleotide sequence is as follows: AAGTGAATCCCAGCTGATAG, SEQ ID NO.1; The nucleotide sequences of the primer pair are as follows: Pre-primer: 5'-CGCCGTGTAGTGTTTCCTAC-3', SEQ ID NO.2; Back primer: 5'-CAGTGCAGGGTCCGAGGT-3', SEQ ID NO.

3.

2. The application as described in claim 1, characterized in that, The product includes a detection device for detecting the expression level of the biomarker based on high-throughput sequencing and / or quantitative PCR and / or probe hybridization.

Images