Heterologous peptide production based on fluorescent fusion

Abstract

The present invention relates to a method for producing a heterologous polypeptide of interest in a host cell, wherein the method comprises expressing a fusion protein comprising a heterologous polypeptide of interest and a fluorescent fusion partner in a host cell, wherein the host cell is modified to include a nucleic acid encoding a cleavage protein operably linked to a promoter, wherein the translation of the cleavage protein is under the control of an RNA thermometer. Also provided is an E. coli cell, which expresses the fusion protein and includes a nucleic acid encoding a cleavage protein operably linked to a promoter, wherein the translation of the cleavage protein is regulated by an RNA thermometer.

Description

Background Art

[0001] The present invention relates to a method for producing a heterologous polypeptide of interest in a host cell, wherein the method comprises expressing a fusion protein comprising a heterologous polypeptide of interest and a fluorescent fusion partner in a host cell, the host cell being modified to comprise a nucleic acid encoding a lytic protein under the control of an RNA thermometer. The present invention further relates to an E. coli cell expressing the fusion protein and comprising a nucleic acid encoding a lytic protein under the control of an RNA thermometer.

[0002] Peptides are ubiquitous in physiological systems, performing functions that are essential for life. In human physiology alone, peptides act as hormones, neurotransmitters, growth factors, ion channel ligands, or antimicrobial agents, making them attractive therapeutic resources.

[0003] The increasing demand for new drugs and industrial enzymes, as a result of next generation sequencing, is creating a market for researchers looking at peptides or proteins that they wish to test for their pharmaceutical or industrial properties. In addition, the production of currently valuable recombinant proteins will always benefit from technologies that can increase yield and productivity. Therefore, technologies such as protein synthesis and heterologous protein expression are gaining application.

[0004] Peptides and small proteins of interest are often chemically synthesized, which yields much higher yields than heterologous expression. Although heterologous expression is a mature technology that utilizes heterologous hosts and is more suitable for high-yield production, it is still constrained by the elusive physical laws that guide protein folding or post-translational modifications. Therefore, it is obvious to many in this field that heterologous expression should work hand in hand with chemical synthesis to provide physical structures from genetic blueprints. However, biologically active proteins are challenging to express due to their inherent physical properties, which make them good candidates for drugs and enzymes from the beginning. Therefore, the expression of these proteins requires specific expertise and technology, which often leads to people tending to adopt multiple iterations of chemical synthesis or classical purification methods. Both methods will lead to an increase in the time and resources required for drug properties. The present invention aims to provide a robust and rapid platform to push the boundaries of heterologous expression in terms of target varieties and yields. Specifically, the inventors of the present application have developed a method for producing a variety of recombinant proteins. The method relies on three key technologies that are interrelated, making it versatile and cost-effective for increasing the yield of various recombinant proteins produced by it. The method of the present invention uses a fluorescent protein fusion partner designed to enable stable peptide expression, which broadens the capacity of E. coli by quenching toxicity, increasing solubility and promoting post-translational modifications. By providing unprecedented real-time in vivo and robust in vitro feedback, the autofluorescence of the fusion partner enables rapid optimization, which increases yield. In addition, post-transcriptional temperature regulation of self-cleavage reduces production costs, time and effort, making this method faster and more cost-effective than traditional methods. Using the method of the present invention, the inventors have demonstrated that it is possible to: 1) increase the range and yield of recombinant proteins that were previously thought to have no expression results; 2) simplify the optimization of expression through in vivo detection of fluorescent fusion proteins; 3) reduce the time for troubleshooting by the ability to quickly observe fluorescent proteins at any time during the production process; and 4) reduce protein production costs and increase yields by implementing autolysis techniques that do not require expensive inducers. Summary of the invention

[0005] The present invention relates to a method for producing a heterologous polypeptide of interest in a host cell, preferably an E. coli cell, comprising expressing a fusion protein comprising a heterologous polypeptide of interest and a fluorescent fusion partner in the host cell. Specifically, the host cell is modified to include a nucleic acid encoding a lytic protein under the control of an RNA thermometer. The present invention also relates to a modified E. coli cell expressing the fusion protein of the present invention and comprising a nucleic acid encoding a lytic protein under the control of an RNA thermometer.

[0006] According to a first aspect of the present invention, there is provided a method for producing one or more heterologous polypeptides of interest in a host cell, the method comprising or consisting of:

[0007] (i) providing an expression vector encoding a fusion protein, wherein the fusion protein comprises the heterologous polypeptide of interest and a fluorescent fusion partner;

[0008] (ii) transforming a host cell with the expression vector of step (i), wherein the host cell and / or the expression vector is modified to include a nucleic acid encoding a promoter (which may be constitutive, such as a stationary phase promoter, or inducible, such as a T7 promoter), the promoter being operably linked to a lytic protein and an RNA thermometer, further wherein expression of the nucleic acid encoding the lytic protein is regulated by the promoter, and translation of the lytic protein is regulated by the RNA thermometer;

[0009] (iii) expressing the fusion protein in a host cell;

[0010] (iv) changing the temperature of the host cell to induce expression of a lytic protein, wherein expression of the lytic protein results in lysis of the host cell; and

[0011] (v) recovering the fusion protein from the host cell.

[0012] Preferably, the nucleic acid encoding the RNA thermometer is transcriptionally fused to a promoter and transcriptionally or translationally fused to a nucleic acid encoding a lytic protein. More preferably, the nucleic acid encoding the RNA thermometer is located upstream of the nucleic acid encoding the lytic protein. In addition, the nucleic acids encoding the promoter, lytic protein, and RNA thermometer may include nucleotide sequences recognized by the RNA thermometer, such as nucleotide sequences naturally recognized and controlled by RNA.

[0013] In a first embodiment of the method, the fusion protein may include a purification tag, and the method may further include a step of purifying the recovered fusion protein. It will be appreciated by those skilled in the art that any known purification tag may be used. Preferably, the purification tag may be a histidine (His) tag for immobilized metal affinity chromatography (IMAC) purification or a glutathione S-transferase (GST) tag for pull-down assays. Alternatively, the fusion protein may include more than one purification tag, such as a histidine (His) tag for IMAC purification and a glutathione S-transferase (GST) tag for pull-down assays.

[0014] According to a second embodiment of the method of the present invention, the fusion protein may include a protease cleavage site, and the method may further include a step of cleaving the fluorescent fusion partner from the heterologous polypeptide of interest after recovery. It will be appreciated by those skilled in the art that any known protease cleavage site may be considered for cleavage by a protease. Specifically, the protease cleavage site can be selected from a WELQut site having an amino acid sequence WELQ (SEQ ID NO: 1) encoded by a nucleic acid having the sequence TGGGAACTGCAG (SEQ ID NO: 2), a thrombin or trypsin cleavage site, a nisP or trypsin cleavage site, a TEV cleavage site, a factor Xa cleavage site, and any combination thereof, wherein the WELQut site has an amino acid sequence WELQ (SEQ ID NO: 1) encoded by a nucleic acid having the sequence TGGGAACTGCAG (SEQ ID NO: 2), the thrombin or trypsin cleavage site has an amino acid sequence LVPR (SEQ ID NO: 3) encoded by a nucleic acid having the sequence CTAGTACCACGC (SEQ ID NO: 4), the nisP or trypsin cleavage site has an amino acid sequence ASPR (SEQ ID NO: 5) encoded by a nucleic acid having the sequence GCGAGCCCGCGC (SEQ ID NO: 6), the TEV cleavage site has an amino acid sequence ENLYFQG (SEQ ID NO: 7) encoded by a nucleic acid having the sequence GAAAACTTGTATTTTCAAGGC (SEQ ID NO: 8), the factor Xa cleavage site has an amino acid sequence IEGR (SEQ ID NO: 9) encoded by a nucleic acid having the sequence ATTGAAGGTCGT (SEQ ID NO: 10), ID NO:9).

[0015] In a third embodiment of the method of the present invention, the fusion protein may include a secretory peptide. The signal peptide that can be used may include, but is not limited to, those signal peptides that guide secretion through Sec (general secretion), SRP (signal recognition particles) or TAT (twin arginine translocation) pathways. For Sec-dependent secretion, sequences from LamB, MalE, OmpA, OmpF, OmpT or PhoA can be used. For SRP-dependent secretion, sequences from DsbA, SfmC, TolB or TorT can be used. For TAT-dependent secretion, the signal peptide can be variable, comprising a PRRxHH motif (wherein P, R, x and H represent polar residues, arginine, any residue and hydrophobic residue, respectively). The signal peptide may be homologous to Escherichia coli, or may be a heterologous sequence from other species (such as PelB (Erwinia carotovora) and SpA (Staphylococcus)).

[0016] According to a fourth embodiment of the method of the present invention, the fluorescent fusion partner is preferably monomeric and can be selected from green fluorescent protein, yellow fluorescent protein, blue fluorescent protein, cyan fluorescent protein and red fluorescent protein. It will be appreciated by those skilled in the art that a variety of fluorescent fusion proteins are known and any fluorescent fusion protein known in the art can be used. For example, the fluorescent fusion partner can be a green fluorescent protein having an amino acid sequence of SEQ ID NO: 11, or a green fluorescent protein encoded by a nucleic acid having a nucleotide sequence of SEQ ID NO: 12. Alternatively, the fluorescent fusion partner can be a red fluorescent protein, such as mCherry having an amino acid sequence of SEQ ID NO: 13, or mCherry encoded by a nucleic acid having a nucleotide sequence of SEQ ID NO: 14. It will be appreciated by those skilled in the art that the method of the present invention may include the step of detecting a fluorescent fusion partner at any point.

[0017] In a further embodiment of the method of the present invention, the heterologous polypeptide of interest can be any heterologous polypeptide of interest, in particular a heterologous polypeptide of interest selected from the following: lanthipeptides, including nisin, epilancin 15X and Pep5; bacteriocins, including plantaricin 423 and mundticin ST4SA; listeriolysin O; ActA; and autophagic peptide X.

[0018] In another embodiment of the method of the present invention, the lytic protein can be any lytic protein known in the art, for example, the lytic protein can be an endolysin or a bacterial murein hydrolase. In a non-limiting example, the lytic protein is derived from phage DNA and has an amino acid sequence of SEQ ID NO: 15 or 17, or is encoded by a nucleic acid having a nucleotide sequence of SEQ ID NO: 16 or 18.

[0019] In a further embodiment of the method of the present invention, the RNA thermometer may include, but is not limited to, an RNA thermometer having a nucleic acid sequence of any one of SEQ ID NOs: 19-27 or SEQ ID NOs: 105-111. The RNA thermometer may be naturally occurring, such as RNA thermometers found in lambda phage and bacteria, or may be synthesized as a new sequence. In addition, the use of a constitutive promoter (e.g., a stationary promoter) or an inducible promoter (e.g., T7) may be used to control the transcription of nucleic acids encoding RNA thermometers and cleavage genes. The use of a stationary promoter may result in a delay in the transcription of mRNA consisting of an RNA thermometer and a cleavage gene. This allows for improved mRNA stability, reducing the metabolic load of cells by delaying the expression of cleavage genes. A suitable stationary promoter may include a promoter having a nucleic acid sequence of any one of SEQ ID NOs: 74-76. In addition, a suitable combination of a promoter and an RNA thermometer may include a combination having a sequence as shown in any one of SEQ ID NOs: 77-100.

[0020] According to a further embodiment of the method of the invention, the host cell may be an E. coli cell.

[0021] According to a second aspect of the present invention, an E. coli cell is provided, comprising: (i) at least one expression vector encoding a fusion protein (including a vector having a sequence shown in SEQ ID NO: 101 or SEQ ID NO: -102), wherein the fusion protein comprises a heterologous polypeptide of interest and a fluorescent fusion partner; and (ii) a nucleic acid encoding a promoter operably linked to a lytic protein and an RNA thermometer, wherein the RNA thermometer is capable of regulating the translation of the lytic protein. In one embodiment, the nucleic acid in (ii) can be provided on an expression vector of (i). In an alternative embodiment, the nucleic acid of (ii) can be provided on a different expression vector that is compatible with the expression vector of (i) and co-transformed.

[0022] In the first embodiment of the cell of the present invention, the fusion protein can include a purification tag for purifying the fusion protein. It will be appreciated by those skilled in the art that any known purification tag can be used. Preferably, the purification tag can be a histidine (His) tag for IMAC purification or a glutathione S-transferase (GST) tag for pull-down assays. Alternatively, the fusion protein can include more than one purification tag, such as a histidine (His) tag for IMAC purification and a glutathione S-transferase (GST) tag for pull-down assays.

[0023] According to a second embodiment of the cell of the present invention, the fusion protein may include a protease cleavage site for cleaving the fluorescent fusion partner from the heterologous polypeptide of interest. It will be appreciated by those skilled in the art that any known protease cleavage site may be used for cleavage by a protease. Specifically, the protease cleavage site can be selected from a WELQut site having an amino acid sequence WELQ (SEQ ID NO: 1) encoded by a nucleic acid having the sequence TGGGAACTGCAG (SEQ ID NO: 2), a thrombin or trypsin cleavage site, a nisP or trypsin cleavage site, a TEV cleavage site, a factor Xa cleavage site, and any combination thereof, wherein the WELQut site has an amino acid sequence WELQ (SEQ ID NO: 1) encoded by a nucleic acid having the sequence TGGGAACTGCAG (SEQ ID NO: 2), the thrombin or trypsin cleavage site has an amino acid sequence LVPR (SEQ ID NO: 3) encoded by a nucleic acid having the sequence CTAGTACCACGC (SEQ ID NO: 4), the nisP or trypsin cleavage site has an amino acid sequence ASPR (SEQ ID NO: 5) encoded by a nucleic acid having the sequence GCGAGCCCGCGC (SEQ ID NO: 6), the TEV cleavage site has an amino acid sequence ENLYFQG (SEQ ID NO: 7) encoded by a nucleic acid having the sequence GAAAACTTGTATTTTCAAGGC (SEQ ID NO: 8), the factor Xa cleavage site has an amino acid sequence IEGR (SEQ ID NO: 9) encoded by a nucleic acid having the sequence ATTGAAGGTCGT (SEQ ID NO: 10), ID NO:9).

[0024] In a third embodiment of the cell of the invention, the fusion protein may include a secretory peptide.

[0025] According to a fourth embodiment of the cell of the present invention, the fluorescent fusion partner can be selected from green fluorescent protein, yellow fluorescent protein, blue fluorescent protein, cyan fluorescent protein and red fluorescent protein. It will be appreciated by those skilled in the art that a variety of fluorescent fusion proteins are known, and any fluorescent fusion protein known in the art can be used. For example, the fluorescent fusion partner can be a green fluorescent protein having an amino acid sequence of SEQ ID NO: 11, or a green fluorescent protein encoded by a nucleotide sequence of SEQ ID NO: 12. Alternatively, the fluorescent fusion partner can be a red fluorescent protein, such as mCherry having an amino acid sequence of SEQ ID NO: 13, or mCherry encoded by a nucleotide sequence of SEQ ID NO: 14.

[0026] In further embodiments of the cells of the present invention, the heterologous polypeptide of interest can be any heterologous polypeptide of interest, for example, a heterologous polypeptide of interest selected from the following: lanthipeptides, including nisin, epilancin 15X and Pep5; bacteriocins, including phytosporin 423 and montebellocin ST4SA; listeriolysin O; ActA; and autophagic peptide X.

[0027] According to a further embodiment of the cell of the present invention, the lytic protein can be any lytic protein known in the art, for example, the lytic protein can be an endolysin or a bacterial murein hydrolase. In a non-limiting example, the lytic protein is derived from a bacteriophage DNA and has an amino acid sequence of SEQ ID NO: 15 or 17 or is encoded by a nucleotide sequence of SEQ ID NO: 16 or 18.

[0028] In yet further embodiments of the cells of the invention, the RNA thermometer may include, but is not limited to, an RNA thermometer having a nucleic acid sequence of any one of SEQ ID NOs: 19-27 or SEQ ID NOs: 105-111. The RNA thermometer may be naturally occurring, such as RNA thermometers found in lambda phage and bacteria, or may be synthesized as a new sequence. The promoter controlling the expression of the RNA thermometer and the lytic protein may be a constitutive promoter (e.g., a stationary promoter having a sequence as shown in any one of SEQ ID NOs: 74-76), or an inducible promoter (e.g., T7). In addition, a suitable combination of a promoter and an RNA thermometer may include a combination having a sequence as shown in any one of SEQ ID NOs: 77-100.

[0029] According to a third aspect of the present invention, a kit is provided, which comprises or consists of: (i) at least one expression vector for expressing a fusion protein, wherein the fusion protein comprises a heterologous polypeptide of interest and a fluorescent fusion partner; and (ii) Escherichia coli cells, wherein the cells and / or the expression vector comprise a nucleic acid encoding a promoter (including a constitutive promoter (e.g., a stationary phase promoter) or an inducible promoter (e.g., T7), wherein the promoter is operably linked to a lytic protein and an RNA thermometer, wherein the RNA thermometer is capable of regulating the translation of the lytic protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Non-limiting embodiments of the present invention will now be described, by way of example only, with reference to the following drawings:

[0031] Figure 1: Schematic diagram of a method for producing a heterologous protein. A) Vector construction; B) Transformation; C) Expression; D) Cell lysis; E) Purification and F) Visualization. Nucleic acid molecules encoding a fluorescent fusion partner and a peptide of interest (PoI) are cloned into a vector. The vector is expressed in E. coli cells. Specifically, the expression of the fluorescent fusion partner is detected by monitoring the fluorescence of the fluorescent fusion partner, which provides an indication of the expression of the protein of interest. Once the peptide of interest accumulates, as indicated by the detected fluorescent fusion partner, the temperature-dependent expression of the lytic protein is initiated by increasing the temperature. The presence of the lytic protein causes the cell membrane to rupture, lysing the cells during freeze-thaw cycles, thereby releasing the peptide of interest and the fluorescent fusion partner. The peptide of interest and the fluorescent fusion partner can be optionally purified. The yield of the peptide of interest can be monitored by detecting the fluorescent fusion partner at all stages, including visualization of the purified product.

[0032] Figure 2 : Plasmid map of pRSF Duet-1, in which GFP is fused to the precursor nisin in MCS-1 and nisB in MCS-2. Relevant restriction sites and the WELQut protease site are indicated.

[0033] Figure 3 : Sequence of GFP-pNisin (SEQ ID NO:29 and SEQ ID NO:31), including relevant restriction sites and protease cleavage sites. The corresponding amino acid sequences (SEQ ID NO:28 and SEQ ID NO:30) are shown. The amino acid and nucleotide changes of the cleavage sites of hNisP (AVPR) and thrombin (ASPR) are shown. The GFP and nisin amino acid sequences are shown, wherein the nisin leader sequence is underlined.

[0034] Figure 4 : Optimization and activity results of GFP-pNisin and HispNisin cleaved with trypsin. (A) Temperature, induction time and IPTG concentration optimization for GFP-pNisin. (B) Activity of IMAC-purified and desalted soluble / insoluble E. coli fractions of HispNisin (without fluorescent fusion) expressed at different temperatures. Antibacterial activity against Lactobacillus sakei (Lb. sakei) was tested.

[0035] Figure 5 : Antibacterial activity of thrombin-cleaved GFP-pPep5 against S. carnosus (A), and antibacterial activity of soluble / insoluble E. coli fractions of IMAC-purified and desalted His-pPep5 against S. carnosus (B).

[0036] Figure 6 : Optimization of cleavage of GFP-pLanthipeptides using thrombin and hNisP. Cleavage of GFP-pPep5 after (A) 4 hours and (B) 20 hours, and cleavage of GFPpNisin after (C) 4 hours and (D) 20 hours, respectively. GFP-pPep5 activity was tested against S. carnivorans and GFP-pNisin activity was tested against L. sakei. hNisP was added at concentrations of 0.01, 5, 10, 50, and 70 ng / μL. Thrombin was added at 0.75, 4.5, 3, and 6 U.

[0037] Figure 7 : SDS-PAGE stained gel and GFP fluorescence imaging represents GFP-pNisin cleaved by thrombin and hNisP. For GFP-pNisin cleaved with a series of concentrations of (A) hNisP and (B) thrombin, the top image represents the stained gel and the bottom image represents the GFP fluorescence in the SDS-PAGE gel before fixation and staining. For GFP-pNisin cleaved at the optimal concentration of (C) hNisP and (D) thrombin, the left image represents the stained gel and the right image represents the fluorescence of GFP in the SDS-PAGE gel before fixation and staining (top), as well as the activity of the uncut and cleaved samples loaded into the gel (bottom). Activity against Lactobacillus sakei was tested. L = molecular weight size marker; UC = uncut sample; C = cleaved sample; 1 = uncut GFP-pNisin; 2 = cleaved GFP; and 3 = nisin.

[0038] Figure 8 : Plasmid map of pRSF-GFP-MunX for heterologous expression of GFP-MunX under T7 control. Munxin ST4SA was released using WELQut protease.

[0039] Fig. 9 : Amino acid sequence of GFP-MunX (SEQ ID NO: 32) and WELQut protease cleavage sequence indicated (grey arrow). The corresponding nucleotide sequence (SEQ ID NO: 33) is also shown.

[0040] Fig.10 : Plasmid map of pRSF-GFP-PlaX for heterologous expression of GFP-PlaX under T7 control. Phytocin 423 was released using WELQut protease.

[0041] Fig.11: Amino acid sequence of GFP-PlaX (SEQ ID NO: 34) and WELQut protease cleavage sequence indicated (grey arrow). The corresponding nucleotide sequence (SEQ ID NO: 35) is also shown.

[0042] Fig.12 : Fluorescence intensity of E. coli pRSF-GFP-MunEx expressing GFP-MunEx at 18°C, 26°C and 37°C. (A) In vivo fluorescence measurement after 0, 24 and 48 hours. (B) Total relative amount of GFP-MunEx expressed at 48 hours calculated after protein extraction and Ni-NTA purification. Fluorescence intensity is measured in relative fluorescence units (RFU). Different letters on the bars indicate that there are significant differences in the mean values ​​between each other (P<0.05) according to the Bonferroni post hoc test.

[0043] Fig.13 : Optimization of IPTG concentration for GFP-MunX expression at 26°C over time, fluorescence intensity measured as relative fluorescence units (RFU). (A) In vivo RFU measurements captured every 25 minutes, n=3 (biological triplicates measured in technical triplicates), each point represents the mean, with error bars representing SEM. (B) Comparison of average RFU output for GFP-MunX expression after 19 hours of incubation over the indicated IPTG concentration range. Arrows indicate Tukey's multiple comparison test results, indicating that 0.1 and 0.2 mM produced significantly higher RFU output than all others tested (P<0.05).

[0044] Fig.14 : Antimicrobial activity of phytosporin 423 and monserotin ST4SA at different WELQut:sample ratios. Antimicrobial activity of phytosporin 423 (A) and monserotin ST4SA (B) cleaved from Ni-NTA purified GFP-PlaX and GFP-MunX proteins, respectively. Cleavage was evaluated against Listeria monocytogenes (L. monocytogenes) using the spot plate technique. The cleavage ratio (mL:mL) of WELQut:sample is shown at the top of the figure. Cleavage was performed at 28°C for 16 hours. After cleavage, 100 mL of GFP-PlaX (A) and 10 mL of GFP-MunX (B) were spotted from each cleavage reaction. Uncut GFP-PlaX (A) and GFP-MunX (B) showed no anti-Listeria activity.

[0045] Fig.15: SDS-PAGE analysis of WELQut-cleaved GFP-PlaX (a, b) and GFP-MunX (c, d). (a, c) represent unstained SDS-PAGE gels photographed by fluorescence. (b, d) represent stained gels of (a, c). Lanes: 1 – molecular weight size marker, 2 – uncut sample, 3 to 6: WELQut-cleaved samples, sample ratios are shown. Band I – uncut GFP-PlantEx, II – putative WELQut and GFP complex, III – WELQut, IV – uncut GFP-MunX, V – putative WELQut and GFP complex, VI – WELQut.

[0046] Fig.16 : Anti-Listeria activity of released montenocillin ST4SA and phytocin 423 after cleavage was observed by SDS-PAGE separation. (a) Overlay of duplicate SDS-PAGE separations showing the size of the bands showing anti-Listeria activity. (b) Anti-Listeria SDS-PAGE overlay showing the activity of WELQut after cleavage, with its position relative to I–GFP-PlaX, II–GFP-MunX, III I-montenocillin ST4SA and IV-phytocin 423. (c) Position of the fluorescent bands in (a).

[0047] Fig.17 : HPLC purification and accurate mass determination of montersellin ST4SA released from GFP-MunX. (A) HPLC fractionation of GFP-MunX mixture cleaved by WELQut, with anti-Listeria activity identified in fractions 13 and 14. (B) Raw mass spectrum fragments showing the observed m / z isotopic envelope of montersellin ST4SA carrying +5 charges ([M+5H]C5, expected m / z 858.0232). The monoisotopic peak in (B) is indicated by an arrow, corresponding to an accurate mass measurement of 4258.1355 Da, which is consistent with the accurate mass of montersellin ST4SA with one disulfide bond (4285.0796 Da).

[0048] Fig.18: Top - SDS-PAGE of purified GFP-LLO and LLO used in the red blood cell lysis assay. Left: Stained gel. Right: GFP-LLO and GFP fluorescence imaging, L: Molecular weight size marker (NEB molecular weight size marker #P7712), 1: Uncut GFP-LLO, 2: Cut, IMAS purified and desalted LLO. A: GFP-LLO, B: LLO. Bottom - Red blood cell hemolysis after GFP-LLO exposure at different pH. Relative hemoglobin absorbance was collected at 540nm, values ​​are expressed as percentage of positive control, mean ± SEM (n = 3), analyzed by t-test to obtain * = p < 0.001, *** = p < 0.0001 vs untreated.

[0049] Fig.19 : SDS-PAGE of GFP-ActA-GST purification. Left: Stained gel, Right: Fluorescence imaging of GFP-ActA-GST and GFP. L: Molecular weight size marker (PageRuler #26632), 1: IMAC effluent, 2: IMAC eluate containing GFP-ActA-GST, 3: Dilution of IMAC eluate before GST purification, 4: effluent from GST column, 5: Eluate from GST column containing GFP-ActA-GST, 6: WELQut protease cleavage of GFP-ActA-GST eluted from GST column, 7: effluent from IMAC column containing ActA-GST after WELQut digestion, 8: Desalted and concentrated ActA-GST from IMAC effluent. A: GFP-ActA-GST, B: ActA-GST, C: GFP. Degradation products are shown in the box.

[0050] Fig. 20 : Optical density of cell cultures taken directly after removal from 18°C ​​expression temperature (initial). Subsequent readings taken after 3 hours, 6 hours and 9 hours of incubation at 26°C or 37°C. Optical density readings were read at 595nm using a microplate reader. Control GFP = cells carrying pRSFGFP expressing GFP. GFPRTGPR = cells carrying pTAPGFP-GPR expressing GFP and GpR regulated by the RNA thermometer. GFPGPR = cells carrying pRSFGFP-GpR expressing GFP and GpR.

[0051] Fig.21: Lysates of cells resuspended in lysis buffer after freeze-thaw cycles. After expression, cells incubated at 26°C or 37°C for 9 hours were frozen, allowed to thaw, resuspended in SB or SB supplemented with 1% SDS, and incubated at 37°C. Optical density readings were read at 595nm using a microplate reader. Control GFP = cells carrying pRSFGFP. GFPRTGPR = cells carrying pTAPGFP-GPR, GFPGPR = cells carrying pRSFGFP-GpR.

[0052] Fig. 22 : SDS PAGE analysis of small-scale His-tag purification. A) Stained SDS PAGE gel (arrows indicate bands corresponding to GFP). B) Fluorescence of GFP in the SDS PAGE from (A). 1 = molecular weight size marker; 2 = control GFP 26°C; 3 = control GFP 37°C; 4 = GFPRTGPR 26°C; 5 = GFPRTGPR 37°C; 6 = GFPGPR 26°C, and 7 = GFPGPR 37°C. C) Comparison of fold change in GFP band intensity between different samples. Band intensity was determined using ImageJ software. Images taken with FluorSee prototype using white light or blue light with an amber filter for fluorescence.

[0053] Fig.23 : SDS-PAGE stained gel and GFP fluorescence imaging showing GFPTATB and TATBmCherry. The left image is Coomassie stained gel; the right image was taken under blue light.

[0054] Fig.24 : Optical density readings of different E. coli constructs grown at 26°C (solid line) and 37°C (dashed line). Grey shaded blocks indicate samples grown at 26°C were moved to 37°C for an additional 5 hours of growth.

[0055] Fig.25 : Logarithmic plot of optical density readings of different E. coli constructs grown at 26°C (solid line) and 37°C (dashed line). Grey shaded blocks indicate samples grown at 26°C were moved to 37°C for an additional 5 hours of growth.

[0056] Fig.26 : Optical density readings of different E. coli constructs (after lysis) grown at different temperatures after one freeze-thaw cycle. 26°C (solid line) and 37°C (dashed line). Grey shaded blocks indicate samples grown at 26°C were moved to 37°C for an additional 5 hours of growth.

[0057] Fig. 27: Logarithmic optical density readings of different E. coli constructs (after lysis) grown at different temperatures after one freeze-thaw cycle. 26°C (solid line) and 37°C (dashed line). Grey shaded blocks indicate samples grown at 26°C were moved to 37°C for an additional 5 hours of growth.

[0058] Fig.28 : The percentage of lysis of sample G5 grown at different temperatures after one freeze-thaw cycle. The dashed squares indicate that the sample grown at 26°C was moved to 37°C for another 5 hours.

[0059] Fig.29 : The percentage of lysis of sample G8 grown at different temperatures after one freeze-thaw cycle. The dashed squares indicate that the sample grown at 26°C was moved to 37°C for another 5 hours.

[0060] Fig.30 : The percentage of lysis of sample G15 grown at different temperatures after one freeze-thaw cycle. The dashed squares indicate that the sample grown at 26°C was moved to 37°C for another 5 hours.

[0061] Fig.31 : The percentage of lysis of sample G17 grown at different temperatures after one freeze-thaw cycle. The dashed squares indicate that the sample grown at 26°C was moved to 37°C for another 5 hours.

[0062] Fig.32 : The percentage of lysis of sample G18 grown at different temperatures after one freeze-thaw cycle. The dashed squares indicate that the sample grown at 26°C was moved to 37°C for another 5 hours. DETAILED DESCRIPTION

[0063] The present invention now will be described more fully hereinafter with reference to the accompanying drawings, in which some, but not all embodiments of the invention are shown.

[0064] The invention described is not to be limited to the specific embodiments disclosed, and modifications and other embodiments are intended to be included within the scope of the invention. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

[0065] As used throughout this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0066] The terms and expressions used herein are for the purpose of description and should not be regarded as limiting. As used herein, the use of the terms "including," "comprising," "having," and "comprising" and variations thereof are meant to encompass the items listed thereafter and equivalents thereof as well as additional items.

[0067] The present invention relates to a method for producing a heterologous polypeptide of interest in a host cell, comprising expressing a fusion protein comprising a heterologous polypeptide of interest and a fluorescent fusion partner in the host cell. The host cell is modified to include a nucleic acid encoding a lytic protein. In order to reduce the metabolic burden of the lytic protein, the protein is controlled by an RNA thermometer. The present invention also relates to an Escherichia coli cell expressing the fusion protein and a nucleic acid encoding the lytic protein under the control of the RNA thermometer.

[0068] The inventors have shown that the use of GFP as a fusion partner provides several advantages in optimizing expression. This includes (i) increasing the contact time of the precursor peptide with the modifying enzymes in the cytoplasm, thereby generating more efficient post-translational modifications (PTMs); (ii) evaluating the potential for expression using in vivo fluorescence readouts, which can greatly reduce optimization time; and (iii) more accurately monitoring proteolytic cleavage by combining the fluorescence properties of the GFP fusion with SDS-PAGE analysis. The use of E. coli as an expression host provides additional advantages such as increased recombinant protein yields, rapid growth on inexpensive media, and access to extensively characterized expression strains and cloning tools. In addition, while expressing peptides with fusion partners redirects a portion of the metabolic flux away from peptide synthesis, in the case of toxic peptide production, the fusion increases overall yield by eliminating toxicity to E. coli. In addition, the use of an RNA thermometer also reduces the metabolic burden of including additional lytic genes required to lyse cells, since no additional recombinant proteins are required to control the temperature-dependent expression of lytic proteins. Another advantage of the method of the present invention is that the fluorescence maintained has been shown to provide clear visualization of the target protein throughout the expression, extraction, purification and analysis process, which allows for rapid optimization and troubleshooting. Fluorescence intensity can be used as a proxy to guide optimization because it is related to the amount of GFP fusion protein.

[0069] The method of the present invention is briefly described below:

[0070] Fusion protein vector design: By using standard cloning techniques, a fluorescent fusion partner (e.g., mCherry or green fluorescent protein (GFP)) is fused to a protein or peptide (PoI) of interest to obtain a fusion construct encoding a fluorescent fusion protein. The peptide of interest can be fused to the N-terminus or C-terminus of the fluorescent fusion partner. A specific protease cleavage site can be included between the fluorescent fusion partner and the peptide of interest. Any protease (e.g., WELQut, thrombin, TEV, NisP) can be used. The fluorescent fusion protein can also include a tag at the N-terminus and / or C-terminus of the fusion protein to facilitate purification. The tag can also be present in the fluorescent fusion protein. The tags that can be used include, but are not limited to, histidine tags (to facilitate purification using immobilized metal affinity chromatography (IMAC)), or glutathione S-transferase (GST) tags for pull-down assays. A protease site can also be included to remove the tag. In addition, the fluorescent fusion protein can include a specific secretion sequence to promote the secretion of the fusion protein so that it can be purified from the extracellular medium. The fusion construct is cloned into a vector. The vector may include a T7 promoter (e.g., pRSF / pACYC / pXH vector) for inducible expression using isopropyl β-d-1-thiogalactopyranoside (IPTG); or may be autoinducible using a specific medium. The vector may further include additional proteins (e.g., modification enzymes), or may be co-transformed with a compatible vector containing additional proteins for post-translational modification of the target peptide.

[0071] Cloning and Expression: The fusion protein vector is transformed into a heterologous expression host, E. coli BL21. Expression in E. coli BL21 is achieved by induction with IPTG at a specific bacterial optical density. In addition to IPTG, specific autoinduction media can be used, which can reduce the production cost of the recombinant protein and potentially increase the yield. Throughout the incubation period, the expression of the fusion protein can be monitored in vivo using a spectrophotometer or a custom detection system capable of measuring the fluorescence of the fusion protein partner.

[0072] Cell lysis: E. coli BL21 heterologous host is modified to include a lytic protein in its genome or on an expression vector. To obtain a fusion protein expressed intracellularly, a lytic protein (e.g., an endolysin or a bacterial murein hydrolase) is included to simplify the lysis method and reduce the cost of the lysis method. RNA thermometers are used to direct the temperature-dependent expression of lytic proteins in E. coli after transcription. The secondary structure formed by the RNA thermometer interferes with ribosome binding by blocking the ribosome binding site, thereby preventing the translation of mRNA into protein. Expensive inducers are not required because the expression of autolytic proteins depends on temperature-induced RNA transcript unwinding and subsequent translation. Depending on the RNA thermometer used, it can be strictly turned on or off, or it can act as a dimer at lower temperatures to reduce protein translation. RNA thermometers can be designed to respond to a range of different temperatures and can be customized according to the desired response. In addition, the use of constitutive promoters (e.g., stationary phase promoters) or inducible promoters (e.g., T7) can be used to control the transcription of nucleic acids encoding RNA thermometers and lytic genes. The use of a quiescent promoter causes the transcription of mRNA consisting of an RNA thermometer and a cleavage gene to be delayed. This will allow the stability of mRNA to be improved, reducing the metabolic load of the cell by delaying the expression of the cleavage gene. As monitored by detecting a fluorescent fusion partner, when the target protein expression occurs, the cell is incubated at a modified temperature to induce the translation of the cleavage protein. Alternatively, the cells can be harvested by centrifugation, resuspended in a cleavage-promoting buffer, and incubated at an elevated temperature to induce the translation of the cleavage protein. After the cleavage expression period, the cells can be harvested by centrifugation and frozen to further degrade the cell wall (<-20°C). The cells are then thawed, and if necessary, a buffer containing a detergent or cell permeabilization chemical (such as 1% SDS or 0.1% Triton X100) is added. In addition, other mechanical stresses or detergents can also be used to enhance cell lysis. The self-lysis guided by the RNA thermometer causes the cleavage protein to contact the cell peptidoglycan layer when the cell damage induced by the frozen cell is caused, thereby causing cell lysis. Centrifugation can be used to separate cell debris from the fusion protein, and the fusion protein can be purified subsequently.

[0073] Purification: Affinity chromatography can be used to achieve purification. The purification method used depends on the tag used. For His-tagged fusion proteins, immobilized metal affinity chromatography can be used. The most commonly used is nickel resin, which can bind to His-tagged proteins. In this purification, the protein is bound to the nickel resin and eluted by lowering the pH or using an increased concentration of imidazole. In an alternative embodiment, a glutathione S-transferase (GST) tag can be used in the fusion protein, in which case a glutathione resin with a high affinity for GST can be used. The GST fusion protein is removed from the resin using an increased concentration of reduced glutathione. Alternatively, two different tags can be used in the fusion protein, and one method can be used first in the double purification process, and then the fusion protein can be purified using another method. Importantly, the fluorescent properties of the fluorescent fusion partner can be used to monitor the fusion protein throughout the purification process. In most cases, the fusion protein can be directly observed (for example, in the case of GFP, by observing green fluorescence). The fusion protein can be artificially purified using one of the above methods, or any purification method known to those skilled in the art, supplemented by the ability to visualize the fusion protein. Alternatively, an automated system can be used to purify the fusion protein. The example of such an automated system can include, but is not limited to, a system capable of detecting protein and detecting fluorescent fusion partner protein at a wavelength of 254nm. The system can also include a variable speed peristaltic pump for controlling flow rate, and a detection system capable of measuring protein (wavelength of 254 nanometers) and fluorescent fusion partner after excitation. Depending on the fluorescent fusion partner used, specific excitation wavelengths and emission filters can be used to achieve excitation of the fluorescent fusion partner.

[0074] The purified protein can then be dialyzed to remove salts and placed in a suitable buffer. Purification methods such as cation exchange, anion exchange or hydrophobic interaction can also be used to further purify the recombinant protein.

[0075] Analysis and Visualization: Due to the nature of fluorescent fusion partners, they can be easily detected using the SDS PAGE method described in more detail herein. In one embodiment of this method, the fluorescent fusion partner portion of the fusion protein can be directly visualized using an LED transilluminator with appropriate LED wavelengths and filters.

[0076] As used herein, the terms "protein", "peptide" or "polypeptide" are used interchangeably to refer to any chain of two or more amino acids, including naturally occurring or non-naturally occurring amino acids or amino acid analogs, whether or not post-translationally modified (e.g., glycosylated or phosphorylated). Thus, amino acids are in a polymeric form of any length linked together by peptide bonds.

[0077] As used herein, the term "heterologous peptide of interest" or "peptide of interest" or "protein of interest" refers to any polypeptide that does not naturally occur in the host cell type. The heterologous polypeptide of interest is intended to be expressed in bacterial cells (e.g., E. coli cells) using the methods of the present invention. The methods of the present invention contemplate the production of viral proteins, bacterial toxins, and mammalian proteins. Non-limiting examples of heterologous polypeptides of interest can include: pharmacological polypeptides (e.g., for medical use, for cell and tissue culture) or industrial polypeptides (e.g., enzymes, growth factors) that can be produced according to the methods of the present invention. The heterologous polypeptides of interest can be used as or in vaccines, as well as in other reagents or diagnostic agents. Specifically, the heterologous polypeptides of interest can be polypeptides from viruses, including viral capsids and spike proteins of SARS-CoV, HIV proteins. Alternatively, the heterologous polypeptide of interest can be a bacterial toxin protein, including listeriolysin O; a mammalian protein, such as insulin or autophagy-inducing protein; an antibody, such as IgG; a cytokine, such as interleukin 10; a protease, including TEV protease from tobacco etch virus, NisP protease from Lactococcus lactis, a serine protease from Staphylococcus aureus; an antimicrobial peptide, such as antituberculosis and antilisterial peptides; an industrial enzyme, such as laccase; a molecular enzyme, including ligases, polymerases, restriction enzymes; and a cleavage enzyme for protein purification, such as endolysins.

[0078] As used herein, the term "fluorescent fusion partner" refers to a fluorescent peptide fused to the N-terminus of a heterologous polypeptide of interest, the C-terminus of a heterologous polypeptide of interest, or to each of the N-terminus and the C-terminus of a heterologous polypeptide of interest. In some embodiments, the "fluorescent fusion partner" of the present invention may include, but is not limited to, a fusion polypeptide including an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 11 or SEQ ID NO: 13.

[0079] As used herein, the term "fusion protein" refers to a polypeptide comprising at least a fluorescent fusion partner and a heterologous polypeptide of interest. The fusion protein of the present invention may also comprise additional amino acid sequences, including purification tags, protease cleavage sites, or secretion sequences. Another embodiment of the present invention includes, but is not limited to, a nucleic acid molecule encoding the above-mentioned fusion protein.

[0080] The fusion protein of the present invention can include a protease cleavage site, which allows the fluorescent fusion partner or purification tag to be separated from the heterologous polypeptide of interest. The protease cleavage site can be a recognition sequence for a site-specific protease. Many site-specific peptidases are known in the art, including many commercial proteases. These include, but are not limited to WELQut, thrombin, trypsin, nisP, Factor Xa, PreScission protease, enterokinase, V8 protease (Glu-C) and TEV.

[0081] In one embodiment of the present invention, the fusion protein may comprise a "purification tag". The purification tag may be a "poly-His tag" or "His tag", which refers herein to a linear sequence of histidine residues that allows purification of recombinant proteins by metal chelate affinity chromatography. Alternatively, the poly-His tag can be used to detect the recombinant polypeptide using an anti-poly-His tag antibody. The poly-His tag may comprise 6, 7, 8, 9 or 10 consecutive histidine residues. The purification tag may be a "GST tag". In addition, the fusion protein may include more than one tag, for example, but not limited to, a His tag and a GST tag for dual purification of the fusion protein.

[0082] As used herein, the term "transformed host cell" refers to a host cell that has been stably transformed to express a heterologous polypeptide (eg, a lytic protein) or a host cell that has been infiltrated with at least one expression vector that transiently expresses a heterologous polypeptide in the host cell.

[0083] As used herein, the term "lytic protein" refers to a protein that causes cell membrane destruction and leads to cell lysis. Many lytic proteins are known in the art. These include, for example, endolysins and bacterial murein hydrolases expressed by phages or prophages. Examples include, but are not limited to lysozymes, GpRs with an amino acid sequence of SEQ ID NO: 15 (encoded by the nucleotide sequence of SEQ ID NO: 16), and GpEs with an amino acid sequence of SEQ ID NO: 17 (encoded by the nucleotide sequence of SEQ ID NO: 18). Lytic enzyme proteins are based on a drilling enzyme (holing)-endolysin system, which is composed of a protein that forms a pore and an enzyme that degrades the cell wall. Cell wall degrading proteins are expressed and present in the cytoplasm in their active form, and only when the drilling enzyme that forms the pores produces pores, allowing endolysins to enter the periplasmic space where they can begin to degrade the cell wall, can cell wall degrading proteins begin to degrade the cell wall. This system is ideal for use in the present invention as it allows the expression of endolysins which would remain inert in the cytoplasm until they are able to encounter the cell wall.

[0084] The expression of lytic protein can be temperature-dependent, for example, the expression of lytic protein can be regulated by RNA thermometer. As used herein, the term "RNA thermometer" refers to a temperature-sensitive non-coding RNA molecule that regulates the expression of lytic protein in response to temperature changes. According to the RNA thermometer, it can be strictly opened or closed in the selected temperature, or it can be used as a dimer to reduce the translation of protein at a lower temperature. The RNA thermometer can be designed to respond to a series of different temperatures and can be customized according to the response required. Using a constitutive promoter (for example, a stationary phase promoter) or an inducible promoter (for example, T7) can be used to control the transcription of nucleic acids encoding RNA thermometers and lytic genes. Using a stationary phase promoter can cause the transcription of the mRNA composed of RNA thermometers and lytic genes to be delayed. This will allow the stability of mRNA to be improved, and the metabolic load of cells is reduced by delaying the expression of lytic genes. The stationary phase promoter is a promoter that is more active in the later stages of bacterial growth (including late exponential and stationary phases).

[0085] The terms "nucleic acid", "nucleic acid molecule" and "polynucleotide" are used interchangeably herein and encompass ribonucleotides (RNA) and deoxyribonucleotides (DNA), including cDNA, genomic DNA and synthetic DNA. Nucleic acids can be double-stranded or single-stranded. When the nucleic acid is single-stranded, the nucleic acid can be a sense strand or an antisense strand. A nucleic acid molecule can be any chain of two or more covalently bonded nucleotides, including naturally occurring or non-naturally occurring nucleotides, or nucleotide analogs or derivatives. The term "DNA" refers to a sequence of two or more covalently bonded, naturally occurring or modified deoxyribonucleotides.

[0086] As used herein, the term "isolated" means having been removed from its natural environment.

[0087] The term "purified" relates to an isolated molecule or compound in a form that is substantially free of contaminants or contaminants. Contaminants are normally associated with molecules or compounds in their natural environment, and thus purification means an increase in purity due to separation from other components of the original composition. The term "purified nucleic acid" describes a nucleic acid sequence that has been separated from other compounds, including, but not limited to, polypeptides, lipids, and carbohydrates that are normally associated with the nucleic acid in its natural state.

[0088] The term "complementary" refers to two nucleic acid molecules that can form Watson-Crick base pairs to produce a double-stranded region between two nucleic acid molecules. It will be appreciated by those skilled in the art that each nucleotide in a nucleic acid molecule need not form a matching Watson-Crick base pair with a nucleotide in an opposite complementary strand to form a duplex. Therefore, if under high stringency conditions, a nucleic acid molecule hybridizes with a second nucleic acid molecule, the nucleic acid molecule is "complementary" to the second nucleic acid molecule. Nucleic acid molecules according to the present invention include two complementary molecules.

[0089] As used herein, "substantially identical" sequences refer to amino acid or nucleotide sequences that have one or more conservative substitutions, or one or more non-conservative substitutions, deletions or insertions with reference sequences only at certain positions of the sequence, which do not destroy or significantly reduce the antigenicity of one or more expressed fusion proteins or polypeptides encoded by nucleic acid molecules. The comparison for the purpose of determining sequence identity percentage can be achieved by various means within the knowledge of those skilled in the art. These include, for example, the use of computer software such as ALIGN, Megalign (DNASTAR), CLUSTALW or BLAST software. Those skilled in the art can easily determine the appropriate parameters for measuring the comparison, including any algorithm required for maximum comparison on the full length of the sequence compared. In one embodiment of the invention, a polypeptide or polynucleotide sequence is provided which has at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% sequence identity to the sequences described herein.

[0090] Alternatively or in addition, two nucleic acid sequences may be "substantially identical" if they hybridize under highly stringent conditions. The "stringency" of a hybridization reaction can be readily determined by one of ordinary skill in the art, and is typically an empirical calculation that depends on probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes require lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. A typical example of such "stringent" hybridization conditions is hybridization at 65°C with gentle shaking for 18 hours, a first wash at 65°C for 12 minutes in wash buffer A (0.5% SDS; 2×SSC), and a second wash at 65°C for 10 minutes in wash buffer B (0.1% SDS; 0.5% SSC).

[0091] Polypeptides, peptides and peptide analogs can be prepared from their corresponding nucleic acid molecules using recombinant DNA technology.

[0092] As used herein, the term "gene" refers to a nucleic acid encoding a functional product (eg, RNA, polypeptide, or protein). A gene may include regulatory sequences upstream or downstream of the sequence encoding the functional product.

[0093] As used herein, the term "coding sequence" refers to a nucleic acid sequence that encodes a specific amino acid sequence. On the other hand, a "regulatory sequence" refers to a nucleotide sequence located upstream, downstream or within a coding sequence. In general, a regulatory sequence affects the transcription, RNA processing or stability or translation of the associated coding sequence. Regulatory sequences include, but are not limited to: effector binding sites, enhancers, introns, polyadenylation recognition sequences, promoters, RNA processing sites, stem-loop structures, translation leader sequences, etc.

[0094] In some embodiments, the nucleic acid molecules used in the inventive method can be operably connected to other sequences. "Operably connected" refers to that the nucleic acid molecules encoding the fusion protein of the present invention and the regulating sequence are connected in such a way that the expression of the protein is allowed when the appropriate molecule is combined with the regulating sequence. This operably connected sequence can be included in a vector or expression construct that can be transformed or transfected into a host cell for expression. It should be understood that any one or more vectors can be used for the purpose of expressing the fusion protein of the present invention.

[0095] The term "promoter" refers to a DNA sequence that can control the expression of a nucleic acid coding sequence or a functional RNA. A promoter can be based entirely on a natural gene, or it can be composed of different elements of different promoters found in nature. Different promoters can direct the expression of a gene in different cell types, or at different developmental stages, or in response to different environmental or physiological conditions. A "constitutive promoter" is a promoter that directs the expression of a gene of interest in most host cell types, at most times, or at certain growth stages.

[0096] The term "recombinant" means that something has been recombined. When used with respect to a nucleic acid construct, the term refers to a molecule comprising a nucleic acid sequence that is linked together or produced by molecular biological techniques. The term "recombinant" when used for a protein or polypeptide refers to a protein or polypeptide molecule expressed from a recombinant nucleic acid construct produced by molecular biological techniques. A recombinant nucleic acid construct may include a nucleotide sequence that is connected to or manipulated to be connected to a nucleic acid sequence that is not naturally connected, or a nucleic acid sequence that is naturally connected at a different position. Therefore, a recombinant nucleic acid construct indicates that the nucleic acid molecule has been manipulated using genetic engineering, i.e., by human intervention. A recombinant nucleic acid construct may be introduced into a host cell by transformation. Such recombinant nucleic acid constructs may include sequences derived from the same host cell species or different host cell species.

[0097] The term "vector" refers to a mode in which a polynucleotide or gene sequence can be introduced into a cell. Various types of vectors are known in the art, including plasmids, viruses, bacteriophages and cosmids. Typically, a polynucleotide or gene sequence is introduced into a vector by a box. The term "box" refers to a polynucleotide or gene sequence expressed from a vector, for example, a polynucleotide or gene sequence encoding a fusion protein of the present invention. The box typically comprises a gene sequence inserted into a vector, which in some embodiments provides a regulatory sequence for expressing a fluorescent fusion protein. In other embodiments, the vector provides a regulatory sequence for expressing an acetyltransferase polypeptide. In further embodiments, the vector provides some regulatory sequences, and nucleotides or gene sequences provide other regulatory sequences." Regulatory sequences" include, but are not limited to, promoters, transcription termination sequences, enhancers, splicing acceptors, donor sequences, introns, ribosome binding sequences, poly (A) addition sequences and / or the origin of replication.

[0098] In some embodiments, a fusion protein or composition according to the invention can be provided in a kit together with instructions for use.

[0099] The following examples are provided for purposes of illustration and not limitation (all buffer compositions are listed in Table 7).

[0100] Example 1

[0101] Heterologous Expression of GFP-fused Class I Lanthipeptides in Escherichia coli

[0102] Construction of pRSFGFP-NisB backbone and pACYC-NisC

[0103] All PCR primers used in this example are provided in Table 1 below. Table 2 provides a description of each plasmid used or generated in this example. To construct plasmid pRSFGFP, the mgfp5 gene (primers = SEQ ID NOs: 41 and 42) (from Michela Lizier, Addgene plasmid #27169) was amplified from pTRKH3-ermGFP (a plasmid containing GFP, Ery) by PCR. The PCR product and pRSF Duet-1 were digested with BamHI / PstI and connected using T4 ligase. This produced a GFP fused to a His tag with a C-terminal WELQ site. Using Lactococcus lactis gDNA as a template, nisB and nisC genes were amplified by PCR (primers = SEQ ID NOs: 45-48).

[0104] The PCR products of nisC and nisB were cloned into pACYC Duet-1 and pRSFGFP as BglII / XhoI fragments, respectively. The constructs were transformed into chemically competent Escherichia coli BL21 (DE3) and plated on Luria-Bertani (LB) agar, which was supplemented with kanamycin (50 μg / mL) or chloramphenicol (25 μg / mL) as the selective antibiotics for pRSF and pACYC constructs, respectively. Single colonies were selected for inoculation with LB broth supplemented with the corresponding antibiotics, and incubated overnight at 30°C. Plasmid DNA was separated for sequencing reactions (Central Analysis Facility, CAF, University of Stellenbosch), cloning and transformation.

[0105] Construction of strains expressing lanthipeptides

[0106] The nisA gene was amplified by PCR using Lactococcus lactis genomic DNA as a template. Pep5 and epilancin 15× were amplified using their respective primers (Table 1). The forward primers used to amplify Pep5 and epilancin 15× incorporated 5' overhangs homologous to the 3' region of the nisin leader sequence. The nisin leader sequence was amplified by PCR using Lactococcus lactis DNA as a template using primers 9 (SEQ ID NO:49) and 14 (SEQ ID NO:54) in Table 1 below, wherein the reverse primer incorporated a nucleotide sequence encoding a thrombin protease site (S-3V).

[0107] For fusion PCR, the nisin leader sequence PCR product and the corresponding Pep5 / epilancin 15× PCR product (using primers 10-11 (SEQ ID NO:50-51) and 12-13 (SEQ ID NO:52-53), respectively) were mixed, and primers 9 and 11 (SEQ ID NO:49 and SEQ ID NO:51) were used to amplify Pep5, or primers 9 and 13 (SEQ ID NO:49 and SEQ ID NO:53) were used to amplify epilancin 15×. The final fusion PCR resulted in the fusion of the core lanthipeptide with the nisin leader sequence. The final fused precursor lanthipeptides (pLanthipeptides) and pRSF Duet-1 were digested with PstI / HindIII and ligated using T4 ligase. pLanthipeptides in pRSF was digested with PstI / NotI and ligated to the corresponding sites in pRSFGFP-NisB.

[0108] The protease site in precursor Pep5 (pPep5) and precursor epilancin 15× (pEpilancin 15×) was also changed from thrombin (AVPR) to hNisP site (ASPR) by fusion PCR. Template DNA was from the corresponding pRSFGFP-pLanthipeptides-NisB construct with thrombin protease site. The nisin leader sequence was amplified using primers 9 (SEQ ID NO:49) and 16 (SEQ ID NO:56), and the reverse primer produced a nucleotide substitution from GTA (valine) to TCA (serine). Each core peptide was amplified using forward primer 15 (SEQ ID NO:55) and its respective reverse primer (SEQ ID NO:51 for Pep5 and SEQ ID NO:53 for epilancin 15×). The PCR products of the leader peptide and the core peptide were mixed and fusion PCR was performed using the forward primer (SEQ ID NO:50) of the nisin leader sequence and the reverse primer of each peptide. The final product was digested and ligated as above to obtain pRSF-GFPpNisin-NisB ( Figure 2 and Figure 3 ).

[0109] As described above, the replacement of the thrombin site with the NisP site in the prenisin construct was achieved using fusion PCR. The primer combination used included primer 9 (SEQ ID NO:49) and primer 18 (SEQ ID NO:58); primer 17 (SEQ ID NO:57) and primer 4 (SEQ ID NO:44); and primer 9 (SEQ ID NO:49) and primer 4 (SEQ ID NO:44), using pRSFGFPpNisin-NisB pDNA as a template.

[0110] The resulting constructs were transformed into chemically competent E. coli BL21 (DE3) and plated on LB agar supplemented with kanamycin (50 μg / mL). Single colonies were selected for inoculation with LB broth supplemented with kanamycin (50 μg / mL) and incubated overnight at 30°C. Plasmid DNA was isolated for subsequent sequencing reactions (CAF, Stellenbosch) and cloning / conversion. Subsequently, each construct was co-transformed with pACYCNisC into chemically competent E. coli BL21 (DE3) cells, plated on LB agar supplemented with kanamycin (50 μg / mL) and chloramphenicol (25 μg / mL), and incubated overnight at 30°C. Single colonies were isolated for subsequent expression experiments.

[0111] As described above, the inventors of the present invention have therefore created a backbone plasmid ( Figure 2 and Figure 3 ).

[0112] Construction of His-pLanthipeptides without GFP tag was performed. Briefly, the nisA gene was amplified from Lactococcus lactis gDNA, and nisB and nisC were amplified and cloned as described previously. To generate His-prePep5 and His-preEpilancin15×, the respective pLanthipeptides were amplified from pRSFGFP-pPep5Th-NisB / pEpilancin15XTh-NisB using forward primer 3 (SEQ ID NO:43) and reverse primers for Pep5 (SEQ ID NO:51) and Epilancin 15× (SEQ ID NO:53). The respective PCR products and pRSF Duet-1 were digested with BamHI / HindIII and ligated using T4 ligase to generate pre-lanthipeptides with a His tag at the N-terminus. His-pLanthipeptides were digested with BamHI / NotI in pRSF and ligated to the corresponding sites in pRSF-NisB. Transformation and cell culture were performed as described above.

[0113] Table 1: Primers used for expression of GFP-fused class I lanthipeptides in E. coli.

[0114]

[0115]

[0116] Table 2: Vectors used for expression of GFP-fused class I lanthipeptides in E. coli.

[0117]

[0118]

[0119]

[0120] Optimization of GFP-pNisin expression

[0121] In all cases, an overnight culture of pRSFGFP-pNisin E. coli BL21 (DE3) was used to inoculate (1.0% v / v) flasks containing 200 mL of TB broth supplemented with kanamycin (50 μg / mL) and chloramphenicol (25 μg / mL). The cultures were incubated at 37°C until OD 600nmReach 0.6, induce and further incubate. For temperature, the culture was induced with 1 mM IPTG and further incubated for 48 hours at 4 different temperatures (18°C, 26°C, 30°C or 37°C). IPTG concentration was evaluated at 4 different concentrations (0.1 mM, 0.25 mM, 0.5 mM and 1 mM), and the induced culture was incubated at 26°C for 24 hours. At 26°C, incubation after induction (1 mM IPTG) was evaluated at three different times (12 hours, 24 hours and 48 hours). The cells were lysed, purified, and tested for activity.

[0122] Expression and purification of His-pLanthipeptide without GFP fusion

[0123] E. coli BL21 (DE3) co-transformed with pRSF-His-pLanthipeptides-NisB and pACYC-NisC were incubated overnight at 30°C in LB broth supplemented with kanamycin (50 μg / mL) and chloramphenicol (25 μg / mL) under aeration. Overnight cultures were used to inoculate (1.0% v / v) 100 mL of TB medium (TB) supplemented with antibiotics. These cultures were incubated at 37°C under aeration until OD 600 The expression of His-pNisin culture was performed at 18°C, 26°C and 37°C (overnight), and His-pPep5 / pEpilancin15X culture was performed at 18°C ​​(overnight). After expression, the cells were harvested by centrifugation (6164×g, 20 minutes, 4°C).

[0124] For the soluble part, the cell pellet was resuspended in 10mL SB supplemented with lysozyme (1mg / mL), protease inhibitors, DNAse (1U / mL) and RNAse (6U / mL). The cells were incubated on ice for 30 minutes, followed by ultrasonic disruption on ice (70% power output 3 times, 50% pulse 3 minutes). The lysed sample was centrifuged at 4°C for 60 minutes at 15870 × g. The resulting supernatant was used to purify the soluble fraction, and the precipitate was resuspended in 10mL of starting buffer urea (SBU: 50mM Tris, 500mM sodium chloride, 8M urea, pH 8.0). The resuspended precipitate was lysed at room temperature for 30 minutes, then ultrasonicated, and centrifuged at 4°C for 60 minutes at 15870 × g. According to the manufacturer's instructions, protein purification was achieved using a pre-loaded HisTrapHP column using an AKTA Purifier purification system. The resulting eluate was desalted for PBS buffer using a pre-loaded Sephadex G25 column. The desalted samples were used for subsequent activity assays and SDS PAGE gel separation.

[0125] Initial antimicrobial activity

[0126] For the initial antibacterial efficacy test, GFP-fused and non-GFP-fused pLanthipeptides were loaded (GFP-pNisin and GFP-pPep5) and cut directly in the wells with trypsin (5 μg / mL for GFPpNisin) or thrombin (3U / 100 μL for GFP-pPep5). The antibacterial activity against Lactobacillus sakei was evaluated for nisin, and the antibacterial activity against Streptococcus carnosus was evaluated for GFP-pPep5. The plates were incubated overnight at 30°C until visible transparent areas were observed. Lactobacillus sakei was cultured in MRS broth or agar, and Streptococcus carnosus was cultured in Mueller Hinton broth or agar.

[0127] Based on the activity data, it was first determined that GFP-pNisin was successfully expressed (i.e., modified) in E. coli and secondly that the expression was robust, as activity was detected when expression was performed over a range of temperatures, induction times, and IPTG concentrations. The highest activity was observed for His-tagged precursor nisin (HispNisin) purified from both soluble and insoluble fractions when expression was performed at 18°C ​​(after cleavage with trypsin). A decrease and a significant loss of activity were observed when expression was performed at 26°C and 37°C, respectively. Figure 4 ). However, separation of soluble and insoluble fractions using SDS-PAGE electrophoresis showed that higher levels of His-pNisin could be obtained at higher temperatures. Due to increased expression rates and possible toxicity, the His-tagged precursor peptides were sequestered in inclusion bodies, which reduced the contact time with the corresponding modifying enzymes. In the case of GFP-pNisin, the highest activity was observed at 26 °C (after release of the core peptide) ( Figure 4 )-This may be due to the increased contact time with the corresponding modification enzyme in the cytosol, even at higher temperatures, leading to more efficient dehydration and cyclization reactions. Preliminary yield results show that using the present invention, ~1.99 mg / L of antimicrobial active nisin can be obtained after 48 hours of induction (after cleavage with nisin protease (NisP) and HPLC purification). According to ESI-MS, ~0.67-1.08 mg / L of the antimicrobial active product obtained is equivalent to fully modified nisin.

[0128] Activity was detected after GFP-pPep5 was cleaved with thrombin, but no activity was detected without cleavage ( Figure 5). After cleavage and purification, fully modified Pep5 could also be detected (using ESI-MS).

[0129] Protease digestion

[0130] Protease digestion of the peptides was used to determine whether scarless cleavage of the core peptide from its respective GFP-leader peptide fusion could be achieved. This is an important aspect to consider when heterologous expression is used to produce lanthipeptides or when fusion tags are used. Several commercial proteases are capable of scarless cleavage, but are expensive and may not be able to cleave efficiently near the PTM. Therefore, the inventors evaluated the ability of NisP in cleaving precursor lanthipeptides fused to GFP (GFP-pLanthipeptides).

[0131] GFP-pLanthipeptides were cleaved with thrombin or hNisP for 4 hours and 20 hours at 37°C. Heterologously expressed hNisP was added at concentrations of 0.01ng / μL, 5ng / μL, 10ng / μL, 50ng / μL and 70ng / μL. Thrombin was added at 0.75U, 4.5U, 3U and 6U. The cleavage reaction was performed in a 100μL reaction, and the protein concentration of GFP-pLanthipeptides was adjusted to a final concentration of 1mg / mL, except for GFP-pPep5Th, which was adjusted to 0.9mg / mL. The cleavage reaction was terminated by adding protease inhibitors. The antibacterial activity of GFP-pNisin (30μL) and GFP-pPep5 (80μL) against Lactobacillus sakei and Streptococcus carnosus was evaluated, respectively. The plate was incubated overnight at 30°C until a visible transparent area was observed. The samples were separated using SDS-PAGE.

[0132] Cleavage with thrombin and hNisP resulted in the release of active lanthipeptides after 4 and 20 hours of cleavage ( Figure 6 Interestingly, increasing concentrations of thrombin and hNisP as well as cleavage time adversely affected the antimicrobial activity of Pep5, most likely due to the presence of a nonspecific hNisP cleavage site within the core peptide that is not protected by a lanthionine / methyllanthionine bridge.

[0133] SDS-PAGE

[0134] To visualize GFP fluorescence after electrophoretic separation, the samples were not boiled in sample buffer, but incubated at 37°C for 30 minutes. Subsequently, 7 μL of sample was loaded into the wells of a 20% tricine SDS-PAGE gel. In order to reduce heat generation and help separate smaller peptides, the SDS-PAGE gel was run at 8°C. To visualize GFP fluorescence in SDS-PAGE gels, the samples were exposed to UV light (312 nm) and directly photographed using a digital camera or MiniBIS Pro DNR Bioimaging System (DNR Bioimaging System, Israel). After UV imaging, the gel was washed with dH2O and fixed in 5% (v / v) glutaraldehyde for 1 hour. After fixation, the gel was washed with dH2O and stained with blue silver Coomassie stain until the protein bands were visible.

[0135] Traditionally, cleavage efficiency would be evaluated using SDS-PAGE. However, traditional staining methods do not always provide a clear picture of cleavage efficiency. The inventors of the present invention have proposed an alternative evaluation method that makes this possible using GFP fusion. Taking advantage of the fluorescent properties of GFP-pNisin, by using UV imaging and traditional Coomassie staining, the cleavage efficiency can be more clearly observed by tracking the migration of cleaved and uncleaved GFP-pNisin ( Figure 7 Using this combined approach, the inventors were able to clearly distinguish uncleaved and cleaved GFP-pNisin from background proteins by superimposing UV and staining images. Two fluorescent bands were detected in the uncleaved sample, but this does not mean that GFPpNisin was partially cleaved, because there was no antibacterial activity in the uncleaved sample ( Figure 7 C and Figure 7 D). Satisfactory cleavage of GFP-pNisin was observed in the presence of tested concentrations of thrombin and hNisP ( Figure 7 A and Figure 7 B).

[0136] Using the methods described in Example 1 above, the inventors expressed post-translationally modified lanthipeptides with antimicrobial activity. The inventors also demonstrated the potential for expressing other modifying enzymes as well as fluorescently fused PoIs, where the fluorescent fusion does not interfere with the activity of the modifying enzyme. In addition, the inventors demonstrated the successful release of active lanthipeptides from lanthipeptide fluorescent fusion partners using proteases (using at least two different proteases).

[0137] Example 2

[0138] Heterologous expression of subclass IIa bacteriocins fused to GFP in Escherichia coli

[0139] Construction of GFP-bacteriocin expression vectors for phytosporin 423 and monteronicin ST4SA

[0140] All PCR primers used in this example are provided in Table 3 below. Table 4 provides a description of each plasmid used or generated in this example. The same pRSFGFP backbone plasmid as described in Example 1 was used here.

[0141] Genomic DNA from Lactobacillus plantarum 423 and E. mundtii ST4SA was used as template to amplify the bacteriocin genes of mature phytocin 423 and munston ST4SA using GFP-PlaX_Pst_Fwd / GFP-PlaX_Hind_Rev (SEQ ID NO: 59 and SEQ ID NO: 60) and GFP-MunX_Pst_Fwd / GFP-MunX_Hind_Rev (SEQ ID NO: 61 and SEQ ID NO: 62) primer sets, respectively. These primer sets added 5'PstI and 3'HindIII restriction sites for cloning mature phytocin 423 (plaA) or munston ST4SA (munST4SA) genes as GFP fusions in pRSFDuet-1. Amplified bacteriocin genes were purified using GeneJet PCR purification kit (Thermo Scientific) and digested with PstI and HindIII. The digested mixture was purified again using the GeneJet PCR Purification Kit according to the manufacturer's instructions and used for subsequent cloning experiments.

[0142] The pJET-GFP plasmid was digested with BamHI / PstI; the pRSFDuet-1 vector was digested with BamHI / HindIII. The linearized pRSFDuet-1 vector and digested GFP fragment were purified using agarose gel electrophoresis, gel excised and recovered. In a single ligation reaction, the BamHI / PstI GFP fragment and the PstI / HindIII bacteriocin fragment were ligated into the linearized pRSFDuet-1 vector (BamHI / HindIII). The fragments were ligated using the following: vector: insert_GFP: insert_bacteriocin molar end ratio of 1:3:3. The resulting construct pRSF-GFP-PlaX( Fig.10 and Fig.11 ) and pRSF-GFP-MunX( Figure 8 and Fig. 9) was used to transform chemically competent E. coli BL21 (DE3) cells. pRSF-GFP-PlaX and pRSF-GFP-MunX plasmids were extracted from E. coli BL21 (DE3) colonies with green fluorescence phenotype and kanamycin (50 μg / mL) resistance. For mature phytosporin 423 and monsporin ST4SA genes, sequencing was performed in pRSF-GFP-PlaX and pRSF-GFP-MunX plasmids using MCS1_Rev primer (SEQ ID NO: 63) and confirmed to be correct.

[0143] Table 3: Primers used for expression of GFP-fused subclass IIa bacteriocins in E. coli.

[0144]

[0145] Table 4: Vectors used for expression of GFP-fused subclass IIa bacteriocins in E. coli.

[0146]

[0147]

[0148] Overexpression of GFP-bacteriocin fusion protein in Escherichia coli BL21(DE3)

[0149] A 30 mL starter culture of LB broth containing 50 mg / mL kanamycin was inoculated with the corresponding E. coli BL21 (DE3) transformant containing the pRSF-GFP-PlaX or pRSF-GFP-MunX construct. The starter culture was incubated at 37°C with constant stirring for 12 hours. The starter culture was used as an inoculum (1% v / v) for GFP-PlaX and GFP-MunX expression, respectively. At OD 600nm When the p-value was 0.6-0.65, 0.1 mM IPTG was used to induce the expression of each GFP fusion protein.

[0150] The newly generated GFP fusion proteins GFP-PlaX and GFP-MunX were successfully expressed in Escherichia coli while retaining the autofluorescence property of GFP.

[0151] Ni-NTA purification of GFP-MunX and GFP-PlaX proteins

[0152] The induced cells were harvested by centrifugation at 8000g for 20 minutes at 4°C. The supernatant was discarded and the cell pellet was resuspended in 15mL / g wet weight SB buffer supplemented with 1mg / mL lysozyme and incubated at 8°C with stirring for 45 minutes. After incubation, the lysed cells were sonicated (50% amplitude, 2 second pulse, 2 second pause, 6 minutes) using an Omni Ruptor 400 (ultrasonic homogenizer, Omni International). RNaseI and DNaseI were added to final concentrations of 10mg / mL and 5mg / mL, respectively, and the lysate was incubated at room temperature for 15 minutes. The cell lysate was then centrifuged at 4°C, 20000g for 90 minutes; the cell-free supernatant was collected. Imidazole was added to the cell-free supernatant to a final concentration of 10mM.

[0153] The His-tagged GFP-bacteriocin fusion proteins GFP-PlaX and GFP-MunX were purified by IMAC using Ni-NTA superflow resin according to the batch purification instructions of the Qiagen expression manual. The purification system was combined with Sephadex G25 resin packed into a chromatography column (16×65 mm, GE Healthcare) to exchange the sample from SB500 into WELQut cut buffer. After successful protein purification, the fluorescence properties of GFP were used to evaluate the optimal expression conditions for increasing the fluorescence output. This included different temperatures, expression times, and IPTG concentrations.

[0154] Incubation temperature optimization for GFP-MunX expression

[0155] Temperature optimization was performed only for GFP-MunX fermentation, since cleaved GFP-MunX has higher specific activity. Temperature optimization of GFPMunX expression was performed in three biological replicates of E. coli BL21 (DE3) carrying the pRSF-GFP-MunX plasmid at 18°C, 26°C, and 37°C. Three biological replicates of E. coli pRSF-GFP-MunX were used to inoculate three 400 mL flasks of TB broth containing 50 mg / mL kanamycin. The cultures were grown at 37°C until the OD was 0. 600nm When the p-value was 0.6–0.65, 0.1 mM IPTG was used for induction. Each 400 mL culture was divided into three 100 mL cultures and incubated at 18°C, 26°C, and 37°C for 48 h.

[0156] To measure the expression of GFP-MunX in vivo, 1 mL samples were collected from each flask in triplicate at the time of induction; samples were collected again at 24 and 48 hours and frozen at -80°C. After collection, samples were thawed, centrifuged and washed twice with potassium phosphate buffer (pH 7.4). Tecan Spark M10 TM (Tecan Group Ltd., Austria), fluorescence measurements (in relative fluorescence units (RFU)) of in vivo expression of GFP-MunX were performed at 488 nm (excitation) and 509 nm (emission).

[0157] After 48 hours, the total GFP-MunX RFU yield of each sample was calculated by harvesting the induced cells from 80 mL of culture (centrifugation at 8000 × g for 20 minutes at 4 ° C). Then, the mass of each cell pellet was measured and then resuspended in 15 mL / g wet weight of SB buffer. GFP-MunX in each sample was extracted and purified using IMAC as described previously. Briefly, 5 mL of each cell-free lysate was purified using a 5 ml Ni-NTA Superflow column. Tecan M10 TM Spark (Tecan Group Ltd., Austria) measured the RFU of each Ni-NTA purified GFP-MunX sample. Then, the RFU / g of each sample was calculated by dividing the measured RFU by the equivalent wet weight (g) of the purified lysed cells (i.e., grams of lysed cells in 5 mL). The total RFU generated by each sample was calculated by multiplying the RFU / g by the total wet weight of the cells harvested in each sample.

[0158] After 24 and 48 hours of expression, the fluorescence intensity measured in vivo at 18°C ​​and 26°C, respectively, was significantly higher than that at 37°C ( Fig.12 ). However, these in vivo measurements do not take into account the total wet cell weight and cannot accurately represent the total target protein expression at each temperature. To measure the total target protein expression in relative fluorescence units (RFU), the following formula (1) was used:

[0159]

[0160] The total RFU yield of GFP-MunX was as Fig.12 B, where significantly higher RFU was generated at 18° C. Using SDS-PAGE analysis, this fluorescence intensity correlated with the presence of antibacterial activity after cleavage.

[0161] Optimization of IPTG concentration for induction

[0162] Fluorescence intensity was used to optimize the IPTG induction concentration for GFP-MunX expression using a Tecan Spark M10TM (Tecan Group Ltd., Austria) kinetic incubation program and a humidity chamber in a 96-well microtiter plate. E. coli BL21 (DE3) carrying the pRSF-GFPMunX plasmid was inoculated into three 1 L conical flasks (in three biological replicates) containing 200 mL of filter-sterilized TB broth supplemented with 50 mg / mL kanamycin and incubated at 37°C. Once the OD 600nm When the pH reached 0.55, each culture was cooled in an ice bath. Then, aliquots of the cultures were incubated with 0.01, 0.05, 0.1, 0.2, 0.4, 0.6, 0.8, 1 and 2 mM IPTG (final concentration) in triplicate in 96-well microtiter plates. The microtiter plates were placed in a Tecan Spark M10 TM The plates were incubated for 20 hours at 26° C. in a humidity chamber. Every 20 minutes, the microtiter plates were shaken for 30 seconds, left to rest for 10 seconds, and RFU was measured at 509 nm (emission) after excitation at 488 nm.

[0163] The fluorescence output of the induced samples increased over time and was significantly affected by the concentration of IPTG used for induction ( Fig.13 A). Compared with other IPTG concentrations, 0.1 and 0.2 mM IPTG concentrations induced significantly higher fluorescence after 18 h of incubation at 26 °C ( Fig.13 B).

[0164] Concentration estimation

[0165] One milliliter of Ni-NTA purified and buffer exchanged GFP-PlaX and GFP-MunX eluate was lyophilized and weighed in triplicate to estimate the total protein mass. Purified GFP-PlaX and GFP-MunX samples were separated by tricine SDS-PAGE electrophoresis to estimate sample purity ( and von Jagow, 1987). To avoid saturation during Coomassie staining, 10-fold dilutions of GFP-PlaX and GFP-MunX were used to estimate protein purity. Gel Analyzer 2010a was used to determine the pixel density of each stained band in each lane for estimation of sample purity (Lazer and GelAnalyzer, 2010).

[0166] Large-scale production of GFP-PlaX and GFP-MunX

[0167] To determine the effect of larger scale expression on the yield of the GFP fusion system, the inventors conducted separate experiments using a Minifors 5L fermentor under optimized conditions. Large-scale heterologous expression of phytosporin 423 and monterlin ST4SA GFP fusion proteins was performed using a 5L fermentor (Minifors, Infors AG; maximum recommended capacity 3L). TB broth (2.7L) containing 0.005% defoamer 204 (Sigma-Aldrich) was prepared and autoclaved. After cooling, 300mL of sterile 10×TB buffer and kanamycin (final concentration of 50μg / mL) were aseptically added. The broth was heated to 37°C, sterile compressed air was passed at 1L / min, and stirred at 300RPM. pH and dissolved oxygen levels were not controlled.

[0168] A starting culture of E. coli BL21(DE3) pRSF-GFP-PlaX and pRSF-GFP-MunX was used as 1% v / v inoculum for each expression. 600nm When the pH was 0.6-0.65, the expression of each GFP fusion protein was induced using 0.1 mM IPTG (Thermo-Fisher Scientific). Each fermentation was then cooled to 18°C ​​and incubated for 48 hours.

[0169] After extraction, Ni-NTA purification and buffer exchange of GFP-PlaX and GFP-MunX proteins, 39 mL of GFP-PlaX and 42 mL of GFP-MunX eluate were obtained. After lyophilization of 1 mL of GFP-PlaX and GFP-MunX, 12.96 mg and 17.96 mg of residual mass were measured, respectively. Based on SDS-PAGE analysis, the purity of GFP-PlaX and GFP-MunX was approximately 72% and 61%, resulting in concentrations of approximately 9.33 and 10.95 mg / mL, respectively. At these purities, the approximate yields of GFP-PlaX and GFP-MunX were 121.29 mg / L culture and 153.30 mg / L culture, respectively.

[0170] Antimicrobial activity assay

[0171] Although each bacteriocin was fused to GFP to produce a fluorescent complex, it was important to determine that the antimicrobial activity was due to the released bacteriocin. The antimicrobial activity of phytosporin 423 and monteronicin ST4SA was evaluated against Listeria monocytogenes EDG-e grown on brain heart infusion medium (BHI) containing 7.5 mg / mL chloramphenicol. Spot plating was performed on solid medium (1% w / v agar) seeded with Listeria monocytogenes EDG-e. The activity of SDS-PAGE separations was determined by casting polyacrylamide gels in agar bilayers seeded with Listeria monocytogenes EDG-e. Prior to casting, the polyacrylamide gels were fixed in 25% isopropanol, 10% acetic acid fixative for 20 minutes and then rinsed 3×15 minutes with sterile ultrapure water.

[0172] The cleavage parameters were optimized using a modified method provided by the manufacturer. For 50 μL GFP-PlaX and GFP-MunX samples, the ratio of WELQut to sample was set to 1:100, 1:50, 1:25, 1:5 (v / v), respectively, and diluted in a final volume of 250 μL of WELQut cleavage buffer. The WELQ units corresponding to 466.5 μg GFP-PlaX were 2.5U, 5U, 10U, and 50U, respectively. The WELQ units corresponding to 547.5 μg of GFP-MunX were 2.5U, 5U, 10U, and 50U, respectively. The cleavage reaction was incubated at 28°C, and 50 μL samples were collected at 2 hours, 4 hours, 8 hours, and 16 hours, respectively. The cleavage was evaluated by spot plate method on BHI solid medium (1% w / v agar) inoculated with Listeria monocytogenes EGD-e.

[0173] After 16 hours, the cleavage ratios for GFP-PlaX and GFP-MunX cleavage that resulted in the maximum anti-Listeria activity were confirmed to be 1:10 and 1:25 (mL:mL) for WELQut to sample, respectively ( Fig.14 ).

[0174] An important advantage of using GFP as a fusion partner is that protease cleavage can be evaluated by visualizing the migration pattern of fluorescent bands after electrophoretic separation. The optimal cleavage conditions are determined based on the activity of the heterologously produced bacteriocin fusion, which depends on many variables. Therefore, the inventors confirmed the results of the optimal cleavage by utilizing the GFP fluorescence properties retained after SDS-PAGE electrophoresis. Fluorescent bands of GFP-PlaX, GFP-MunX and GFP were observed before and after cleavage, respectively. These bands were then correlated with the stained bands on the same SDS-PAGE gel ( Fig.15 ).

[0175] The intensity of the uncleaved GFP-PlaX and GFP-MunX fluorescence bands decreased with increasing WELQut:sample ratio ( Fig.15 ). Complete cleavage of GFP-PlaX can be observed, corresponding to the highest spot activity observed. Complete cleavage was not achieved for GFP-MunX, and a faint fluorescent band was observed at the uncleaved GFP-MunX.

[0176] Using SDS-PAGE under semi-native conditions, the location of the fluorescent GFP fusion protein on the separating gel can be photographed and superimposed on the stained and anti-Listeria gel overlays ( Fig.16 ). For WELQut-cleaved GFP-PlaX and GFPMunX samples, anti-Listeria activity was observed as clear areas. Fig.16 The anti-Listeria regions III and IV in the PCR product correspond to the positions of montebellocin ST4SA (4285 Da) and phytomycin 423 (3928 Da), respectively, indicating that the core peptides were released from their respective GFP fusion partners. However, two additional anti-Listeria active regions were observed ( Fig.16 I and II in ), which corresponds to the approximate size and position of fluorescent GFP-MunX (31 874 Da) and GFP-PlaX (31 520 Da).

[0177] HPLC and LC-ESI-MS

[0178] Under the optimal cleavage conditions, monselocin ST4SA and phytosyltransferase 423 were cleaved from 1 ml of purified GFP-MunX and GFP-PlaX with His tags, respectively. The cleavage reactions were purified by high performance liquid chromatography (HPLC) and the single peak was spotted to test the anti-Listeria activity.

[0179] Electrospray ionization MS of HPLC purified montebellocin ST4SA confirmed the presence of a peptide with a mass corresponding to that of mature montebellocin ST4SA ( Fig.17 ). Although from [M+5H] +5 The exact mass of montebellocin ST4SA was determined to be 4285.1355 Da in the isotopic envelope of the substance, but the abundance of this charged substance in the original spectrum was low ( Fig.17 ). However, accurate mass measurements were in good agreement with the theoretical monoisotopic mass of 4285.0796 Da (equivalent to the formation of one disulfide bridge).

[0180] The activity of monsellin ST4SA was observed from a single peak, while phytosyl 423 produced multiple activity peaks, but at a lower activity level. The monsellin ST4SA fractions were lyophilized and the residual mass was weighed. The optimal cleavage of GFP-MunX produced 0.88 mg of active monsellin ST4SA, indicating that approximately 37.3 mg could be obtained from 3 L of fermentation, equivalent to 12.4 mg / L of monsellin ST4SA.

[0181] Using the methods described in Example 2 above, the inventors expressed bacteriocins with antibacterial activity. The inventors also demonstrated the potential for scaling up the system by using larger scale fermentation reactors. The inventors were able to accurately and rapidly evaluate expression by taking advantage of the in vitro and in vivo fluorescence properties of the fusion protein.

[0182] Example 3

[0183] Production of GFP-fused bacterial toxins Listeriolysin (LLO) and ActA in Escherichia coli

[0184] The inventors of the present invention have shown that the bacterial toxin Listeria monocytogenes O ( Fig.18 ) and ActA( Fig.19 )’s successful expression.

[0185] Plasmid design

[0186] The Listeria monocytogenes effectors LLO and ActA were translationally fused to green fluorescent protein (GFP) and expressed in E. coli. As described in Examples 1 and 2, a backbone plasmid containing mgfp5 was generated, which includes a 6× polyhistidine tag (His tag) at the N-terminus and a WELQut protease site at the C-terminus. The LLO gene was amplified from Listeria monocytogenes EDG-e genomic DNA using the primers listed in Table 5, wherein the forward primer was designed to exclude the signal peptide at the N-terminus (SEQ ID NOs: 66-67). The digested (PstI / NotI) and purified LLO was cloned into pRSF-GFP on a PstI / NotI fragment using T4 ligase, resulting in a translational fusion of LLO to GFP with a His tag, which has the amino acid sequence of SEQ ID NO: 37 and the nucleotide sequence of SEQ ID NO: 38. The resulting pRSFGFP-LLO construct was transformed into chemically competent E. coli BL21 (DE3) cells.

[0187] Table 5: Primers used for expression of GFP-fused LLO and ActA in E. coli.

[0188] ID Primer name Primer sequences SEQ ID NO: 1 GST_Notl_F GCGCGGCCGCGTCCCCTATACTAGGTTATTGGAAA SEQ ID NO: 64 2 GST_Xhol_R CAGACTCGAGTTACGATTTTGGAGGATGGTCGCCA SEQ ID NO: 65 3 WLLO_Pstl_F GGGAACTGCAGGCATCTGCATTCAATAAAG SEQ ID NO: 66 4 LLO_Notl_R ATTATGCGGCCGCTTATTCGATTGGATTAT SEQ ID NO: 67 5 WActA_Pstl_F GGGAACTGCAGGATAGCGAAGATTCTAGTCTAAACAC SEQ ID NO: 68 6 ActA_Notl_R ATGCGGCCGCTTACGTCGTATGGTTCCCTG SEQ ID NO: 69

[0189] Due to the observation of degradation products during ActA expression and purification, several plasmid constructs for the expression of ActA were generated. The final construct produced a translational fusion of ActA with a His-tagged GFP at its N-terminus and a GST tag at the C-terminus, which had the amino acid sequence of SEQ ID NO: 39 and the nucleotide sequence of SEQ ID NO: 40. ActA was amplified from Listeria monocytogenes EDG-e gDNA using primers designed to exclude N-terminal and C-terminal signal peptides and transmembrane domains, respectively (SEQ ID NO: 68-69). The GST tag was amplified from pET41a (+) using the primers listed in Table 5 (SEQ ID NO: 64-65). The purified ActA PCR product was digested with PstI / NotI and ligated into pRSFGFP previously digested with PstI / NotI. The ligated product was transformed and purified. The resulting pRSFGFP-ActA construct was digested with NotI / XhoI and used for ligation with a GST tag (digested with NotI / XhoI). The product of the ligation reaction was used to transform chemically competent E. coli BL21 (DE3) cells and pDNA was isolated as described above. The stability of ActA during expression was increased using the E. coli strain ArcticExpress carrying the cold-adapted chaperone proteins Cpn10 and Cpn60. Transformation and culture of ArcticExpress were performed as described for E. coli BL21 (DE3), with the exception that gentamicin (20 μg / mL) was contained to maintain the plasmid carrying cpn10 and cpn60.

[0190] Protein synthesis and purification

[0191] Listeriolysin-O: For E. coli expressing GFP-LLO, a similar manner as explained in Examples 1 and 2 was followed. The His tag purified eluate was desalted against PBS (pH 7.4) using a 10 kDa spin column. The protein concentration used to determine the desalted protein yield was determined using the BCA protein assay.

[0192] Using optimal cleavage conditions, LLO was further purified to remove GFP and WELQut (also with a His tag) ( Fig.18 ). 10 mM imidazole was added and loaded onto the equilibrated His Trap HP Ni-NTA column. The flow-through containing LLO was collected and the purified LLO was desalted with PBS (pH 7.4) using a 10 kDa protein concentrator.

[0193] Actin assembly-inducing protein: Purification of GFP-ActA-GST was performed in a similar manner as GFP-LLO, except for an additional GST tag purification step ( Fig.19 ). E. coli ArcticExpress cells expressing GFP-ActA-GST were inoculated into LB broth containing 50 μg / mL kanamycin and 20 μg / mL gentamicin and incubated overnight at 30°C with stirring. They were inoculated into 500 mL TB (2% v / v) containing 50 μg / mL kanamycin and 20 μg / mL gentamicin. The flasks were incubated at 30°C with shaking until the OD 600nm to 0.5. Cells were induced with 0.5 mM IPTG and allowed to express for 18 hours at 26°C with agitation. Cells were collected by centrifugation at 6164 × g for 20 minutes at 10°C and lysed as described above. All subsequent purification steps were performed on ice to reduce degradation of GFP-ActA-GST. Prior to protein separation by IMAC, a His Trap HP Ni-NTA His tag column was equilibrated with SB containing 20 mM imidazole (SB20) and supplemented with protease inhibitors, and the supernatant was applied. The column was washed twice, first with SB20 containing protease inhibitors, then with PBS containing 20 mM imidazole (PBS20), and GFP-ActA-GST was eluted with PBS containing 125 mM imidazole. The eluate was diluted 1:1 in PBS (pH 7.4) and supplemented with dithiothreitol (DTT) to a final concentration of 5 mM. The diluted eluate was applied to a column loaded with glutathione agarose (2 mL) and circulated for 1 hour to allow the GST-tagged protein to bind fully. The column was washed with PBS (pH 7.4), and the bound GFP-ActA-GST was eluted with PBS containing 10 mM reduced glutathione (pH 8).

[0194] Release of ActA-GST from GFP by WELQuit cleavage ( Fig.19 ). For each milliliter of eluate, the eluate was purified by cleaving the GST-tag with 10U of WELQut protease and incubating at 8°C for 16 hours. After cleavage, 10mM imidazole was added and loaded onto a His Trap HP Ni-NTA column pre-equilibrated with 10mM imidazole. The released ActA-GST effluent was collected and desalted in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (20mM HEPES, 50mM KCl; pH 7.5) using a 10kDa protein concentrator to determine protein yield. As described in Examples 1 and 2, samples were collected throughout the purification and cleavage reactions for analysis by SDS-PAGE.

[0195] Using the methods described in Example 3 above, the inventors expressed Listeriolysin O (LLO) at a yield 15-fold higher than that reported in the prior art (51 mg / L vs 3.4-8 mg / L). Using non-optimized conditions (1 L of media), the inventors were able to produce pure LLO. Furthermore, it was shown that LLO fused to its fluorescent partner was still active. To further demonstrate the versatility of this method and how it can be rapidly used to optimize other peptides, the inventors used the methods described herein to produce another easily degradable bacterial toxin ActA ( Fig.19 ). In particular, the inventors of the present invention were able to quickly assess that a protein of interest was being degraded by monitoring the fluorescence of a fluorescent fusion partner, and based on this observation were able to prevent degradation by implementing a double purification setup to obtain a pure product.

[0196] Example 4

[0197] Lytic protein expression in E. coli

[0198] The inventors have identified two highly active lysis proteins from lambda phage, i.e. GpR (SEQ ID NO: 15) and GpE (SEQ ID NO: 17). For the purpose of proof of concept, GpR is used to determine the ability of GpR to induce Escherichia coli lysis. GpR-F and GpR-R primers (SEQ ID NO: 70 and 71) were used to amplify the gpR gene (endolysin R-NP_040645.1) from lambda phage by PCR. GpE-F and GpE-R primers (SEQ ID NO: 72 and 73) were used to amplify the gpE gene (lysozyme murein hydrolase-YP_002854084.1) from T4 phage by PCR. The amplified product was cloned into the second multiple cloning site of pRSFGFP using restriction enzymes BglII and KpnI to produce pRSFGFPGpR, and then BglII and XhoI were used to produce pRSFGFPGpE.

[0199] Table 6: Primers used for expression of lytic proteins in E. coli

[0200] ID Primer name Primer sequences SEQ ID NO; 1 GPR-F ATGGCAGATCTGGTAGAAATCAATAATCAA SEQ ID NO: 70 2 GPR-R ATAGGTACCTCATACATCAATCTCTCTGACCGT SEQ ID NO: 71 3 GPE-F ATGGCAGATCTGAATATTTTTGAAATGCTG SEQ ID NO: 72 4 GPE-R CAGACTCGAGTTACAGATTTTTATATGCAT SEQ ID NO: 73

[0201] Example 5

[0202] Proof of concept for regulating lytic protein expression using an RNA thermometer

[0203] To illustrate this proof of concept of using an RNA thermometer to reduce the metabolic load of GpR on E. coli cells, the inventors used the RNA thermometer U7Tap (SEQ ID NO: 19) to produce recombinant His-tagged GFP. pRSF-Duet1 was used as a backbone plasmid to generate pTAP (RNA thermometer backbone vector). The selected RNA thermometer will downregulate gene expression at lower temperatures and increase translation at higher temperatures. GpR was digested from pRSFGFPGpR using BglII-XhoI and cloned into the BglII-XhoI site in the newly generated pTAP (SEQ ID NO: 36) plasmid, placing the autolysin under the control of the P7 promoter and the included RNA thermometer. After ligation and transformation, cells were plated onto BHI agar supplemented with kanamycin (50ug / mL). Positive clones were identified for further validation.

[0204] For proof of concept, cells were inoculated in BHI broth supplemented with kanamycin (50ug / mL) and cultured at 26°C for 18 hours with aeration. The cells carried pRSFGFP (control GFP); pRSFGFPGpR (GFPGPR) and pTAPGFPGpR (GFPRTGPR), all of which express recombinant His-tagged GFP. GFPGPR and GFPRTGPR also express the indicated cleavage proteins. The culture was then used to inoculate 200mL of TB broth supplemented with kanamycin and incubated at 26°C with aeration. When OD 600nmWhen the reading reaches 0.1-0.2, the cells are moved to 18°C ​​and incubated until OD reaches 0.55-0.6. The cells are then induced with 0.125mM IPTG and incubated for 12 hours at 18°C. After incubation, each culture carrying different carriers is divided into 2 flasks, which are incubated at 26°C and 37°C, respectively. Samples are collected at 3 hours, 6 hours, and 9 hours and placed at 8°C until further use. Cells are diluted 1 / 10 at each time point, and OD readings are read at 595nm to determine cell density. At 9 hours, the samples are centrifuged and the precipitation is frozen at -20°C for at least 1 hour. The samples (each 400 μL) are thawed at room temperature, and then SB buffer (Table 7) and SB supplemented with 1% SDS are added to half of the original volume (200 μL), incubated exclusively at 37°C, and occasionally mixed for 1-2 hours. After incubation, OD readings are read at 595nm to determine the extent of cell lysis. The amount of His-tagged GFP obtained from the sample incubated for 9 hours can be evaluated using immobilized metal ion chromatography. Each sample (samples of different temperatures and constructs) was centrifuged for 2 mL, and the precipitate was frozen at -20 ° C for at least 1 hour. The sample was allowed to thaw at room temperature and 1 mL of buffer was added (lysis buffer for control GFP, SB buffer supplemented with 1% SDS for GFPGPR and GFPRTGPR). In all cases, the buffer was supplemented with DNAse and RNAse, incubated at 37 ° C, and occasionally mixed for 1-2 hours. According to the standard method as described in Example 1, the sample containing the control GFP construct was lysed, and the sample containing the GFPGPR and GFPRTGPR construct was lysed using SB buffer supplemented with 1% SDS as described above. After lysis, the sample was centrifuged at 12000 rpm to precipitate cell debris and unlysed cells. The supernatant of the sample was removed, imidazole was added to a final concentration of 5 mM, and then 600 μL was added to the HisPur (ThermoScientific) spin column to bind the GFP with the His tag. The spin column was washed 3 times with SB buffer supplemented with 5 mM imidazole. Finally, GFP was eluted with 600 μL of SB buffer supplemented with 500 mM imidazole. These samples were then used for SDS-PAGE analysis.

[0205] Inclusion of the RNA thermometer (GFPRTGPR) resulted in consistently higher optical density readings compared to cells carrying control GFP or GFPGPR constructs ( Fig. 20 ). Furthermore, the absence of the RNA thermometer in the GFPGPR construct resulted in consistently lower optical density readings, indicating a higher metabolic burden and potential toxicity ( Fig. 20 ).

[0206] Regardless of whether cells were grown at 26°C or 37°C, significant lysis was observed in the construct without the RNA thermometer ( Fig.21 However, when resuspended in SB buffer, the GFPRTGPR construct containing the RNA thermometer resulted in approximately 2-fold reduction in lysis at 26°C compared to 37°C, indicating that GpR expression was successfully suppressed when cells were grown at 26°C ( Fig.21 Addition of 1% SDS to cells containing GFPGPR or GFPRTGPR constructs resulted in complete cell lysis ( Fig.21 ). This indicates that the selected RNA thermometers are able to inhibit GpR expression at 26°C, but are not able to completely inhibit GpR translation at this temperature. This also illustrates the potency of the selected autolysin. Cells carrying only the control GFP construct were also affected by freeze-thaw and SDS addition, but not to the same extent as cells containing GFPGPR or GFPRTGPR.

[0207] The cells were lysed using the standard lysis protocol, resulting in incomplete lysis. Both the GFPGPR and GFPRTGPR samples showed complete lysis after the addition of 1% SDS, and no incompletely lysed cells were observed. The lack of an RNA thermometer resulted in a significant reduction in the amount of GFP, indicating low GFP expression ( Fig. 22 However, the addition of the RNA thermometer produced more recombinant GFP compared to the control GFP and GFPGPR constructs. Analysis using SDS PAGE showed that temperature and the addition of the RNA thermometer affected the amount of GFP that could be obtained ( Fig. 22 In all cases, incubation of cells at 37°C resulted in a decrease in GFP, likely due to the stability of GFP at this temperature. Inclusion of the RNA thermometer resulted in up to 4-fold and 2.8-fold increases in GFP compared to the control GFP (when cells were grown at 26°C or 37°C, respectively). Inclusion of the RNA thermometer resulted in a 30-fold and 11-fold increase in the amount of GFP compared to the GFPGPR sample (when cells were grown at 26°C or 37°C, respectively).

[0208] In Example 5, the inventors have shown that the inclusion of an RNA thermometer results in i) increased yields of recombinant GFP after His-tag purification compared to the yields obtainable from a control (control GFP) and a GFPGPR construct lacking the RNA thermometer, and ii) increased lysis of cells at higher temperatures. The inclusion of an RNA thermometer is critical for proper expression of recombinant His-tagged GFP and proper growth of cells compared to a GFPGPR construct lacking the RNA thermometer. RNA thermometers with varying temperature sensitivities can be included to alter the stringency of expression of lytic proteins, as well as any other recombinant protein whose expression needs to be controlled in addition to standard induction or autoinduction controls.

[0209] Example 6

[0210] Production of the autophagic peptide TATBeclin fused to GFP and fused to mCherry in Escherichia coli

[0211] Using the methods presented in Examples 1-5 above, the inventors have generated the autophagic peptide TATBeclin ( Fig.23 ). The peptide remains biologically active even when attached to a fluorescent fusion partner, adding functionality in terms of visualization and tracking capabilities.

[0212] The goal here is to reconstruct the TAT-Beclin construct so that it can be fused to either GFP or mCherry. In the case of GFP, TATBeclin (32.96 kDa) is fused to the C-terminus of GFP with a protease site (WELQut) between GFP and TATBeclin. For mCherry, TATBeclin carries a His tag at the N-terminus and is fused to mCherry at its C-terminus (34.37 kDa).

[0213] TATBeclin was synthesized using two long primers with homology in between (SEQ ID No. 74 and 75). This construct was used to generate GFP-TATBeclin (GFPTATB) (SEQ ID 76 and 77).

[0214] The two primers were prepared as 100uM stock solutions in fresh 10mM Tris (pH 8.0). Klenow (NEB) was used to construct nucleotides and fuse TatBecF and TatBecR (SEQ ID.74 and 75). 50uL of reaction mixture was prepared using buffer M (10×, Roche), primer stock solution (1uL each; each equal to 2.2ug) and Klenow (3uL) and incubated at 37°C for 1 hour. Thereafter, the reactants were purified and concentrated using a PCR purification kit. The purified product and pRSFGFP were digested overnight with PstI and HindIII (NEB) at 37°C. The digestion products were purified and connected together using T4 ligase (NEB). The resulting ligation mixture was used to transform Escherichia coli BL21 (DE3), which was then plated onto LB agar supplemented with 50ug / mL kanamycin and incubated at 37°C until visible colonies were formed. Colonies were used to inoculate LB broth and incubated at 37°C with aeration for 18 hours. Overnight cultures were subjected to plasmid extraction.

[0215] In order to fuse TATBeclin with mCherry, additional primers (TATBmCherry; SEQ ID.78 and 79) are required. The forward primer has a BamHI site (with WELQut protease), and the reverse primer has a NotI site (Table 1). These primers are used to amplify TATBeclin from pRSF-GFPTATB (SEQ ID.80 and 81) constructs. The resulting PCR product is purified and digested with BamHI and NotI. Similarly, the plasmid containing mCherry for C-terminal fusion is digested with the same restriction enzyme. As previously mentioned, digested TAT-Beclin and plasmid are purified, connected and transformed.

[0216] TATBeclin fusions were expressed and purified as described in Examples 1-2. The eluates were desalted with PBS buffer with 250 mM or 150 mM NaCl for GFPTATBeclin and TATmCherry, respectively, using a 20 kDa dialysis cassette (20 kDa cutoff) or a 10 kDa protein concentrator (10 kDa cutoff).

[0217] Both fusion proteins were successfully expressed and purified using immobilized metal affinity chromatography (IMAC). The preliminary total protein yield of the IMAC purified and desalted samples was 113.8 mg / L for GFPTATB and 41.7 mg / L for TATBmCherry. The relative purity range of the samples determined by SDS PAGE was 70-82% for GFPTATB and 48-50% for TATBmCherry ( Fig.23 ). These yields and purities can be further improved through optimized processes and the use of specialized strains and techniques.

[0218] Table 7: Buffers used in the examples

[0219]

[0220]

[0221] Example 7

[0222] Design of additional RNA thermometers and use of stationary promoters

[0223] To further improve the proof of concept, different RNA thermometers (RNATs) can be used in combination with stationary phase promoters. Examples of RNATs include SEQ ID NOs: 19-27 and SEQ ID NOs: 105-111, and promoters include SEQ ID NOs: 74-76. To illustrate this, RNAT / promoter combinations of SEQ ID NOs: 81 (G5), SEQ ID NOs: 84 (G8), SEQ ID NOs: 91 (G15), SEQ ID NOs: 93 (G17), and SEQ ID NOs: 94 (G18) are used for preliminary illustration. Different promoter / RNAT combinations are cloned into vector pHXk (SEQ ID NO: 101) using restriction enzymes KasI and BamHI. Vector pHXk was designed to contain a kanamycin resistance gene, a LacIq (lac repressor) gene, a pUC19 replication origin, and two multiple cloning sites (MCS) with its own T7 promoter and LacO operator, followed by transcription termination sequences L3S2P56 and BBa0015 (restriction endonuclease sites for MCS1 - PacI, NdeI, BamHi, XhoI, PstI, NotI MfeI; MCS2 - NcoI, BglII, SalI, SacI, HindIII, EcoRI). A second vector (SEQ ID NO: 102) was designed using the same backbone plasmid with a chloramphenicol resistance marker (instead of kanamycin). Using the same basic vector sequence as above, two additional vectors (SEQ ID NO: 103-104) were designed with altered sequences between their respective promoter / operator and start codons, differing in the multiple cloning site: MCS1 had a BBa0015 transcription terminator and MCS2 had a T7 terminator. Subsequently, the cleavage protein GPR was cloned into these new vectors using BamHI and XhoI. These new vectors were then used to transform E. coli BL21 and used for preliminary evaluation.

[0224] Different E. coli BL21 constructs were used to experiment and simulate expression conditions. Culture was inoculated into 5 mL of Luria Bertani (LB) broth (supplemented with 50ug / mL kanamycin), grown overnight at 26 ℃. Subsequently, overnight culture was inoculated with 1% v / v of 150 mL of LB broth, incubated at 26 ℃ until the OD600 of culture reached between 0.6-0.8. Subsequently, 50 mL of each culture was dispensed into flasks, grown at 26 ℃ or 37 ℃. Within 12 hours, readings were read every 2 hours. After 15 hours (total incubation time), cells were incubated for another 11 hours (26 hours in total). After 26 hours, all remaining samples grown at 26 ℃ were removed and incubated for another 5 hours at 37 ℃.

[0225] All optical density readings were obtained using cuvettes and SmartSPec Plus (Biorad). When necessary, samples were diluted in Tris buffer (pH 7.4) to maintain OD600 values ​​below 1.0.

[0226] At the selected time point, 1 mL of the culture was removed, centrifuged at 8000 rpm (2 minutes), and the pellet was frozen at -20°C for at least 2 hours. After freezing, the cell pellet was thawed at room temperature and resuspended in 1 mL of lysis buffer (Tris buffer (pH 7.4) supplemented with 25 U / mL of ThermoScientific universal nuclease). After incubation at room temperature for 5 minutes, the optical density reading was read as described above (when necessary, dilution was performed as described above).

[0227] To calculate the percentage of lysis, the optical density reading obtained from each resuspended freeze-thaw pellet (ODFreeze) was divided by the optical density reading of the original culture before freezing (ODOriginal) (Equation 1).

[0228] Formula 1: Lysis % = (1-frozen OD / original OD) × 100

[0229] The E. coli B21 promoter / RNAT constructs grown at 26°C reached an OD600 of 0.6-0.8 within 3 hours, and subsequent growth at 37°C resulted in an increase in optical density values ​​compared to the constructs grown at 26°C until 15 hours ( Fig.24 and Fig.25 ). Cells grown at 26°C and 37°C had similar OD600 values ​​at 26 hours. Cells grown at 26°C and moved to 37°C for an additional 5 hours showed a slight increase in OD600 values, with sample G5 showing the largest change. Overall, all constructs reached a high OD600, averaging 7.25 (+ / - 0.22), and reached early stationary phase after 15 hours ( Fig.24 and Fig.25 ).

[0230] Samples (1 mL) were collected at 7, 9, 11, 13, 15, 26, and +5 (31) hours after centrifugation and frozen at -20°C. These samples were then resuspended in lysis buffer to determine the percent lysis as a function of the original OD600 value for each culture (Equation 1). For samples grown at 26°C, lysis was consistently weaker, with more lysis observed at the early time points ( Figure 26-Figure 32This is likely due to basal GPR expression and increased sensitivity of young cells to membrane damage after freeze-thaw cycles. Samples G5, G8, and G18 showed a clear difference in lysis for cells grown at 37°C, showing >90% lysis within 15 hours ( Figure 26-Figure 27 , Fig.28 , Fig.29 , Fig.32 ). Lysis decreased in samples grown at 26°C and 37°C after 26 hours of growth, most likely due to the thicker cell walls of older cells being more resistant to damage from freezing and thawing. However, the greatest difference in lysis between samples grown at 26°C and 37°C was observed at this later time point, with samples grown at 37°C having more lysis (70-85%) compared to samples grown at 26°C (14-74%) ( Figure 26-Figure 32 At later time points, the greatest differences in lysis between samples grown at 26°C or 37°C were found between samples G5, G8, and G18 ( Figure 26-Figure 27 , Fig.28 , Fig.29 , Fig.32 After cells previously grown at 26°C were moved to 37°C (for an additional 5 hours), an increase in lysis was observed consistent with cells grown at 37°C, suggesting increased expression / translation of GPR cleavage genes, consistent with a function for RNAT.

[0231] From these results, using RNATs with quiescent promoters results in different cleavage efficiencies when cells are grown at low temperatures (26°C) or high temperatures (37°C). Furthermore, these preliminary results suggest that shifting cells from low temperatures to high temperatures during late quiescence can result in increased cleavage efficiency. The results also suggest that different RNATs have different efficiencies in their ability to suppress lytic expression / translation at lower temperatures. This allows for the selection of RNATs based on specific needs / applications.

[0232] Taken together, these results further illustrate the utility of RNAT / quiescent phase promoter combinations for lysis of recombinant E. coli cells.

[0233] Table 8: Percentage of cell lysis after one freeze-thaw cycle

[0234] Sequence Listing <110> Stellenbosch University <120> Heterologous peptide production based on fluorescent fusion <130> PA175174 / PCT <150> ZA 2020 / 07119 <151> 2020-11-16 <160> 111 <170> PatentIn version 3.5 <210> 1 <211> 4 <212> PRT <213> Artificial sequence <220> <223> WelQut cleavage site amino acid sequence <400> 1 Trp Glu Leu Gln 1 <210> 2 <211> 12 <212> DNA <213> Artificial sequence <220> <223> WelQut cleavage site nucleotide sequence <400> 2 tgggaactgc ag 12 <210> 3 <211> 4 <212> PRT <213> Artificial sequence <220> <223> Thrombin / trypsin cleavage site amino acid sequence <400> 3 Leu Val Pro Arg 1 <210> 4 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Thrombin / trypsin cleavage site nucleotide sequence <400> 4 ctagtaccac gc 12 <210> 5 <211> 4 <212> PRT <213> Artificial sequence <220> <223> nisP / trypsin cleavage site amino acid sequence <400> 5 Ala Ser Pro Arg 1 <210> 6 <211> 12 <212> DNA <213> Artificial sequence <220> <223> nisP / trypsin cleavage site nucleotide sequence <400> 6 gcgagcccgc gc 12 <210> 7 <211> 7 <212> PRT <213> Artificial sequence <220> <223> TEV cleavage site amino acid sequence <400> 7 Glu Asn Leu Tyr Phe Gln Gly 1 5 <210> 8 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> TEV cleavage site nucleotide sequence <400> 8 gaaaacttgt attttcaagg c 21 <210> 9 <211> 4 <212> PRT <213> Artificial sequence <220> <223> Factor Xa cleavage site amino acid sequence <400> 9 Ile Glu Gly Arg 1 <210> 10 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Factor Xa cleavage site nucleotide sequence <400> 10 attgaaggtc gt 12 <210> 11 <211> 240 <212> PRT <213> Artificial sequence <220> <223> Green fluorescent protein amino acid sequence <400> 11 Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val 1 5 10 15 Glu Leu Asp Gly Asp Val Asn Gly Tyr Lys Phe Ser Val Ser Gly Glu 20 25 30 Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys 35 40 45 Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu 50 55 60 Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Arg 65 70 75 80 His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg 85 90 95 Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val 100 105 110 Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile 115 120 125 Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn 130 135 140 Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly 145 150 155 160 Ile Lys Ala Asn Phe Lys Thr Arg His Asn Ile Glu Asp Gly Gly Val 165 170 175 Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Asp Pro 180 185 190 Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser 195 200 205 Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val 210 215 220 Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys Thr Gly 225 230 235 240 <210> 12 <211> 720 <212> DNA <213> Artificial sequence <220> <223> Green fluorescent protein nucleotide sequence <400> 12 atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60 gatgttaatg ggtacaaatt ttctgtcagt ggagagggtg aaggtgatgc aacatacgga 120 aaacttaccc ttaaatttat ttgcactact ggaaaactac ctgttccatg gccaacactt 180 gtcactactc tcacttatgg tgttcaatgc ttttcaagat atccagatca tatgaagcgg 240 cacgacttct tcaagagcgc catgcctgag ggatacgtgc aggagaggac catcttcttc 300 aaggacgacg ggaactacaa gacacgtgct gaagtcaagt ttgagggaga caccctcgtc 360 aacaggatcg agcttaaggg aatcgatttc aaggaggacg gaaacatcct cggccacaag 420 ttggaataca actacaactc ccacaacgta tacatcatgg ccgacaagca aaagaacggc 480 atcaaagcca acttcaagac ccgccacaac atcgaagacg gcggcgtgca actcgctgat 540 cattatcaac aaaatactcc aattggcgat gaccctgtcc ttttaccaga caaccattac 600 ctgtccacac aatctgccct ttcgaaagat cccaacgaaa agagagacca catggtcctt 660 cttgagtttg taacggctgc tgggattaca catggcatgg atgaactata caaaaccggt 720 <210> 13 <211> 227 <212> PRT <213> Artificial Sequence <220> <223> mCherry amino acid sequence <400> 13 Val Ala Ile Ile Lys Glu Phe Met Arg Phe Lys Val His Met Glu Gly 1 5 10 15 Ser Val Asn Gly His Glu Phe Glu Ile Glu Gly Glu Gly Glu Gly Arg 20 25 30 Pro Tyr Glu Gly Thr Gln Thr Ala Lys Leu Lys Val Thr Lys Gly Gly 35 40 45 Pro Leu Pro Phe Ala Trp Asp Ile Leu Ser Pro Gln Phe Met Tyr Gly 50 55 60 Ser Lys Ala Tyr Val Lys His Pro Ala Asp Ile Pro Asp Tyr Leu Lys 65 70 75 80 Leu Ser Phe Pro Glu Gly Phe Lys Trp Glu Arg Val Met Asn Phe Glu 85 90 95 Asp Gly Gly Val Val Thr Val Thr Gln Asp Ser Ser Leu Gln Asp Gly 100 105 110 Glu Phe Ile Tyr Lys Val Lys Leu Arg Gly Thr Asn Phe Pro Ser Asp 115 120 125 Gly Pro Val Met Gln Lys Lys Thr Met Gly Trp Glu Ala Ser Ser Glu 130 135 140 Arg Met Tyr Pro Glu Asp Gly Ala Leu Lys Gly Glu Ile Lys Gln Arg 145 150 155 160 Leu Lys Leu Lys Asp Gly Gly His Tyr Asp Ala Glu Val Lys Thr Thr 165 170 175 Tyr Lys Ala Lys Lys Pro Val Gln Leu Pro Gly Ala Tyr Asn Val Asn 180 185 190 Ile Lys Leu Asp Ile Thr Ser His Asn Glu Asp Tyr Thr Ile Val Glu 195 200 205 Gln Tyr Glu Arg Ala Glu Gly Arg His Ser Thr Gly Gly Met Asp Glu 210 215 220 Leu Tyr Lys 225 <210> 14 <211> 681 <212> DNA <213> Artificial sequence <220> <223> mCherry nucleotide sequence <400> 14 gtggcaatca tcaaagaatt tatgcggttt aaagtacata tggaaggtag tgtgaatggt 60 catgaatttg aaattgaagg tgaaggagaa ggtagaccat atgaaggaac gcaaaccgcg 120 aaattgaaag ttactaaagg tggaccatta ccttttgcat gggatatctt atctccacaa 180 tttatgtatg gatcaaaagc atatgtaaaa catccagcag atatccctga ttatttaaaa 240 ttaagttttc ctgaaggttt taaatgggaa cgggttatga attttgaaga tggtggagtt 300 gtaactgtaa cacaagatag ttctttacaa gatggagaat ttatctataa agtcaaattg 360 cgtggaacga attttccatc tgatggtcct gtgatgcaaa agaaaactat gggttgggaa 420 gctagtagtg aacgtatgta tccagaagat ggagcattaa aaggtgaaat caaacaaaga 480 ttaaaattga aagatggtgg acattatgat gcggaagtta aaactacata taaagccaaa 540 aaaccagtcc aattacctgg tgcttataat gtgaatatca aattggatat cacgagtcat 600 aatgaagatt ataccattgt cgaacaatat gaaagagcgg aaggaagaca ttctacaggt 660 ggtatggatg aattatataa a 681 <210> 15 <211> 161 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of GpR cleavage protein <400> 15 Met Ala Asp Leu Val Glu Ile Asn Asn Gln Arg Lys Ala Phe Leu Asp 1 5 10 15 Met Leu Ala Trp Ser Glu Gly Thr Asp Asn Gly Arg Gln Lys Thr Arg 20 25 30 Asn His Gly Tyr Asp Val Ile Val Gly Gly Glu Leu Phe Thr Asp Tyr 35 40 45 Ser Asp His Pro Arg Lys Leu Val Thr Leu Asn Pro Lys Leu Lys Ser 50 55 60 Thr Gly Ala Gly Arg Tyr Gln Leu Leu Ser Arg Trp Trp Asp Ala Tyr 65 70 75 80 Arg Lys Gln Leu Gly Leu Lys Asp Phe Ser Pro Lys Ser Gln Asp Ala 85 90 95 Val Ala Leu Gln Gln Ile Lys Glu Arg Gly Ala Leu Pro Met Ile Asp 100 105 110 Arg Gly Asp Ile Arg Gln Ala Ile Asp Arg Cys Ser Asn Ile Trp Ala 115 120 125 Ser Leu Pro Gly Ala Gly Tyr Gly Gln Phe Glu His Lys Ala Asp Ser 130 135 140 Leu Ile Ala Lys Phe Lys Glu Ala Gly Gly Thr Val Arg Glu Ile Asp 145 150 155 160 Val <210> 16 <211> 483 <212> DNA <213> Artificial Sequence <220> <223> GpR cleavage protein nucleotide sequence <400> 16 atggcagatc tggtagaaat caataatcaa cgtaaggcgt tcctcgatat gctggcgtgg 60 tcggagggaa ctgataacgg acgtcagaaa accagaaatc atggttatga cgtcattgta 120 ggcggagagc tatttactga ttactccgat caccctcgca aacttgtcac gctaaaccca 180 aaactcaaat caacaggcgc cggacgctac cagcttcttt cccgttggtg ggatgcctac 240 cgcaagcagc ttggcctgaa agacttctct ccgaaaagtc aggacgctgt ggcattgcag 300 cagattaagg agcgtggcgc tttacctatg attgatcgtg gtgatatccg tcaggcaatc 360 gaccgttgca gcaatatctg ggcttcactg ccgggcgctg gttatggtca gttcgagcat 420 aaggctgaca gcctgattgc aaaattcaaa gaagcgggcg gaacggtcag agagattgat 480 gta 483 <210> 17 <211> 167 <212> PRT <213> Artificial sequence <220> <223> GpE cleavage protein amino acid sequence <400> 17 Met Ala Asp Leu Asn Ile Phe Glu Met Leu Arg Ile Asp Glu Arg Leu 1 5 10 15 Arg Leu Lys Ile Tyr Lys Asp Thr Glu Gly Tyr Tyr Thr Ile Gly Ile 20 25 30 Gly His Leu Leu Thr Lys Ser Pro Ser Leu Asn Ala Ala Lys Ser Glu 35 40 45 Leu Asp Lys Ala Ile Gly Arg Asn Cys Asn Gly Val Ile Thr Lys Asp 50 55 60 Glu Ala Glu Lys Leu Phe Asn Gln Asp Val Asp Ala Ala Val Arg Gly 65 70 75 80 Ile Leu Arg Asn Ala Lys Leu Lys Pro Val Tyr Asp Ser Leu Asp Ala 85 90 95 Val Arg Arg Cys Ala Leu Ile Asn Met Val Phe Gln Met Gly Glu Thr 100 105 110 Gly Val Ala Gly Phe Thr Asn Ser Leu Arg Met Leu Gln Gln Lys Arg 115 120 125 Trp Asp Glu Ala Ala Val Asn Leu Ala Lys Ser Ile Trp Tyr Asn Gln 130 135 140 Thr Pro Asn Arg Ala Lys Arg Val Ile Thr Thr Phe Arg Thr Gly Thr 145 150 155 160 Trp Asp Ala Tyr Lys Asn Leu 165 <210> 18 <211> 501 <212> DNA <213> Artificial sequence <220> <223> GpE cleavage protein nucleotide sequence <400> 18 atggcagatc tgaatatttt tgaaatgctg cgtatagatg aaggtcttag acttaaaatc 60 tataaagaca cagaaggcta ttacactatt ggcatcggtc atttgcttac aaaaagtcca 120 tcacttagtg ttgctaaatc tgaattagat aaagctattg gacgtaattg caatggtgta 180 attacaaaag atgaggctga aaaactcttt aatcaggatg ttgatgctgc tgttcgcgga 240 attctgagaa atgctaaatt aaaaccggtt tatgattctc ttgatgcggt tcgtcgttgt 300 gcattgatta atatggtctt ccaaatggga gaaaccggtg tggcaggatt tactaactct 360 ttacgtatgc ttcaacaaaa acgctgggat gaagcagcag ttaacttagc taaaagtaga 420 tggtataatc aaacaccctaa tcgcgcaaaa cgagtcatta caacgtttag aactggcact 480 tgggacgcat ataaaaatct g 501 <210> 19 <211> 25 <212> RNA <213> Artificial sequence <220> <223> RNA Thermometer 1 <400> 19 uaguucuccu ucagaaggag auaua 25 <210> 20 <211> 130 <212> RNA <213> Artificial sequence <220> <223> RNA Thermometer 2 <400> 20 uguaaaaaac aucauuuagc gugacuuucu uucaacagcu aacaauuguu guuacugccu 60 aauguuuuua ggguauuuua aaaaagggcg auaaaaaacg auugggggau gagacaugaa 120 cgcucaagca 130 <210> twenty one <211> 89 <212> RNA <213> Artificial sequence <220> <223> RNA Thermometer 3 <400> twenty one ggccacuuua gucugugguu acuguauuag guauuguuau aacaaucugg augguuuuua 60 ugaauaagac auuacugguc ucuucuuua 89 <210> twenty two <211> 112 <212> RNA <213> Artificial sequence <220> <223> RNA Thermometer 4 <400> twenty two uguguuuuuu guaaguucua uuaaauacau caguuuacag caaugaauuc accauuggc 60 aucgucaaua aaaggagugu uuaugaaaaa ucaauggcaa caucaauauu uu 112 <210> twenty three <211> 46 <212> RNA <213> Artificial sequence <220> <223> RNA Thermometer 5 <400> twenty three acagcaauuu ugcguuaccu guuaaucgag auugaaacac augaaa 46 <210> twenty four <211> 240 <212> RNA <213> Artificial sequence <220> <223> RNA Thermometer 6 <400> twenty four ggcgccacgg uuugacguac agaccauuaa agcaguguag uaaggcaagu cccuucaaga 60 guuaucguug auaccccucg uagugcacau uccuuuaacg cuucaaaauc uguaaagcac 120 gccauaucgc cgaaaggcac acuuaauuau uaaagguaau acacuauguc cgguaaaaug 180 acugguaucg uaaaaugguu caacgcugac aaaggcuucg gcuucaucac uccugacgau 240 <210> 25 <211> 46 <212> RNA <213> Artificial sequence <220> <223> RNA Thermometer 7 <400> 25 acagcaauuu ugcguuaucu guuaaucgag acugaaauac augaaa 46 <210> 26 <211> 50 <212> RNA <213> Artificial sequence <220> <223> RNA Thermometer 8 <400> 26 auucaagggu aaucaauucc uuccacacau caggaguuaa cauuaugucu 50 <210> 27 <211> 110 <212> RNA <213> Artificial sequence <220> <223> RNA Thermometer 9 <400> 27 ggccuaauua uagcacuuaa ucgaaauaaa uuuaugagua cguagaguau aauuaguauu 60 cuucuuucca acuuccuuau acuuauauac uuauagauuc uaaaaucaug 110 <210> 28 <211> 301 <212> PRT <213> Artificial sequence <220> <223> GFPNisin (ASPR) amino acid sequence <400> 28 Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val 1 5 10 15 Glu Leu Asp Gly Asp Val Asn Gly Tyr Lys Phe Ser Val Ser Gly Glu 20 25 30 Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys 35 40 45 Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu 50 55 60 Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Arg 65 70 75 80 His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg 85 90 95 Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val 100 105 110 Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile 115 120 125 Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn 130 135 140 Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly 145 150 155 160 Ile Lys Ala Asn Phe Lys Thr Arg His Asn Ile Glu Asp Gly Gly Val 165 170 175 Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Asp Pro 180 185 190 Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser 195 200 205 Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val 210 215 220 Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys Thr Gly 225 230 235 240 Trp Glu Leu Gln Met Ser Thr Lys Asp Phe Asn Leu Asp Leu Val Ser 245 250 255 Val Ser Lys Lys Asp Ser Gly Ala Ser Pro Arg Ile Thr Ser Ile Ser 260 265 270 Leu Cys Thr Pro Gly Cys Lys Thr Gly Ala Leu Met Gly Cys Asn Met 275 280 285 Lys Thr Ala Thr Cys His Cys Ser Ile His Val Ser Lys 290 295 300 <210> 29 <211> 903 <212> DNA <213> Artificial Sequence <220> <223> GFPNisin (ASPR) Nucleotide Sequence <400> 29 atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60 gatgttaatg ggtacaaatt ttctgtcagt ggagagggtg aaggtgatgc aacatacgga 120 aaacttaccc ttaaatttat ttgcactact ggaaaactac ctgttccatg gccaacactt 180 gtcactactc tcacttatgg tgttcaatgc ttttcaagat atccagatca tatgaagcgg 240 cacgacttct tcaagagcgc catgcctgag ggatacgtgc aggagaggac catcttcttc 300 aaggacgacg ggaactacaa gacacgtgct gaagtcaagt ttgagggaga caccctcgtc 360 aacaggatcg agcttaaggg aatcgatttc aaggaggacg gaaacatcct cggccacaag 420 ttggaataca actacaactc ccacaacgta tacatcatgg ccgacaagca aaagaacggc 480 atcaaagcca acttcaagac ccgccacaac atcgaagacg gcggcgtgca actcgctgat 540 cattatcaac aaaatactcc aattggcgat gaccctgtcc ttttaccaga caaccattac 600 ctgtccacac aatctgccct ttcgaaagat cccaacgaaa agagagacca catggtcctt 660 cttgagtttg taacggctgc tgggattaca catggcatgg atgaactata caaaaccggt 720 tgggaactgc agatgagtac aaaagatttt aacttggatt tggtatctgt ttcgaagaaa 780 gattcaggtg catcaccacg cattacaagt atttcgctat gtacacccgg ttgtaaaaca 840 ggagctctga tgggttgtaa catgaaaaca gcaacttgtc attgtagtat tcacgtaagc 900 aaa 903 <210> 30 <211> 315 <212> PRT <213> Synthetic Sequence <220> <223> Amino acid sequence of GFPNisin (AVPR) <400> 30 Met Gly Ser Ser His His His His His His Ser Gln Asp Pro Met Ser 1 5 10 15 Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu 20 25 30 Asp Gly Asp Val Asn Gly Tyr Lys Phe Ser Val Ser Gly Glu Gly Glu 35 40 45 Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr 50 55 60 Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Thr Tyr 65 70 75 80 Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Arg His Asp 85 90 95 Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile 100 105 110 Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe 115 120 125 Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe 130 135 140 Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Tyr Asn 145 150 155 160 Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly Ile Lys 165 170 175 Ala Asn Phe Lys Thr Arg His Asn Ile Glu Asp Gly Gly Val Gln Leu 180 185 190 Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Asp Pro Val Leu 195 200 205 Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp 210 215 220 Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val Thr Ala 225 230 235 240 Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys Thr Gly Trp Glu 245 250 255 Leu Gln Met Ser Thr Lys Asp Phe Asn Leu Asp Leu Val Ser Val Ser 260 265 270 Lys Lys Asp Ser Gly Ala Val Pro Arg Ile Thr Ser Ile Ser Leu Cys 275 280 285 Thr Pro Gly Cys Lys Thr Gly Ala Leu Met Gly Cys Asn Met Lys Thr 290 295 300 Ala Thr Cys His Cys Ser Ile His Val Ser Lys 305 310 315 <210> 31 <211> 945 <212> DNA <213> Artificial sequence <220> <223> Nucleotide sequence of GFPNisin (AVPR) <400> 31 atgggcagca gccatcacca tcatcaccac agccaggatc cgatgagtaa aggagaagaa 60 cttttcactg gagttgtccc aattcttgtt gaattagatg gtgatgttaa tgggtacaaa 120 ttttctgtca gtggagaggg tgaaggtgat gcaacatacg gaaaacttac ccttaaattt 180 atttgcacta ctggaaaact acctgttcca tggccaacac ttgtcactac tctcacttat 240 ggtgttcaat gcttttcaag atatccagat catatgaagc ggcacgactt cttcaagagc 300 gccatgcctg agggatacgt gcaggagagg accatcttct tcaaggacga cgggaactac 360 aagacacgtg ctgaagtcaa gtttgaggga gacaccctcg tcaacaggat cgagcttaag 420 ggaatcgatt tcaaggagga cggaaacatc ctcggccaca agttggaata caactacaac 480 tcccacaacg tatacatcat ggccgacaag caaaagaacg gcatcaaagc caacttcaag 540 acccgccaca acatcgaaga cggcggcgtg caactcgctg atcattatca acaaaatact 600 ccaattggcg atgaccctgt ccttttacca gacaaccatt acctgtccac acaatctgcc 660 ctttcgaaag atcccaacga aaagagagac cacatggtcc ttcttgagtt tgtaacggct 720 gctgggatta cacatggcat ggatgaacta tacaaaaccg gttgggaact gcagatgagt 780 acaaaagatt ttaacttgga tttggtatct gtttcgaaga aagattcagg tgcagtacca 840 cgcattacaa gtatttcgct atgtacaccc ggttgtaaaa caggagctct gatgggttgt 900 aacatgaaaa cagcaacttg tcattgtagt attcacgtaa gcaaa 945 <210> 32 <211> 301 <212> PRT <213> Artificial Sequence <220> <223> GFPMunX Amino Acid Sequence <400> 32 Met Gly Ser Ser His His His His His His Ser Gln Asp Pro Met Ser 1 5 10 15 Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu 20 25 30 Asp Gly Asp Val Asn Gly Tyr Lys Phe Ser Val Ser Gly Glu Gly Glu 35 40 45 Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr 50 55 60 Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Thr Tyr 65 70 75 80 Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Arg His Asp 85 90 95 Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile 100 105 110 Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe 115 120 125 Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe 130 135 140 Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Tyr Asn 145 150 155 160 Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly Ile Lys 165 170 175 Ala Asn Phe Lys Thr Arg His Asn Ile Glu Asp Gly Gly Val Gln Leu 180 185 190 Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Asp Pro Val Leu 195 200 205 Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp 210 215 220 Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val Thr Ala 225 230 235 240 Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys Thr Gly Trp Glu 245 250 255 Leu Gln Lys Tyr Tyr Gly Asn Gly Val Ser Cys Asn Lys Lys Gly Cys 260 265 270 Ser Val Asp Trp Gly Lys Ala Ile Gly Ile Ile Gly Asn Asn Ser Ala 275 280 285 Ala Asn Leu Ala Thr Gly Gly Ala Ala Gly Trp Lys Ser 290 295 300 <210> 33 <211> 903 <212> DNA <213> Artificial sequence <220> <223> GFPMunX nucleotide sequence <400> 33 atgggcagca gccatcacca tcatcaccac agccaggatc cgatgagtaa aggagaagaa 60 cttttcactg gagttgtccc aattcttgtt gaattagatg gtgatgttaa tgggtacaaa 120 ttttctgtca gtggagaggg tgaaggtgat gcaacatacg gaaaacttac ccttaaattt 180 atttgcacta ctggaaaact acctgttcca tggccacac ttgtcactac tctcacttat 240 ggtgttcaat gcttttcaag atatccagat catatgaagc ggcacgactt ctcaagc 300 gccatgcctg agggatacgt gcaggagagg accatcttct tcaggacga cgggaactac 360 aagacacgtg ctgaagtcaa gttgaggga gatacctcg tcacaggat cgagcttaag 420 ggaatcgatt tcaggagga cggaacatc ctcggccaca agttggaata caactacaac 480 tcccacaacg tatacatcat ggccgacaag caaagaacg gcatcaacc caactcaag 540 acccgccaca acatcgaaga cggcggcgtg caaccgctg atcattatca acaaatact 600 ccaattggcg atgaccctgt ccttttacca gandaccatt acctgtccac acatctgcc 660 ctttcgaaag atcccaacga aaagagagac cacatggtcc ttctgagtt tgtaacggct 720 gctgggatta cacatggcat ggatgaacta tacaaaccg gttgggaact gcagaaatac 780 tacggtaatg gagtctcatg tataaaaaa gggtgcagtg tgattgggg aaagctatt 840 ggcattattg gaaataattc tgctgcgaat ttagctactg gtggagcagc tggttggaaa 900 agt 903 <210> 34 <211> 295 <212> PRT <213> Artificial sequence <220> <223> GFPPlantX amino acid sequence <400> 34 Met Gly Ser Ser His His His His His His Ser Gln Asp Pro Met Ser 1 5 10 15 Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu 20 25 30 Asp Gly Asp Val Asn Gly Tyr Lys Phe Ser Val Ser Gly Glu Gly Glu 35 40 45 Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr 50 55 60 Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Thr Tyr 65 70 75 80 Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Arg His Asp 85 90 95 Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile 100 105 110 Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe 115 120 125 Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe 130 135 140 Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Tyr Asn 145 150 155 160 Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly Ile Lys 165 170 175 Ala Asn Phe Lys Thr Arg His Asn Ile Glu Asp Gly Gly Val Gln Leu 180 185 190 Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Asp Pro Val Leu 195 200 205 Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp 210 215 220 Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val Thr Ala 225 230 235 240 Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys Thr Gly Trp Glu 245 250 255 Leu Gln Lys Tyr Tyr Gly Asn Gly Val Thr Cys Gly Lys His Ser Cys 260 265 270 Ser Val Asn Trp Gly Gln Ala Phe Ser Cys Ser Val Ser His Leu Ala 275 280 285 Asn Phe Gly His Gly Lys Cys 290 295 <210> 35 <211> 885 <212> DNA <213> Artificial sequence <220> <223> GFPPlantX nucleotide sequence <400> 35 atgggcagca gccatcacca tcatcaccac agccaggatc cgatgagtaa aggagaagaa 60 cttttcactg gagttgtccc aattcttgtt gaattagatg gtgatgttaa tgggtacaaa 120 ttttctgtca gtggagaggg tgaaggtgat gcaacatacg gaaaacttac ccttaaattt 180 atttgcacta ctggaaaact acctgttcca tggccaacac ttgtcactac tctcacttat 240 ggtgttcaat gcttttcaag atatccagat catatgaagc ggcacgactt cttcaagagc 300 gccatgcctg agggatacgt gcaggagagg accatcttct tcaaggacga cgggaactac 360 aagacacgtg ctgaagtcaa gtttgaggga gacaccctcg tcaacaggat cgagcttaag 420 ggaatcgatt tcaaggagga cggaaacatc ctcggccaca agttggaata caactacaac 480 tcccacaacg tatacatcat ggccgacaag caaaagaacg gcatcaaagc caacttcaag 540 acccgccaca acatcgaaga cggcggcgtg caactcgctg atcattatca acaaaatact 600 ccaattggcg atgaccctgt ccttttacca gacaaccatt acctgtccac acaatctgcc 660 ctttcgaaag atcccaacga aaagagagac cacatggtcc ttcttgagtt tgtaacggct 720 gctgggatta cacatggcat ggatgaacta tacaaaaccg gttgggaact gcagaaatac 780 tatggtaatg gggttacttg tggtaaacat tcctgctctg ttaactgggg ccaagcattt 840 tcttgtagtg tgtcacattt agctaacttc ggtcatggaa agtgc 885 <210> 36 <211> 3829 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of pTAP (RNA thermometer backbone vector) <400> 36 ggggaattgt gagcggataa caattcccct gtagaaataa ttttgtttaa ctttaataag 60 gagatatacc atgggcagca gccatcacca tcatcaccac agccaggatc cgaattcgag 120 ctcggcgcgc ctgcaggtcg acaagcttgc ggccgcataa tgcttaagtc gaacagaaag 180 taatcgtatt gtacacggcc gcataatcga aattaatacg actcactata ggggaattgt 240 gagcggataa caattcccca tcttagtata ttagttctcc ttcaagaagga gatatacata 300 tggcagatct caattggata tcggccggcc acgcgatcgc tgacgtcggt accctcgagt 360 ctggtaaaga aaccgctgct gcgaaatttg aacgccagca catggactcg tctactagcg 420 cagcttaatt aacctaggct gctgccaccg ctgagcaata actagcataa ccccttgggg 480 cctctaaacg ggtcttgagg ggttttttgc tgaaacctca ggcatttgag aagcacacgg 540 tcacactgct tccggtagtc ataaaccgg taaaccagca atagacataa gcggctattt 600 aacgaccctg ccctgaaccg acgacaagct gacgaccggg tctccgcaag tggcactttt 660 cggggaaatg tgcgcggaac ccctatttgt ttattttct aaatacattc aaatatgtat 720 ccgctcatga attaattctt agaaaaactc atcgagcatc aaatgaaact gcaatttatt 780 catatcagga ttatcaatac catattttg aaaaagccgt ttctgtaatg aaggaaaaa 840 ctcaccgagg cagttccata ggatggcaag atcctggtat cggtctgcga ttccgactcg 900 tccaacatca atacaaccta ttaatttccc ctcgtcaaaa ataaggttat caagtgaagaa 960 atcaccatga gtgacgactg aatccggtga gaatggcaaa agtttatgca tttctttcca 1020 gacttgttca acaggccagc cattacgctc gtcatcaaaa tcactcgcat caaccaaacc 1080 gttattcatt cgtgattgcg cctgagcgag acgaaatacg cggtcgctgt taaaaggaca 1140 attacaaaca ggaatcgaat gcaaccggcg caggaacact gccagcgcat caacaatatt 1200 ttcacctgaa tcaggatatt cttctaatac ctggaatgct gttttcccgg ggatcgcagt 1260 ggtgagtaac catgcatcat caggagtacg gataaaatgc ttgatggtcg gaagaggcat 1320 aaattccgtc agccagttta gtctgaccat ctcatctgta acatcattgg caacgctacc 1380 tttgccatgt ttcagaaaca actctggcgc atcgggcttc catacaatc gatagattgt 1440 cgcacctgat tgcccgacat tatcgcgagc ccatttatac ccatataaat cagcatccat 1500 gttggaattt aatcgcggcc tagagcaaga cgtttcccgt tgaatatggc tcatactctt 1560 cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt 1620 tgaatgtatt tagaaaata aacaaatagg catgcagcgc tcttccgctt cctcgctcac 1680 tgactcgcta cgctcggtcg ttcgactgcg gcgagcggtg tcagctcact caaaagcggt 1740 aatacggtta tccacagaat caggggataa agccggaaag aacatgtgag caaaaagcaa 1800 agcaccggaa gaagccaacg ccgcaggcgt ttttccatag gctccgcccc cctgacgagc 1860 atcacaaaaa tcgacgctca agccagaggt ggcgaaaccc gacaggacta taaagatacc 1920 aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 1980 gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgtt 2040 ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 2100 ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 2160 acgacttatc gccactggca gcagccattg gtaactgatt tagaggactt tgtcttgaag 2220 ttatgcacct gttaaggcta aactgaaaga acagattttg gtgagtgcgg tcctccaacc 2280 cacttacctt ggttcaaaga gttggtagct cagcgaacct tgagaaaacc accgttggta 2340 gcggtggttt ttctttattt atgagatgat gaatcaatcg gtctatcaag tcaacgaaca 2400 gctattccgt tactctagat ttcagtgcaa tttatctctt caaatgtagc acctgaagtc 2460 agccccatac gatataagtt gtaattctca tgttagtcat gccccgcgcc caccggaagg 2520 agctgactgg gttgaaggct ctcaagggca tcggtcgaga tcccggtgcc taatgagtga 2580 gctaacttac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt 2640 gccagctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgcc 2700 agggtggttt ttcttttcac cagtgagacg ggcaacagct gattgccctt caccgcctgg 2760 ccctgagaga gttgcagcaa gcggtccacg ctggtttgcc ccagcaggcg aaaatcctgt 2820 ttgatggtgg ttaacggcgg gatataacat gagctgtctt cggtatcgtc gtatcccact 2880 accgagatgt ccgcaccaac gcgcagcccg gactcggtaa tggcgcgcat tgcgcccagc 2940 gccatctgat cgttggcaac cagcatcgca gtgggaacga tgccctcatt cagcatttgc 3000 atggtttgtt gaaaaccgga catggcactc cagtcgcctt cccgttccgc tatcggctga 3060 atttgattgc gagtgagata tttatgccag ccagccagac gcagacgcgc cgagacagaa 3120 cttaatgggc ccgctaacag cgcgatttgc tggtgaccca atgcgaccag atgctccacg 3180 cccagtcgcg taccgtcttc atgggagaaa ataatactgt tgatgggtgt ctggtcagag 3240 acatcaagaa ataacgccgg aacattagtg caggcagctt ccacagcaat ggcatcctgg 3300 tcatccagcg gatagttaat gatcagccca ctgacgcgtt gcgcgagaag attgtgcacc 3360 gccgctttac aggcttcgac gccgcttcgt tctaccatcg acaccaccac gctggcaccc 3420 agttgatcgg cgcgagattt aatcgccgcg acaatttgcg acggcgcgtg cagggccaga 3480 ctggaggtgg caacgccaat cagcaacgac tgtttgcccg ccagttgttg tgccacgcgg 3540 ttgggaatgt aattcagctc cgccatcgcc gcttccactt tttcccgcgt tttcgcagaa 3600 acgtggctgg cctggttcac cacgcgggaa acggtctgat aagagacacc ggcatactct 3660 gcgacatcgt ataacgttac tggtttcaca ttcaccaccc tgaattgact ctcttccggg 3720 cgctatcatg ccataccgcg aaaggttttg cgccattcga tggtgtccgg gatctcgacg 3780 ctctccctta tgcgactcct gcattaggaa attaatacga ctcactata 3829 <210> 37 <211> 761 <212> PRT <213> Artificial sequence <220> <223> GFPLLO amino acid sequence <400> 37 Met Gly Ser Ser His His His His His His Ser Gln Asp Pro Met Ser 1 5 10 15 Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu 20 25 30 Asp Gly Asp Val Asn Gly Tyr Lys Phe Ser Val Ser Gly Glu Gly Glu 35 40 45 Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr 50 55 60 Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Thr Tyr 65 70 75 80 Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Arg His Asp 85 90 95 Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile 100 105 110 Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe 115 120 125 Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe 130 135 140 Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Tyr Asn 145 150 155 160 Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly Ile Lys 165 170 175 Ala Asn Phe Lys Thr Arg His Asn Ile Glu Asp Gly Gly Val Gln Leu 180 185 190 Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Asp Pro Val Leu 195 200 205 Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp 210 215 220 Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val Thr Ala 225 230 235 240 Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys Thr Gly Trp Glu 245 250 255 Leu Gln Ala Ser Ala Phe Asn Lys Glu Asn Ser Ile Ser Ser Met Ala 260 265 270 Pro Pro Ala Ser Pro Pro Ala Ser Pro Lys Thr Pro Ile Glu Lys Lys 275 280 285 His Ala Asp Glu Ile Asp Lys Tyr Ile Gln Gly Leu Asp Tyr Asn Lys 290 295 300 Asn Asn Val Leu Val Tyr His Gly Asp Ala Val Thr Asn Val Pro Pro 305 310 315 320 Arg Lys Gly Tyr Lys Asp Gly Asn Glu Tyr Ile Val Val Glu Lys Lys 325 330 335 Lys Lys Ser Ile Asn Gln Asn Asn Ala Asp Ile Gln Val Val Asn Ala 340 345 350 Ile Ser Ser Leu Thr Tyr Pro Gly Ala Leu Val Lys Ala Asn Ser Glu 355 360 365 Leu Val Glu Asn Gln Pro Asp Val Leu Pro Val Lys Arg Asp Ser Leu 370 375 380 Thr Leu Ser Ile Asp Leu Pro Gly Met Thr Asn Gln Asp Asn Lys Ile 385 390 395 400 Val Val Lys Asn Ala Thr Lys Ser Asn Val Asn Asn Ala Val Asn Thr 405 410 415 Leu Val Glu Arg Trp Asn Glu Lys Tyr Ala Gln Ala Tyr Pro Asn Val 420 425 430 Ser Ala Lys Ile Asp Tyr Asp Asp Glu Met Ala Tyr Ser Glu Ser Gln 435 440 445 Leu Ile Ala Lys Phe Gly Thr Ala Phe Lys Ala Val Asn Asn Ser Leu 450 455 460 Asn Val Asn Phe Gly Ala Ile Ser Glu Gly Lys Met Gln Glu Glu Val 465 470 475 480 Ile Ser Phe Lys Gln Ile Tyr Tyr Asn Val Asn Val Asn Glu Pro Thr 485 490 495 Arg Pro Ser Arg Phe Phe Gly Lys Ala Val Thr Lys Glu Gln Leu Gln 500 505 510 Ala Leu Gly Val Asn Ala Glu Asn Pro Pro Ala Tyr Ile Ser Ser Val 515 520 525 Ala Tyr Gly Arg Gln Val Tyr Leu Lys Leu Ser Thr Asn Ser His Ser 530 535 540 Thr Lys Val Lys Ala Ala Phe Asp Ala Ala Val Ser Gly Lys Ser Val 545 550 555 560 Ser Gly Asp Val Glu Leu Thr Asn Ile Ile Lys Asn Ser Ser Phe Lys 565 570 575 Ala Val Ile Tyr Gly Gly Ser Ala Lys Asp Glu Val Gln Ile Ile Asp 580 585 590 Gly Asn Leu Gly Asp Leu Arg Asp Ile Leu Lys Lys Gly Ala Thr Phe 595 600 605 Asn Arg Glu Thr Pro Gly Val Pro Ile Ala Tyr Thr Thr Asn Phe Leu 610 615 620 Lys Asp Asn Glu Leu Ala Val Ile Lys Asn Asn Ser Glu Tyr Ile Glu 625 630 635 640 Thr Thr Ser Lys Ala Tyr Thr Asp Gly Lys Ile Asn Ile Asp His Ser 645 650 655 Gly Gly Tyr Val Ala Gln Phe Asn Ile Ser Trp Asp Glu Val Asn Tyr 660 665 670 Asp Pro Glu Gly Asn Glu Ile Val Gln His Lys Asn Trp Ser Glu Asn 675 680 685 Asn Lys Ser Lys Leu Ala His Phe Thr Ser Ser Ile Tyr Leu Pro Gly 690 695 700 Asn Ala Arg Asn Ile Asn Val Tyr Ala Lys Glu Cys Thr Gly Leu Ala 705 710 715 720 Trp Glu Trp Trp Arg Thr Val Ile Asp Asp Arg Asn Leu Pro Leu Val 725 730 735 Lys Asn Arg Asn Ile Ser Ile Trp Gly Thr Thr Leu Tyr Pro Lys Tyr 740 745 750 Ser Asn Lys Val Asp Asn Pro Ile Glu 755 760 <210> 38 <211> 2283 <212> DNA <213> The snowstorm <220> <223> GFPLLO sleeve mounting <400> 38 atgggcagca gccatcacca tcatcaccac agccaggatc cgatgagtaa aggagaagaa cttttcactg gagttgtccc aattcttgtt gaattagtg gtgatgttaa tgggtacaaa ttttctgtca gtggagaggg tgaaggtgat gcaacatacg gaaaacttac ccttaaattt atttgcacta ctggaaaact acctgttcca tggccaacac ttgtcactac tctcacttat ggtgttcaat gcttttcaag atatccagat catatgaagc ggcacgactt cttcaagagc gccatgcctg agggatacgt gcaggagagg accatcttct tcaaggacga cgggaactac 360 aagacacgtg ctgaagtcaa gtttgaggga gacaccctcg tcaacaggat cgagcttaag ggaatcgatt tcaaggagga cggaaacatc ctcggccaca agttggaata caactacaac tcccacaacg tatacatcat ggccgacaag caaaagaacg gcatcaaagc caacttcaag acccgccaca acatcgaaga cggcggcgtg caactcgctg atcattatca acaaaatact ccaattggcg atgaccctgt ccttttacca gacaaccatt acctgtccac acaatctgcc 660 ctttcgaaag atcccaacga aaagagagac cacatggtcc ttcttgagtt tgtaacggct 720 gctgggatta cacatggcat ggatgaacta tacaaaaccg gttgggaact gcaggcatct 780 gcattcaata aagaaaattc aatttcatcc atggcaccac cagcatctcc gcctgcaagt 840 cctaagacgc caatcgaaaa gaaacacgcg gatgaaatcg ataagtatat acaaggattg 900 gattacaata aaaacaatgt attagtatac cacggagatg cagtgacaaa tgtgccgcca 960 agaaaaggtt acaaagatgg aaatgaatat attgttgtgg agaaaaagaa gaaatccatc 1020 aatcaaaata atgcagacat tcaagttgtg aatgcaattt cgagcctaac ctatccaggt 1080 gctctcgtaa aagcgaattc ggaattagta gaaaatcaac cagatgttct ccctgtaaaa 1140 cgtgattcat taacactcag cattgatttg ccaggtatga ctaatcaaga caataaaatc 1200 gttgtaaaaa atgccactaa atcaaacgtt aacaacgcag taaatacatt agtggaaaga 1260 tggaatgaaa aatatgctca agcttatcca aatgtaagtg caaaaattga ttatgatgac 1320 gaaatggctt acagtgaatc acaattaatt gcgaaatttg gtacagcatt taaagctgta 1380 aataatagct tgaatgtaaa cttcggcgca atcagtgaag ggaaaatgca agaagaagtc 1440 attagtttta aacaaattta ctataacgtg aatgttaatg aacctacaag accttccaga 1500 ttttcggca aagctgttac taaagagcag ttgcaagcgc ttggagtgaa tgcagaaaat 1560 cctcctgcat atatctcaag tgtggcgtat ggccgtcaag tttatttgaa attatcaact 1620 aattcccata gtactaaagt aaaagctgct tttgatgctg ccgtaagcgg aaaatctgtc 1680 tcaggtgatg tagaactaac aaatatcatc aaaaattctt ccttcaaagc cgtaatttac 1740 ggaggttccg caaaagatga agttcaaatc atcgacggca acctcggaga cttacgcgat 1800 atttgaaaa aaggcgctac ttttaatcga gaaacaccag gagttcccat tgcttataca 1860 acaaacttcc taaaagacaa tgaattagct gttattaaaa acaactcaga atatattgaa 1920 acaacttcaa aagcttatac agatggaaaa attaacatcg atcactctgg aggatacgtt 1980 gctcaattca acatttcttg ggatgaagta aattatgatc ctgaaggtaa cgaaattgtt 2040 caacataaaa actggagcga aaacaataaa agcaagctag ctcatttcac atcgtccatc 2100 tatttgccag gtaacgcgag aaatattaat gtttacgcta aagaatgcac tggtttagct 2160 tgggaatggt ggagaacggt aattgatgac cggaacttac cacttgtgaa aaatagaaat 2220 atctccatct ggggcaccac gctttatccg aaatatagta ataaagtaga taatccaatc 2280 gaa 2283 <210> 39 <211> 1065 <212> PRT <213> Artificial Sequence <220> <223> GFPActA Amino Acid Sequence <400> 39 Met Gly Ser Ser His His His His His His Ser Gln Asp Pro Met Ser 1 5 10 15 Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu 20 25 30 Asp Gly Asp Val Asn Gly Tyr Lys Phe Ser Val Ser Gly Glu Gly Glu 35 40 45 Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr 50 55 60 Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Thr Tyr 65 70 75 80 Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Arg His Asp 85 90 95 Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile 100 105 110 Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe 115 120 125 Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe 130 135 140 Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Tyr Asn 145 150 155 160 Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly Ile Lys 165 170 175 Ala Asn Phe Lys Thr Arg His Asn Ile Glu Asp Gly Gly Val Gln Leu 180 185 190 Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Asp Pro Val Leu 195 200 205 Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp 210 215 220 Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val Thr Ala 225 230 235 240 Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys Thr Gly Trp Glu 245 250 255 Leu Gln Asp Ser Glu Asp Ser Ser Leu Asn Thr Asp Glu Trp Glu Glu 260 265 270 Glu Lys Thr Glu Glu Gln Pro Ser Glu Val Asn Thr Gly Pro Arg Tyr 275 280 285 Glu Thr Ala Arg Glu Val Ser Ser Arg Asp Ile Lys Glu Leu Glu Lys 290 295 300 Ser Asn Lys Val Arg Asn Thr Asn Lys Ala Asp Leu Ile Ala Met Leu 305 310 315 320 Lys Glu Lys Ala Glu Lys Gly Pro Asn Ile Asn Asn Asn Asn Ser Glu 325 330 335 Gln Thr Glu Asn Ala Ala Ile Asn Glu Glu Ala Ser Gly Ala Asp Arg 340 345 350 Pro Ala Ile Gln Val Glu Arg Arg His Pro Gly Leu Pro Ser Asp Ser 355 360 365 Ala Ala Glu Ile Lys Lys Arg Arg Lys Ala Ile Ala Ser Ser Asp Ser 370 375 380 Glu Leu Glu Ser Leu Thr Tyr Pro Asp Lys Pro Thr Lys Val Asn Lys 385 390 395 400 Lily Lys Val Ala Lily Glu Ser Val Ala Asp Ala Ser Glu Ser Asp Leu 405 410 415 Asp Ser Ser Met Gln Ser Ala Asp Glu Ser Ser Pro Gln Pro Leu Lys 420 425 430 Ala Asn Gln Gln Pro Phe Phe Pro Lys Val Phe Lys Lys Ile Lys Asp 435 440 445 Ala Gly Lys Trp Val Arg Asp Lys Ile Asp Glu Asn Pro Glu Val Lys 450 455 460 Lys Ala Ile Val Asp Lys Ser Ala Gly Leu Ile Asp Gln Leu Leu Thr 465 470 475 480 Lys Lys Lys Ser Glu Glu Val Asn Ala Ser Asp Phe Pro Pro Pro Pro 485 490 495 Thr Asp Glu Glu Leu Arg Leu Ala Leu Pro Glu Thr Pro Met Leu Leu 500 505 510 Gly Phe Asn Ala Pro Ala Thr Ser Glu Pro Ser Ser Phe Glu Phe Pro 515 520 525 Pro Pro Pro Thr Asp Glu Glu Leu Arg Leu Ala Leu Pro Glu Thr Pro 530 535 540 Met Leu Leu Gly Phe Asn Ala Pro Ala Thr Ser Glu Pro Ser Ser Phe 545 550 555 560 Glu Phe Pro Pro Pro Pro Thr Glu Asp Glu Leu Glu Ile Ile Arg Glu 565 570 575 Thr Ala Ser Ser Leu Asp Ser Ser Phe Thr Arg Gly Asp Leu Ala Ser 580 585 590 Leu Arg Asn Ala Ile Asn Arg His Ser Gln Asn Phe Ser Asp Phe Pro 595 600 605 Pro Ile Pro Thr Glu Glu Glu Leu Asn Gly Arg Gly Gly Arg Pro Thr 610 615 620 Ser Glu Glu Phe Ser Ser Leu Asn Ser Gly Asp Phe Thr Asp Asp Glu 625 630 635 640 Asn Ser Glu Thr Thr Glu Glu Glu Ile Asp Arg Leu Ala Asp Leu Arg 645 650 655 Asp Arg Gly Thr Gly Lys His Ser Arg Asn Ala Gly Phe Leu Pro Leu 660 665 670 Asn Pro Phe Ala Ser Ser Pro Val Pro Ser Leu Ser Pro Lys Val Ser 675 680 685 Lys Ile Ser Ala Pro Ala Leu Ile Ser Asp Ile Thr Lys Lys Thr Pro 690 695 700 Phe Lys Asn Pro Ser Gln Pro Leu Asn Val Phe Asn Lys Lys Thr Thr 705 710 715 720 Thr Lys Thr Val Thr Lys Lys Pro Thr Pro Val Lys Thr Ala Pro Lys 725 730 735 Leu Ala Glu Leu Pro Ala Thr Lys Pro Gln Glu Thr Val Leu Arg Glu 740 745 750 Asn Lys Thr Pro Phe Ile Glu Lys Gln Ala Glu Thr Asn Lys Gln Ser 755 760 765 Ile Asn Met Pro Ser Leu Pro Val Ile Gln Lys Glu Ala Thr Glu Ser 770 775 780 Asp Lys Glu Glu Met Lys Pro Gln Thr Glu Glu Lys Met Val Glu Glu 785 790 795 800 Ser Glu Ser Ala Asn Asn Ala Asn Gly Lys Asn Arg Ser Ala Gly Ile 805 810 815 Glu Glu Gly Lys Leu Ile Ala Lys Ser Ala Glu Asp Glu Lys Ala Lys 820 825 830 Glu Glu Pro Gly Asn His Thr Thr Ala Val Pro Arg Ala Ala Ala Ser 835 840 845 Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro Thr Arg 850 855 860 Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu Tyr Glu 865 870 875 880 Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu Gly Leu 885 890 895 Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys Leu Thr 900 905 910 Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn Met Leu 915 920 925 Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu Gly Ala 930 935 940 Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser Lys Asp 945 950 955 960 Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu Met Leu 965 970 975 Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn Gly Asp 980 985 990 His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp Val Val 995 1000 1005 Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu Val 1010 1015 1020 Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr 1025 1030 1035 Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln 1040 1045 1050 Ala Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser 1055 1060 1065 <210> 40 <211> 3195 <212> DNA <213> Artificial Sequence <220> <223> GFPActA Nucleotide Sequence <400> 40 atgggcagca gccatcacca tcatcaccac agccaggatc cgatgagtaa aggagaagaa 60 cttttcactg gagttgtccc aattcttgtt gaattagatg gtgatgttaa tgggtacaaa 120 ttttctgtca gtggagaggg tgaaggtgat gcaacatacg gaaaacttac ccttaaattt 180 atttgcacta ctggaaaact acctgttcca tggccaacac ttgtcactac tctcacttat 240 ggtgttcaat gcttttcaag atatccagat catatgaagc ggcacgactt cttcaagagc 300 gccatgcctg agggatacgt gcaggagagg accatcttct tcaaggacga cgggaactac 360 aagacacgtg ctgaagtcaa gttgaggga gatacctcg tcacaggat cgagcttaag 420 ggaatcgatt tcaggagga cggaacatc ctcggccaca agttggaata caactacaac 480 tcccacaacg tatacatcat ggccgacaag caaagaacg gcatcaacc caactcaag 540 acccgccaca acatcgaaga cggcggcgtg caaccgctg atcattatca acaaatact 600 ccaattggcg atgaccctgt ccttttacca gandaccatt acctgtccac acatctgcc 660 ctttcgaaag atcccaacga aaagagagac cacatggtcc ttctgagtt tgtaacggct 720 gctgggatta cacatggcat ggatgaacta tacaaaccg gttgggaact gcaggatagc 780 gagattcta gtctaacac agatgaatgg gagagaaaaaacagaa gcaaccaagc 840 gaggtaata cgggaccaag atacgaact gcacgtgaag taagttcacg tgatataaa 900 gaactagaaa atcgaata agtgagaat acgaaaag cagacctaat agcaatgttg 960 aaagaaaaag cagaaaaagg tccaataatc ataataca acagtgaaca aactgagaat 1020 gcggctataa atgagaggc ttcaggagcc gaccgaccag ctatacaagt ggagcgtcgt 1080 catccaggat tgccatcgga tagcgcagcg gaaattaaaa aaagaaggaa agccatagca 1140 tcatcggata gtgagcttga aagccttact tatccggata aaccaacaaa agtaaataag 1200 aaaaaagtgg cgaaagagtc agttgcggat gcttctgaaa gtgacttaga ttctagcatg 1260 cagtcagcag atgagtcttc accacaacct ttaaaagcaa accaacaacc atttttccct 1320 aaagtattta aaaaaataaa agatgcgggg aaatgggtac gtgataaaat cgacgaaaat 1380 cctgaagtaa agaaagcgat tgttgataaa agtgcagggt taattgacca attattaacc 1440 aaaaagaaaa gtgaagaggt aaatgcttcg gacttcccgc caccacctac ggatgaagag 1500 ttaagacttg ctttgccaga gacaccaatg cttcttggtt ttaatgctcc tgctacatca 1560 gaaccgagct cattcgaatt tccaccacca cctacggatg aagagttaag acttgctttg 1620 ccagagacgc caatgcttct tggttttaat gctcctgcta catcggaacc gagctcgttc 1680 gaatttccac cgcctccaac agaagatgaa ctagaaatca tccgggaaac agcatcctcg 1740 ctagattcta gttttacaag aggggattta gctagtttga gaaatgctat taatcgccat 1800 agtcaaatt tctctgatt cccaccaatc cccacagag aagagttgaa cgggagaggc 1860 ggtagaccaa catctgaaga atttagttcg ctgaatagtg gtgattttac agatgacgaa 1920 aacagcgaga acagaga agaattgat cgcctagctg atttagaga taggagaca 1980 ggaaaacact caagaatgc gggtttttta ccattaaatc cgtttgctag cagcccggtt 2040 ccttcgttaa gtccaaggt atcgaaaata agcgcaccgg ctctgataag tgacatact 2100 aaaaaaacgc cattaagaa tccacacag ccattaatg tgttaataa aaaaactaca 2160 acgaaaacag tgactaaaa accaacccct gtaagaccg caccaaagct agcagaactt 2220 cctgccacaa aaccacaaga aaccgtactt agggaaata aacaccctt tatagaaaaa 2280 caagcagaaaaaaaaacaaaaaacaaaaaaaaaaaaaaaaaacaaggcc taccagtaat ccaaaaagaa 2340 gctacagaga gcgataaga ggaatgaaa ccacaaccg aggaaaaat ggtagaggaa 2400 agcgaatcag ctataacgc aaacggaaaaatcgttctg ctggcattga agaaggaaaa 2460 ctaattgcta aaagtgcaga agacgaaaa gcgaaggaag aaccaggga ccatacgacg 2520 gcagtaccac gcgcggccgc gtcccctata ctaggttatt ggaaaattaa gggccttgtg 2580 caacccactc gacttctttt ggaatatctt gaagaaaaat atgaagagca tttgtatgag 2640 cgcgatgaag gtgataaatg gcgaaacaaa aagttttgaat tgggtttgga gtttcccaat 2700 cttccttatt atattgatgg tgatgttaaa ttaacacagt ctatggccat catacgttat 2760 atagctgaca agcacaacat gttgggtggt tgtccaaaag agcgtgcaga gatttcaatg 2820 cttgaaggag cggttttgga tattagatac ggtgtttcga gaattgcata tagtaaagac 2880 tttgaaactc tcaaagttga ttttcttagc aagctacctg aaatgctgaa aatgttcgaa 2940 gatcgttat gtcataaaac atatttaaat ggtgatcatg taacccatcc tgacttcatg 3000 ttgtatgacg ctcttgatgt tgtttatac atggacccaa tgtgcctgga tgcgttccca 3060 aaattagttt gttttaaaaa acgtattgaa gctatcccac aaattgataa gtacttgaaa 3120 tccagcaagt atatagcatg gcctttgcag ggctggcaag ccacgtttgg tggtggcgac 3180 catcctccaa aatcg 3195 <210> 41 <211> 50 <212> DNA <213> Artificial sequence <220> <223> GFP_BamHI_F primer sequence <400> 41 ggatccgatg agtaaaggag aagaactttt cactggagtt gtcccaattc 50 <210> 42 <211> 50 <212> DNA <213> Artificial sequence <220> <223> GFPWELQ_PstI_R primer sequence <400> 42 ctgcagttcc caaccggttt tgtatagttc atccatgcca tgtgtaatcc 50 <210> 43 <211> 38 <212> DNA <213> Artificial sequence <220> <223> NisA_BamHI_F primer sequence <400> 43 ctagatggat ccgatgagta caaaagattt taacttgg 38 <210> 44 <211> 37 <212> DNA <213> Artificial sequence <220> <223> NisA_HindIII_R primer <400> 44 ctagaagcttttatttgctt acgtgaatac tacaatg 37 <210> 45 <211> 43 <212> DNA <213> Artificial sequence <220> <223> NisB_BglII_F primer <400> 45 cagccgagat ctgatgataa aaagttcatt taaagctcaa ccg 43 <210> 46 <211> 42 <212> DNA <213> Artificial sequence <220> <223> NisB_XhoI_R primer <400> 46 ctagctcgag tcatttcatg tattcttccg aaacaaacaa cc 42 <210> 47 <211> 45 <212> DNA <213> Artificial sequence <220> <223> NisC_BglII_F primer <400> 47 ctagggaaga tctgatgaat aaaaaaaata taaaaagaaa tgttg 45 <210> 48 <211> 43 <212> DNA <213> Artificial sequence <220> <223> NisC_XhoI_R primer <400> 48 ctagctcgag tcatttcctc ttccctcctt tcaaaaaatc gtc 43 <210> 49 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> GFPNisLeader_PstI_F Primer <400> 49 ggaactgcag atgagtacaa aaga 24 <210> 50 <211> 37 <212> DNA <213> Artificial sequence <220> <223> NisinLThPep5_F Primer <400> 50 caggtgcagt accacgcacc gcgggtccgg cgatccg 37 <210> 51 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Pep5HindIII_R primer <400> 51 caccaagcttttatttgcagccgtttttac 30 <210> 52 <211> 37 <212> DNA <213> Artificial sequence <220> <223> NisinLTh15X_F Primer <400> 52 caggtgcagt accacgcagc gcgagcatcg tgaagac 37 <210> 53 <211> 31 <212> DNA <213> Artificial sequence <220> <223> 15XHindIII_R primer <400> 53 gcgccaagct tttatttctt gccggtaaag t 31 <210> 54 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> NisLeaderThr_R primer <400> 54 gcgtggtact gcacctgaat c 21 <210> 55 <211> 25 <212> DNA <213> Artificial sequence <220> <223> NisLeaderOri_F Primer <400> 55 gaaagattca ggtgcatcac cacgc 25 <210> 56 <211> 25 <212> DNA <213> Artificial sequence <220> <223> NisLeaderOri_R Primer <400> 56 gcgtggtgat gcacctgaat ctttc 25 <210> 57 <211> 30 <212> DNA <213> Artificial sequence <220> <223> NisLeaderNisThr_F Primer <400> 57 ttcaggtgca gtaccacgca ttacaagtat 30 <210> 58 <211> 30 <212> DNA <213> Artificial sequence <220> <223> NisLeaderNisThr_R Primer <400> 58 atacttgtaa tgcgtggtac tgcacctgaa 30 <210> 59 <211> 33 <212> DNA <213> Artificial sequence <220> <223> GFP-PlaX_Pst_Fwd Primer <400> 59 taagggatcc gtgggaactg cagaaatact atg 33 <210> 60 <211> 41 <212> DNA <213> Artificial sequence <220> <223> GFP-PlaX_Hind_Rev Primer <400> 60 tattaagctt agcactttcc atgaccgaag ttagctaaat g 41 <210> 61 <211> 47 <212> DNA <213> Artificial sequence <220> <223> GFP-MunX_Pst_Fwd Primer <400> 61 atcgctgcag aaatactacg gtaatggagt ctcatgtaat aaaaaag 47 <210> 62 <211> 29 <212> DNA <213> Artificial sequence <220> <223> GFP-MunX_Hind_Rev Primer <400> 62 acgcaagctt aacttttcca accagctgc 29 <210> 63 <211> 20 <212> DNA <213> Artificial sequence <220> <223> pRSFMCS1_R Primer <400> 63 gattatgcgg ccgtgtacaa 20 <210> 64 <211> 35 <212> DNA <213> Artificial sequence <220> <223> GST_NotI_F primer <400> 64 gcgcggccgc gtcccctata ctaggttatt ggaaa 35 <210> 65 <211> 35 <212> DNA <213> Artificial sequence <220> <223> GST_XhoI_R primer <400> 65 cagactcgag ttacgatttt ggaggatggt cgcca 35 <210> 66 <211> 30 <212> DNA <213> Artificial sequence <220> <223> WLLO_PstI_F primer <400> 66 gggactgca ggcatctgca ttcaataaag 30 <210> 67 <211> 30 <212> DNA <213> Artificial sequence <220> <223> LLO_NotI_R primer <400> 67 attatgcggc cgcttattcg attggattat 30 <210> 68 <211> 37 <212> DNA <213> Artificial sequence <220> <223> WActA_PstI_F primer <400> 68 gggactgca ggatagcgaa gattctagtc taaacac 37 <210> 69 <211> 30 <212> DNA <213> Artificial sequence <220> <223> ActA_NotI_R primer <400> 69 atgcggccgc ttacgtcgta tggttccctg 30 <210> 70 <211> 30 <212> DNA <213> Artificial sequence <220> <223> GPR-F Primer <400> 70 atggcagatc tggtagaaat caataatcaa 30 <210> 71 <211> 33 <212> DNA <213> Artificial sequence <220> <223> GPR-R Primers <400> 71 ataggtacct catacatcaa tctctctgac cgt 33 <210> 72 <211> 30 <212> DNA <213> Artificial sequence <220> <223> GPE-F Primer <400> 72 atggcagatc tgaatatttt tgaaatgctg 30 <210> 73 <211> 30 <212> DNA <213> Artificial sequence <220> <223> GPE-R Primer <400> 73 cagactcgagttacagatttttatatgcat 30 <210> 74 <211> 214 <212> DNA <213> Artificial sequence <220> <223> Quiescent promoter 1 <400> 74 ggcgccctgg cacaggaacg ttatccggac gttcagttcc accagacccg cgagcattaa 60 ttcttgcctc cagggcgcgg tagtcgcgcc ctgtcaattt cccttcctta ttagccgctt 120 acggaatgtt cttaaaacat tcacttttgc ttatgttttc gctcatatcc cgagcggttt 180 caaaattgtg atctatattt aacaaattaa ttaa 214 <210> 75 <211> 231 <212> DNA <213> Artificial sequence <220> <223> Quiescent promoter 2 <400> 75 ggcgcctttg tggtgatcta cactgatact ctgttgcatt attcgcctga aaccacaata 60 ttcaggcgtt ttttcgctat ctttgacaaa aaatatcaac tttctcgatt tgctctcagc 120 ccttatatca cgggaaattc cggcgatttg ctcgcatcaa tattcatgcc acatttgcca 180 tcaggggccg cctcagattc tcagtatgtt ataatagaaa aaattaatta a 231 <210> 76 <211> 197 <212> DNA <213> Artificial sequence <220> <223> Static phase promoter 3 <400> 76 ggcgccaaaa aatattcagt tacaggaaag gtcagggcag ggattctaca gagttctgga 60 taaaatttgt atcgcaatct cattcgctgc cggaggcgaa ggaaatgtaa attttgttaa 120 ttcggcgtga agaattgatc ctggacagca ttttgctcaa aaaatagcca tactatttaa 180 ttgcaacaat taattaa 197 <210> 77 <211> 328 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA thermometer combination 1 <400> 77 ggcgccaaaa aatattcagt tacaggaaag gtcagggcag ggattctaca gagttctgga 60 taaaatttgt atcgcaatct cattcgctgc cggaggcgaa ggaaatgtaa attttgttaa 120 ttcggcgtga agaattgatc ctggacagca ttttgctcaa aaaatagcca tactatttaa 180 ttgcaacaat taattaaggc ctaattatag cacttaatcg aaataaattt atgagtacgt 240 agagtataat tagtattctt ctttccaact tccttatact tatatactta tagattctaa 300 aatcatgaaa cggattcttt gcggatcc 328 <210> 78 <211> 261 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 2 <400> 78 ggcgccaaaa aatattcagt tacaggaaag gtcagggcag ggattctaca gagttctgga 60 taaaatttgt atcgcaatct cattcgctgc cggaggcgaa ggaaatgtaa attttgttaa 120 ttcggcgtga agaattgatc ctggacagca ttttgctcaa aaaatagcca tactatttaa 180 ttgcaacaat taattaaaca gcaattttgc gttatctgtt aatcgagact gaaatacatg 240 aaaaaaacca cattaggatc c 261 <210> 79 <211> 437 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 3 <400> 79 ggcgccaaaa aatattcagt tacaggaaag gtcagggcag ggattctaca gagttctgga 60 taaaatttgt atcgcaatct cattcgctgc cggaggcgaa ggaaatgtaa attttgttaa 120 ttcggcgtga agaattgatc ctggacagca ttttgctcaa aaaatagcca tactatttaa 180 ttgcaacaat taattaaacg gtttgacgta cagaccatta aagcagtgta gtaaggcaag 240 tcccttcaag agttatcgtt gatacccctc gtagtgcaca ttcctttaac gcttcaaaat 300 ctgtaaagca cgccatatcg ccgaaaggca cacttaatta ttaaaggtaa tacactatgt 360 ccggtaaaat gactggtatc gtaaaatggt tcaacgctga caaaggcttc ggcttcatca 420 ctcctgacga tggatcc 437 <210> 80 <211> 261 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 4 <400> 80 ggcgccaaaa aatattcagt tacaggaaag gtcagggcag ggattctaca gagttctgga 60 taaaatttgt atcgcaatct cattcgctgc cggaggcgaa ggaaatgtaa attttgttaa 120 ttcggcgtga agaattgatc ctggacagca ttttgctcaa aaaatagcca tactatttaa 180 ttgcaacaat taattaaaca gcaattttgc gttacctgtt aatcgagatt gaaacacatg 240 aaaaaaacca cattaggatc c 261 <210> 81 <211> 265 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 5 <400> 81 ggcgccaaaa aatattcagt tacaggaaag gtcagggcag ggattctaca gagttctgga 60 taaaatttgt atcgcaatct cattcgctgc cggaggcgaa ggaaatgtaa attttgttaa 120 ttcggcgtga agaattgatc ctggacagca ttttgctcaa aaaatagcca tactatttaa 180 ttgcaacaat taattaaatt caagggtaat caattccttc cacacatcag gagttaacat 240 tatgtctctc attctttacg gatcc 265 <210> 82 <211> 292 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA thermometer combination 6 <400> 82 ggcgccaaaa aatattcagt tacaggaaag gtcagggcag ggattctaca gagttctgga 60 taaaatttgt atcgcaatct cattcgctgc cggaggcgaa ggaaatgtaa attttgttaa 120 ttcggcgtga agaattgatc ctggacagca ttttgctcaa aaaatagcca tactatttaa 180 ttgcaacaat taattaaggc cactttagtc tgtggttact gtattaggta ttgttataac 240 aatctggatg gtttttatga ataagacatt actggtctct tctttaggat cc 292 <210> 83 <211> 315 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 7 <400> 83 ggcgccaaaa aatattcagt tacaggaaag gtcagggcag ggattctaca gagttctgga 60 taaaatttgt atcgcaatct cattcgctgc cggaggcgaa ggaaatgtaa attttgttaa 120 ttcggcgtga agaattgatc ctggacagca ttttgctcaa aaaatagcca tactatttaa 180 ttgcaacaat taattaatgt gttttttgta agttctatta aatacatcag tttacagcaa 240 tgaattcacc attgtgcatc gtcaataaaa ggagtgttta tgaaaaatca atggcaacat 300 caatattttg gatcc 315 <210> 84 <211> 345 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 8 <400> 84 ggcgccctgg cacaggaacg ttatccggac gttcagttcc accagacccg cgagcattaa 60 ttcttgcctc cagggcgcgg tagtcgcgcc ctgtcaattt cccttcctta ttagccgctt 120 acggaatgtt cttaaaacat tcacttttgc ttatgttttc gctcatatcc cgagcggttt 180 caaaattgtg atctatattt aacaaattaa ttaaggccta attatagcac ttaatcgaaa 240 taaatttatg agtacgtaga gtataattag tattcttctt tccaacttcc ttatacttat 300 atacttatag attctaaaat catgaaacgg attctttgcg gatcc 345 <210> 85 <211> 295 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 9 <400> 85 ggcgcctttg tggtgatcta cactgatact ctgttgcatt attcgcctga aaccacaata 60 ttcaggcgtt ttttcgctat ctttgacaaa aaatatcaac tttctcgatt tgctctcagc 120 ccttatatca cgggaaattc cggcgatttg ctcgcatcaa tattcatgcc acatttgcca 180 tcaggggccg cctcagattc tcagtatgtt ataatagaaa aaattaatta aacagcaatt 240 ttgcgttatc tgttaatcga gactgaaata catgaaaaaa accacattag gatcc 295 <210> 86 <211> 471 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 10 <400> 86 ggcgcctttg tggtgatcta cactgatact ctgttgcatt attcgcctga aaccacaata 60 ttcaggcgtt ttttcgctat ctttgacaaa aaatatcaac tttctcgatt tgctctcagc 120 ccttatatca cgggaaattc cggcgatttg ctcgcatcaa tattcatgcc acatttgcca 180 tcaggggccg cctcagattc tcagtatgtt ataatagaaa aaattaatta aacggtttga 240 cgtacagacc attaaagcag tgtagtaagg caagtccctt caagagttat cgttgatacc 300 cctcgtagtg cacattcctt taacgcttca aaatctgtaa agcacgccat atcgccgaaa 360 ggcacactta attattaaag gtaatacact atgtccggta aaatgactgg tatcgtaaaa 420 tggttcaacg ctgacaaagg cttcggcttc atcactcctg acgatggatc c 471 <210> 87 <211> 295 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA thermometer combination 11 <400> 87 ggcgcctttg tggtgatcta cactgatact ctgttgcatt attcgcctga aaccacaata 60 ttcaggcgtt ttttcgctat ctttgacaaa aaatatcaac tttctcgatt tgctctcagc 120 ccttatatca cgggaaattc cggcgatttg ctcgcatcaa tattcatgcc acatttgcca 180 tcaggggccg cctcagattc tcagtatgtt ataatagaaa aaattaatta aacagcaatt 240 ttgcgttacc tgttaatcga gattgaaaca catgaaaaaa accacattag gatcc 295 <210> 88 <211> 299 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 12 <400> 88 ggcgcctttg tggtgatcta cactgatact ctgttgcatt attcgcctga aaccacaata 60 ttcaggcgtt ttttcgctat ctttgacaaa aaatatcaac tttctcgatt tgctctcagc 120 ccttatatca cgggaaattc cggcgatttg ctcgcatcaa tattcatgcc acatttgcca 180 tcaggggccg cctcagattc tcagtatgtt ataatagaaa aaattaatta aattcaaggg 240 taatcaattc cttccacaca tcaggagtta acattatgtc tctcattctt tacggatcc 299 <210> 89 <211> 326 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 13 <400> 89 ggcgcctttg tggtgatcta cactgatact ctgttgcatt attcgcctga aaccacaata 60 ttcaggcgtt ttttcgctat ctttgacaaa aaatatcaac tttctcgatt tgctctcagc 120 ccttatatca cgggaaattc cggcgatttg ctcgcatcaa tattcatgcc acatttgcca 180 tcaggggccg cctcagattc tcagtatgtt ataatagaaa aaattaatta aggccacttt 240 agtctgtggt tactgtatta ggtattgtta taacaatctg gatggttttt atgaataaga 300 cattactggt ctcttcttta ggatcc 326 <210> 90 <211> 349 <212> DNA <213> Artificial Sequence <220> <223> Promoter / RNA Thermometer Combo 14 <400> 90 ggcgcctttg tggtgatcta cactgatact ctgttgcatt attcgcctga aaccacaata 60 ttcaggcgtt ttttcgctat ctttgacaaa aaatatcaac tttctcgatt tgctctcagc 120 ccttatatca cgggaaattc cggcgatttg ctcgcatcaa tattcatgcc acatttgcca 180 tcaggggccg cctcagattc tcagtatgtt ataatagaaa aaattaatta atgtgttttt 240 tgtaagttct attaaataca tcagtttaca gcaatgaatt caccattgtg catcgtcaat 300 aaaaggagtg tttatgaaaa atcaatggca acatcaatat tttggatcc 349 <210> 91 <211> 373 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 15 <400> 91 ggcgcctttg tggtgatcta cactgatact ctgttgcatt attcgcctga aaccacaata 60 ttcaggcgtt ttttcgctat ctttgacaaa aaatatcaac tttctcgatt tgctctcagc 120 ccttatatca cgggaaattc cggcgatttg ctcgcatcaa tattcatgcc acatttgcca 180 tcaggggccg cctcagattc tcagtatgtt ataatagaaa aaattaatta atgtaaaaaa 240 catcatttag cgtgactttc tttcaacagc taacaattgt tgttatactgcc taatgttttt 300 agggtatttt aaaaaagggc gataaaaaac gattggggga tgagacatga acgctcaagc 360 agaagaagga tcc 373 <210> 92 <211> 362 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 16 <400> 92 ggcgcctttg tggtgatcta cactgatact ctgttgcatt attcgcctga aaccacaata 60 ttcaggcgtt ttttcgctat ctttgacaaa aaatatcaac tttctcgatt tgctctcagc 120 ccttatatca cgggaaattc cggcgatttg ctcgcatcaa tattcatgcc acatttgcca 180 tcaggggccg cctcagattc tcagtatgtt ataatagaaa aaattaatta aggcctaatt 240 atagcactta atcgaaataa atttatgagt acgtagagta taattagtat tcttctttcc 300 aacttcctta tacttatata cttatagatt ctaaaatcat gaaacggatt ctttgcggat 360 cc 362 <210> 93 <211> 278 <212> DNA <213> Artificial Sequence <220> <223> Promoter / RNA Thermometer Combo 17 <400> 93 ggcgccctgg cacaggaacg ttatccggac gttcagttcc accagacccg cgagcattaa 60 ttcttgcctc cagggcgcgg tagtcgcgcc ctgtcaattt cccttcctta ttagccgctt 120 acggaatgtt cttaaaacat tcacttttgc ttatgttttc gctcatatcc cgagcggttt 180 caaaattgtg atctatattt aacaaattaa ttaaacagca attttgcgtt atctgttaat 240 cgagactgaa atacatgaaa aaaaccacat taggatcc 278 <210> 94 <211> 454 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 18 <400> 94 ggcgccctgg cacaggaacg ttatccggac gttcagttcc accagacccg cgagcattaa 60 ttcttgcctc cagggcgcgg tagtcgcgcc ctgtcaattt cccttcctta ttagccgctt 120 acggaatgtt cttaaaacat tcacttttgc ttatgttttc gctcatatcc cgagcggttt 180 caaaattgtg atctatattt aacaaattaa ttaaacggtt tgacgtacag accattaaag 240 cagtgtagta aggcaagtcc cttcaagagt tatcgttgat acccctcgta gtgcacattc 300 ctttaacgct tcaaaatctg taaagcacgc catatcgccg aaaggcacac ttaattatta 360 aaggtaatac actatgtccg gtaaaatgac tggtatcgta aaatggttca acgctgacaa 420 aggcttcggc ttcatcactc ctgacgatgg atcc 454 <210> 95 <211> 278 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 19 <400> 95 ggcgccctgg cacaggaacg ttatccggac gttcagttcc accagacccg cgagcattaa 60 ttcttgcctc cagggcgcgg tagtcgcgcc ctgtcaattt cccttcctta ttagccgctt 120 acggaatgtt cttaaaacat tcacttttgc ttatgttttc gctcatatcc cgagcggttt 180 caaaattgtg atctatattt aacaaattaa ttaaacagca attttgcgtt acctgttaat 240 cgagattgaa acacatgaaa aaaaccacat taggatcc 278 <210> 96 <211> 282 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA thermometer combination 20 <400> 96 ggcgccctgg cacaggaacg ttatccggac gttcagttcc accagacccg cgagcattaa 60 ttcttgcctc cagggcgcgg tagtcgcgcc ctgtcaattt cccttcctta ttagccgctt 120 acggaatgtt cttaaaacat tcacttttgc ttatgttttc gctcatatcc cgagcggttt 180 caaaattgtg atctatattt aacaaattaa ttaaattcaa gggtaatcaa ttccttccac 240 acatcaggag ttaacattat gtctctcatt ctttacggat cc 282 <210> 97 <211> 309 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 21 <400> 97 ggcgccctgg cacaggaacg ttatccggac gttcagttcc accagacccg cgagcattaa 60 ttcttgcctc cagggcgcgg tagtcgcgcc ctgtcaattt cccttcctta ttagccgctt 120 acggaatgtt cttaaaacat tcacttttgc ttatgttttc gctcatatcc cgagcggttt 180 caaaattgtg atctatattt aacaaattaa ttaaggccac tttagtctgt ggttatactgta 240 ttaggtattg ttataacaat ctggatggtt tttatgaata agacattact ggtctcttct 300 ttaggatcc 309 <210> 98 <211> 356 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 22 <400> 98 ggcgccctgg cacaggaacg ttatccggac gttcagttcc accagacccg cgagcattaa 60 ttcttgcctc cagggcgcgg tagtcgcgcc ctgtcaattt cccttcctta ttagccgctt 120 acggaatgtt cttaaaacat tcacttttgc ttatgttttc gctcatatcc cgagcggttt 180 caaaattgtg atctatattt aacaaattaa ttaatgtaaa aaacatcatt tagcgtgact 240 ttctttcaac agctaacaat tgttgttatgcctaatgtt tttagggtat tttaaaaaag 300 ggcgataaaa aacgattggg ggatgagaca tgaacgctca agcagaagaa ggatcc 356 <210> 99 <211> 339 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 23 <400> 99 ggcgccaaaa aatattcagt tacaggaaag gtcagggcag ggattctaca gagttctgga 60 taaaatttgt atcgcaatct cattcgctgc cggaggcgaa ggaaatgtaa attttgttaa 120 ttcggcgtga agaattgatc ctggacagca ttttgctcaa aaaatagcca tactatttaa 180 ttgcaacaat taattaatgt aaaaaacatc atttagcgtg actttctttc aacagctaac 240 aattgttgtt actgcctaat gtttttaggg tattttaaaa aagggcgata aaaaacgatt 300 gggggatgag acatgaacgc tcaagcagaa gaaggatcc 339 <210> 100 <211> 332 <212> DNA <213> Artificial sequence <220> <223> Promoter / RNA Thermometer Combination 24 <400> 100 ggcgccctgg cacaggaacg ttatccggac gttcagttcc accagacccg cgagcattaa 60 ttcttgcctc cagggcgcgg tagtcgcgcc ctgtcaattt cccttcctta ttagccgctt 120 acggaatgtt cttaaaacat tcacttttgc ttatgttttc gctcatatcc cgagcggttt 180 caaaattgtg atctatattt aacaaattaa ttaatgtgtt ttttgtaagt tctattaaat 240 acatcagttt acagcaatga attcaccatt gtgcatcgtc aataaaagga gtgtttatga 300 aaaatcaatg gcaacatcaa tattttggat cc 332 <210> 101 <211> 3714 <212> DNA <213> Artificial Sequence <220> <223> pXH Plasmid 1 <400> 101 gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 60 ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 120 cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 180 ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 240 <h2 style=";text-align:left;direction:ltr">taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 300<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 360<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 420<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 480<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac 540<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc 600<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 660<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 720<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa accggtgagg 780<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ctatcccgtt ggcggttaat cacccacagc gtgaccagct tgcgctttat tggccagatt 840<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ccaggcgaga aacctgacgt gcgagttgca tcaggctatc cgccaaagct ctcggagagg 900<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cagtctgggt gttcggagcc agcgtggttt tgcgcttaac gagagatacc ggaagtagtt 960<h2 style=";text-align:left;direction:ltr"> ggttaccctt caccgcctga ccttgcgaca gttgcagcaa acgatccacg ctcgtttgac 1020 ccagcaaacg aaaatcctgc ttaatggtgg tcaaaggcgg gatgtaacag ctggagtctt 1080 cggtgtcatc ataacccacg acgctgatgt ctgcaccaac acgcaggccg gattcggtaa 1140 tcgcacgcat cgcgcccagc gccatctgat cattcgccac aagcatagcg gtcggaacaa 1200 taccttcgtt cagcatctgc atggtctgct gaaaaccgct cattgctgac caatcgccct 1260 cgcgctcggc aatcggctga atttgattac gcgtcaggta tttatgccaa cccgccagac 1320 gcaggcgagc cgacacgctg ctcagcggac cggcgagcag ggcgatttgc tgatgaccca 1380 gcgcaaccag gtgctccacg cctaatctgg tgccgtcctc gtgggagaag atgatggagt 1440 taatcggagt ttgatcgcta acgtccagga acaatgccgg cacgttggtg cacgcagcct 1500 ccacggcgat tgcgtcctgg tcgtccagcg ggtaattaat aatcaggcct gaaacacgtt 1560 gcgccaacag gttgtgcaca gccgccttgc aggcctcgac accgctgcgt tcaaccatgc 1620 tgacgaccac gctagcaccc aactggtctg cacggctctt gatcgcggcc acgatctgag 1680 acggtgcatg taaggccaag ctgctggtag cgacgccgat cagcaggctc tgtttgccgg 1740 ccagttgttg cgctacacgg ttcgggatgt agttcagttc cgccatcgcc gcctcaactt 1800 tttcacgggt ttcgcgctc acgtggctcg cttgattcac aacgcggggaa actgtctgat 1860 aactaacgcc cgcatactca gcaacatcat atagtgttac gggtttcata ttcaccacccc 1920 tgaattgact ctcttccggg cgctatcatg cataccgcg aaaggttttg caccattcga 1980 tggtgtccgg gatgagttcc gcaagtgtgc tattcaatgt ttcaccgtag gcgctcactc 2040 ccgatatctt gttattcctc gcagccgcgt taattaccac gacgctatcc ggcttgcttt 2100 agaagaactc gtccagcatc aggtgaaatt gcagtttgtt catgtccggg ttgtcgatac 2160 catacttctg aaataagcgc ttctgcaagg atgggctgaa ctcacccagg caattccata 2220 ggatcgccag atcctgataa cgatcggcga tgcctacacg gcccacgtca atgcagccga 2280 tcagcttacc ctcatcgaag atgaggttat ccagggaaaa atccccatgt gtgaccacgc 2340 tgtccggcga aaacgggagc agtttatgca tttctttcca cacttgttca accggccagc 2400 cattgcgctc gtcgtcgaag tccgatgcat caaccaggcc gttgttcata cggctttgcg 2460 cttgcgccaa gcggaaaacg cgatcggagt tgaacgggca gttgcacacc ggaatgctat 2520 gtaaacgacg caggaacaca gccagggcat caacaatgtt ctcaccgctg tccgggtatt 2580 cttccagaac ctgaaacgcg gtcttacccg ggatcgcggt ggtcaacagc cacgcatcgt 2640 ccggagtgcg gataaagtgt ttaatcgtcg gcagaggcat gaactcggtc aaccagttca 2700 aacgaaccat ctcatccgtg acatcattag cgacagaacc tttaccgtgc ttaagaaaca 2760 gttccggagc gtctggcttg ccgtacagac gataaatggt tgcgccagac tgacccacgt 2820 tatctcttgc ccatttgtag ccgtacaggt ccgcgtccat attgctgttc aaacgcggac 2880 ggctacatga tgtttccctt tgtatgtgac tcataacacc ccttgtatta ctgtttatgt 2940 aagcagacag ttttattgtt catgatgata tatttttatc ttgtgcaatg taacatcaga 3000 gattttgaga cacgggatcg cacaagttca ctagctgaat ccatccgtcc gcctcatcca 3060 gattgaggcg ccggctgggc tggctggcgc ggcttgtcct tgtaatacga ctcactatag 3120 gggaattgtg agcggataac aattcccctt aattaagtat attagttaag tataagaagg 3180 agatatacat atgggaagtt cacatcacca tcaccaccac ggcagcggtg gatccgagaa 3240 cttgtatttt caaggctcca acgccctcga gtatctgcag agcggccgca tccaattgta 3300 atcctcaatg gctcggtacc aaattttcga aaaaagacgc tgaaaagcgt cttttttcgt 3360 tttggtccac tagtcgatgc gttcggcgga tttctccccg gtgctaatac gactcactat 3420 aggggaattg tgagcggata acaattcccc tgtagaaata attttgttta actttaagaa 3480 ggagatatac catggagatc taatgtcgac atcgagctca tcaagcttat cgttgaattc 3540 gtcgcgcttc ccaggcatca aataaaacga aaggctcagt cgaaagactg ggcctttcgt 3600 tttatctgtt gtttgtcggt gaacgctctc tactagagtc acactggctc accttcgggt 3660 gggcctttct gcgtttatag cggatgttag ctaacgtcgt gtttaaggcg cgcc 3714 <210> 102 <211> 3547 <212> DNA <213> Artificial Sequence <220> <223> pXH Plasmid 2 <400> 102 gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 60 ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 120 cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 180 ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 240 taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 300 ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 360 ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 420 aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 480 tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac 540 agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc 600 ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 660 tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 720 tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa accggtgagg 780 ctatcccgtt ggcggttaat cacccacagc gtgaccagct tgcgctttat tggccagatt 840 ccaggcgaga aacctgacgt gcgagttgca tcaggctatc cgccaaagct ctcggagagg 900 cagtctgggt gttcggagcc agcgtggttt tgcgcttaac gagagatacc ggaagtagtt 960 ggttaccctt caccgcctga ccttgcgaca gttgcagcaa acgatccacg ctcgtttgac 1020 ccagcaaacg aaaatcctgc ttaatggtgg tcaaaggcgg gatgtaacag ctggagtctt 1080 cggtgtcatc ataacccacg acgctgatgt ctgcaccaac acgcaggccg gattcggtaa 1140 tcgcacgcat cgcgcccagc gccatctgat cattcgccac aagcatagcg gtcggaacaa 1200 taccttcgtt cagcatctgc atggtctgct gaaaaccgct cattgctgac caatcgccct 1260 cgcgctcggc aatcggctga atttgattac gcgtcaggta tttatgccaa cccgccagac 1320 gcaggcgagc cgacacgctg ctcagcggac cggcgagcag ggcgatttgc tgatgaccca 1380 gcgcaaccag gtgctccacg cctaatctgg tgccgtcctc gtgggagaag atgatggagt 1440 taatcggagt ttgatcgcta acgtccagga acaatgccgg cacgttggtg cacgcagcct 1500 ccacggcgat tgcgtcctgg tcgtccagcg ggtaattaat aatcaggcct gaaacacgtt 1560 gcgccaacag gttgtgcaca gccgccttgc aggcctcgac accgctgcgt tcaaccatgc 1620 tgacgaccac gctagcaccc aactggtctg cacggctctt gatcgcggcc acgatctgag 1680 acggtgcatg taaggccaag ctgctggtag cgacgccgat cagcaggctc tgtttgccgg 1740 ccagttgttg cgctacacgg ttcgggatgt agttcagttc cgccatcgcc gcctcaactt 1800 tttcacgggt tttcgcgctc acgtggctcg cttgattcac aacgcgggaa actgtctgat 1860 aactaacgcc cgcatactca gcaacatcat atagtgttac gggtttcata ttcaccaccc 1920 tgaattgact ctcttccggg cgctatcatg ccataccgcg aaaggttttg caccattcga 1980 tggtgtccgg gatgagttcc gcaagtgtgc tattcaatgt ttcaccgtag gcgctcactc 2040 ccgatatctt gttattcctc gcagccgcgt taattaccac gacgctatcc ggcttgcttt 2100 atgcaccgcc ctgccactcg tcgcagtatt gttgcaattc attcagcata cgaccaacat 2160 ggaagccgtc gcacacagcg tggtgaacct gaatcgccag cggcatcaac accttgtcgc 2220 cctgggtgta gtatttaccc attgtaaata ccggagcgaa aaaattatcc atattggcca 2280 cgttcaggtc gaagctggtg aacgaaaccc acgggttcgc agaaacaaaa aacatgtttt 2340 cgatgaaacc ttttgggaaa tacgccaggt tctcaccata gcaggcaaca tcttggctgt 2400 agatgtgcaa aaactggcga aagtcatcat gatactcgga ccacaggcta gagaaggttt 2460 ccgtttgttc gtggaacacg gtgtaacacg ggtgcacgga atcccaaata actaactcgc 2520 cgtctttcat agccatgcgg aactccggat gcgcgttcat cagacgcgcc agaatatgga 2580 tgaatgccgg atagaacttg tgcttgttct ttttgacggt cttgagaaat gcggtaatat 2640 ccagctgcac agtctgattg tacgtacact gcgcgacgct ttggaacgcc tcaaaatgtt 2700 ctttacggtg ccattggctg atgtccactg tagtatatcc cgttatcttt ttttccattt 2760 tagcttcctt agctcctgaa aatctcgata actcaaaaaa tacgcccggt agtgatctta 2820 tttcattatg gtgaaagttg gaacctctta tcgcacaagt tcactagctg aatccatccg 2880 tccgcctcat ccagattgag gcgccggctg ggctggctgg cgcggctgt ccttgtatata 2940 cgactcacta taggtt gtgagcggatt aacaatccc cttaattag tattagtt 3000 aagtataaga aggagatata catatgggaa gttcacatca ccatcaccac cacggcagcg 3060 gtggatccga gaacttgtat ttcaggct cagagccct cgagtatctg cagagcggcc 3120 gcatccaatt gtaatcctca atggctcggt accaaattt cgaaaaaga cgctgaaaag 3180 cgtcttttt cgttttggtc cactagtcga tgcgttcggc ggatttctcc ccggtgctaa 3240 tacgactcac tatagggaa ttgtgagcgg atacaatc ccctgtagaa atattttgt 3300 ttaactttaa gaaggagata taccatggag atctaatgtc gatcgagc tcatcaagct 3360 tatcgttgaa ttcgtcgcgc ttcccaggca tcaataaaa cgaaaggctc agtcgaaaga 3420 ctgggccttt cgttttatct gttgtttgtc ggtgaacgct cttactaga gtcacactgg 3480 ctcaccttcg ggtgggcctt tctgcgttta tagctaacgt cgtgtttaag 3540 gccgcgcc 3547 <210> 103 <211> 3753 <212> DNA <213> Artificial Sequence <220> <223> pXH plasmid 3 <400> 103 gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 60 ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 120 cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 180 ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 240 taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 300 ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 360 ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 420 aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 480 tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac 540 agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc 600 ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 660 tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 720 tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa accggtgagg 780 ctatcccgtt ggcggttaat cacccacagc gtgaccagct tgcgctttat tggccagatt 840 ccaggcgaga aacctgacgt gcgagttgca tcaggctatc cgccaaagct ctcggagagg 900 cagtctgggt gttcggagcc agcgtggttt tgcgcttaac gagagatacc ggaagtagtt 960 ggttaccctt caccgcctga ccttgcgaca gttgcagcaa acgatccacg ctcgtttgac 1020 ccagcaaacg aaaatcctgc ttaatggtgg tcaaaggcgg gatgtaacag ctggagtctt 1080 cggtgtcatc ataacccacg acgctgatgt ctgcaccaac acgcaggccg gattcggtaa 1140 tcgcacgcat cgcgcccagc gccatctgat cattcgccac aagcatagcg gtcggaacaa 1200 taccttcgtt cagcatctgc atggtctgct gaaaaccgct cattgctgac caatcgccct 1260 cgcgctcggc aatcggctga atttgattac gcgtcaggta tttatgccaa cccgccagac 1320 gcaggcgagc cgacacgctg ctcagcggac cggcgagcag ggcgatttgc tgatgaccca 1380 gcgcaaccag gtgctccacg cctaatctgg tgccgtcctc gtgggagaag atgatggagt 1440 taatcggagt ttgatcgcta acgtccagga acaatgccgg cacgttggtg cacgcagcct 1500 ccacggcgat tgcgtcctgg tcgtccagcg ggtaattaat aatcaggcct gaaacacgtt 1560 gcgccaacag gttgtgcaca gccgccttgc aggcctcgac accgctgcgt tcaaccatgc 1620 tgacgaccac gctagcaccc aactggtctg cacggctctt gatcgcggcc acgatctgag 1680 acggtgcatg taaggccaag ctgctggtag cgacgccgat cagcaggctc tgtttgccgg 1740 ccagttgttg cgctacacgg ttcgggatgt agttcagttc cgccatcgcc gcctcaactt 1800 tttcacgggt tttcgcgctc acgtggctcg cttgattcac aacgcgggaa actgtctgat 1860 aactaacgcc cgcatactca gcaacatcat atagtgttac gggtttcata ttcaccaccc 1920 tgaattgact ctcttccggg cgctatcatg ccataccgcg aaaggttttg caccattcga 1980 tggtgtccgg gatgagttcc gcaagtgtgc tattcaatgt ttcaccgtag gcgctcactc 2040 ccgatatctt gttattcctc gcagccgcgt taattaccac gacgctatcc ggcttgcttt 2100 agaagaactc gtccagcatc aggtgaaatt gcagtttgtt catgtccggg ttgtcgatac 2160 catacttctg aaataagcgc ttctgcaagg atgggctgaa ctcacccagg caattccata 2220 ggatcgccag atcctgataa cgatcggcga tgcctacacg gcccacgtca atgcagccga 2280 tcagcttacc ctcatcgaag atgaggttat ccagggaaaa atccccatgt gtgaccacgc 2340 tgtccggcga aaacgggagc agtttatgca tttctttcca cacttgttca accggccagc 2400 cattgcgctc gtcgtcgaag tccgatgcat caaccaggcc gttgttcata cggctttgcg 2460 cttgcgccaa gcggaaaacg cgatcggagt tgaacgggca gttgcacacc ggaatgctat 2520 gtaaacgacg caggaacaca gccagggcat caacaatgtt ctcaccgctg tccgggtatt 2580 cttccagaac ctgaaacgcg gtcttacccg ggatcgcggt ggtcaacagc cacgcatcgt 2640 ccggagtgcg gataaagtgt ttaatcgtcg gcagaggcat gaactcggtc aaccagttca 2700 aacgaaccat ctcatccgtg acatcattag cgacagaacc tttaccgtgc ttaagaaaca 2760 gttccggagc gtctggcttg ccgtacagac gataaatggt tgcgccagac tgacccacgt 2820 tatctcttgc ccatttgtag ccgtacaggt ccgcgtccat attgctgttc aaacgcggac 2880 ggctacatga tgtttccctt tgtatgtgac tcataacacc ccttgtatta ctgtttatgt 2940 aagcagacag ttttattgtt catgatgata tatttttatc ttgtgcaatg taacatcaga 3000 gattttgaga cacgggatcg cacaagttca ctagctgaat ccatccgtcc gcctcatcca 3060 gattgaggcg ccaaattttc gaaaaaagac gctgaaaagc gtcttttttc gttttggtcc 3120 cgatgcgttc ggcggatttc tccccggtgc taatacgact cactataggg gaattgtgag 3180 cggataacaa ttcccctgta gaaataattt tgtttaactt taagaaggag atatacatat 3240 gggaagttca catcaccatc accaccacgg cagcggtgga tccgagaact tgtattttca 3300 aggctccaac gccctcgagt atctgcagag cggccgcatc caattgtaat cctcaatggc 3360 caggcatcaa ataaaacgaa aggctcagtc gaaagactgg gcctttcgtt ttatctgttg 3420 tttgtcggtg aacgctctct actagagtca cactggctca ccttcgggtg ggcctttctg 3480 cgtttataac tagtggctgg gctggctggc gcggcttgtc cttgtaatac gactcactat 3540 aggggaattg tgagcggata acaattcccc tgtagaaata attttgttta actttaataa 3600 ggagatatac catggagatc taatgtcgac atcgagctca tcaagcttat cgttgaattc 3660 gtcgcgcttc ctagcataac cccttggggc ctctaaacgg gtcttgaggg gttttttggc 3720 ggatgttagc taacgtcgtg tttaaggcgc gcc 3753 <210> 104 <211> 3584 <212> DNA <213> Artificial sequence <220> <223> pXH plasmid 4 <400> 104 gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 60 ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 120 cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 180 ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 240 taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 300 ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 360 <h2 style=";text-align:left;direction:ltr">ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 420<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 480<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac 540<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc 600<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 660<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 720<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa accggtgagg 780<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ctatcccgtt ggcggttaat cacccacagc gtgaccagct tgcgctttat tggccagatt 840<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ccaggcgaga aacctgacgt gcgagttgca tcaggctatc cgccaaagct ctcggagagg 900<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cagtctgggt gttcggagcc agcgtggttt tgcgcttaac gagagatacc ggaagtagtt 960<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ggttaccctt caccgcctga ccttgcgaca gttgcagcaa acgatccacg ctcgtttgac 1020<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ccagcaaacg aaaatcctgc ttaatggtgg tcaaaggcgg gatgtaacag ctggagtctt 1080<h2 style=";text-align:left;direction:ltr"> cggtgtcatc ataacccacg acgctgatgt ctgcaccaac acgcaggccg gattcggtaa 1140 tcgcacgcat cgcgcccagc gccatctgat cattcgccac aagcatagcg gtcggaacaa 1200 taccttcgtt cagcatctgc atggtctgct gaaaaccgct cattgctgac caatcgccct 1260 cgcgctcggc aatcggctga atttgattac gcgtcaggta tttatgccaa cccgccagac 1320 gcaggcgagc cgacacgctg ctcagcggac cggcgagcag ggcgatttgc tgatgaccca 1380 gcgcaaccag gtgctccacg cctaatctgg tgccgtcctc gtgggagaag atgatggagt 1440 taatcggagt ttgatcgcta acgtccagga acaatgccgg cacgttggtg cacgcagcct 1500 ccacggcgat tgcgtcctgg tcgtccagcg ggtaattaat aatcaggcct gaaacacgtt 1560 gcgccaacag gttgtgcaca gccgccttgc aggcctcgac accgctgcgt tcaaccatgc 1620 tgacgaccac gctagcaccc aactggtctg cacggctctt gatcgcggcc acgatctgag 1680 acggtgcatg taaggccaag ctgctggtag cgacgccgat cagcaggctc tgtttgccgg 1740 ccagttgttg cgctacacgg ttcgggatgt agttcagttc cgccatcgcc gcctcaactt 1800 tttcacgggt tttcgcgctc acgtggctcg cttgattcac aacgcgggaa actgtctgat 1860 aactaacgcc cgcatactca gcaacatcat ataggtttac gggtttcata ttcaccaccc 1920 tgaattgact ctcttccggg cgctatcatg ccataccgcg aaaggttttg caccattcga 1980 tggtgtccgg gatgagttcc gcaagtgtgc tattcaatgt ttcaccgtag gcgctcactc 2040 ccgatatctt gttatcctc gcagccgcgt taattaccac gacgctatcc ggcttgcttt 2100 atgcaccgcc ctgccactcg tcgcagtatt gttgcaattc attcagcata cgaccaacat 2160 ggaagccgtc gcacacagcg tggtgaacct gaatcgccag cggcatcaac accttgtcgc 2220 cctgggtgta gtatttaccc attgtaaata ccggagcgaa aaaattatcc atattggcca 2280 cgttcaggtc gaagctggtg aacgaaaccc acgggttcgc agaaacaaaa aacatgtttt 2340 cgatgaaacc ttttgggaaa tacgccaggt tctcaccata gcaggcaaca tcttggctgt 2400 agatgtgcaa aaactggcga aagtcatcat gatactcgga ccacaggcta gagaaggttt 2460 ccgtttgttc gtggaacacg gtgtaacacg ggtgcacgga atcccaaata actaactcgc 2520 cgtctttcat agccatgcgg aactccggat gcgcgttcat cagacgcgcc agaatatgga tgaatgccgg atagacttg tgcttgttct ttttgacggt cttgagaaat gcggtaatat ccagctgcac agtctgattg tacgtacact gcgcgacgct ttggaacgcc tcaaaatgtt ctttacggtg ccattggctg atgtccactg tagtatatcc cgttatcttt ttttccattt tagcttcctt agctcctgaa aatctcgata actcaaaaaa tacgcccggt agtgatctta tttcattatg gtgaaagttg gaacctctta tcgcacaagt tcactagctg aatccatccg tccgcctcat ccagattggc gccaaatttt cgaaaaaga cgctgaaaag cgtctttttt cgttttggtc ccgatgcgtt cggcggattt ctccccggtg ctaatacgac tcactatagg ggaattgtga gcggataaca attcccctgt agaaataatt ttgtttaaact ttaagaagga gatatacata tgggaagttc acatcaccat caccaccacg gcagcggtgg atccgagaac ttgtattttc aaggctccaa cgccctcgag tatctgcaga gcggccgcat ccaattgtaa tcctcaatgg ccaggcatca aataaaacga aaggctcagt cgaaagactg ggcctttcgt tttatctgtt gtttgtcggt gaacgctctc tactagagtc acactggctc accttcgggt 3300 gggcctttct gcgtttataa ctagtggctg ggctggctgg cgcggcttgt ccttgtaata 3360 cgactcacta taggggaatt gtgagcggat aacaattccc ctgtagaaat aattttgttt 3420 aactttaata aggagatata ccatggagat ctaatgtcga catcgagctc atcaagctta 3480 tcgttgaatt cgtcgcgctt cctagcataa ccccttgggg cctctaaacg ggtcttgagg 3540 ggttttttgg cggatgttag ctaacgtcgt gtttaaggcg cgcc 3584 <210> 105 <211> 29 <212> RNA <213> Artificial sequence <220> <223> RNA thermometer 10 <400> 105 ggaucccucc uucagaagga gauauaccc 29 <210> 106 <211> 59 <212> RNA <213> Artificial sequence <220> <223> RNA thermometer 11 <400> 106 ggauccucuc cuucacuagu aaaaaaaaaa aaaaaaaaaa aaaaaaagga gauauaccc 59 <210> 107 <211> 29 <212> RNA <213> Artificial sequence <220> <223> RNA Thermometer 12 <400> 107 ggauccucuc cuuagaagga gauauaccc 29 <210> 108 <211> 38 <212> RNA <213> Artificial sequence <220> <223> RNA Thermometer 13 <400> 108 ggaucccucc uuacuagucu gcagaaggag auauaccc 38 <210> 109 <211> 39 <212> RNA <213> Artificial sequence <220> <223> RNA Thermometer 14 <400> 109 ggauccucuccuuacuagucugcagaaggagaauaccc 39 <210> 110 <211> 39 <212> RNA <213> Artificial sequence <220> <223> RNA Thermometer 15 <400> 110 ggaucccucc uucacuaguc ugcagaagga gauauaccc 39 <210> 111 <211> 61 <212> RNA <213> Artificial sequence <220> <223> RNA Thermometer 16 <400> 111 uaaauacauc aguuuacagc aaugaauuca ccauugugca ucgucaauaaaggaguguu 60 u 61

Claims

1. A method for producing one or more heterologous polypeptides in an Escherichia coli host cell, the method comprising: (i) providing an expression vector encoding a fusion protein, wherein the fusion protein comprises the heterologous polypeptide and a fluorescent fusion partner; (ii) transforming the E. coli host cell with the expression vector of step (i), wherein the E. coli host cell and / or the expression vector are modified to include a nucleic acid encoding a stationary phase promoter, a lytic protein and an RNA thermometer, wherein the lytic protein is an endolysin or a bacterial murein hydrolase, and the RNA thermometer consists of a nucleic acid sequence of any one of SEQ ID NOs: 19-27 or SEQ ID NOs: 105-111, further wherein the expression of the nucleic acid encoding the lytic protein is regulated by the promoter, and the translation of the lytic protein is regulated by the RNA thermometer; (iii) expressing the fusion protein in the E. coli host cell; (iv) changing the temperature of the E. coli host cell to induce translation of the lytic protein, wherein translation of the lytic protein results in lysis of the E. coli host cell; and (v) recovering the fusion protein from the E. coli host cell.

2. The method of claim 1, wherein the fusion protein comprises one or more purification tags, wherein the method further comprises a step of purifying the recovered fusion protein.

3. The method according to claim 2, wherein the purification tag is a histidine (His) tag and / or a glutathione S-transferase (GST) tag.

4. The method of claim 1, wherein the fusion protein comprises a protease cleavage site, wherein the method further comprises the step of cleaving the fluorescent fusion partner from the heterologous polypeptide after recovery.

5. The method of claim 4, wherein the protease cleavage site is selected from the group consisting of a WELQut site, a thrombin or trypsin cleavage site, a nisP or trypsin cleavage site, a TEV cleavage site, a factor Xa cleavage site, and any combination thereof, wherein the WELQut site consists of an amino acid sequence WELQ (SEQ ID NO: 1) encoded by a nucleic acid consisting of the sequence TGGGAACTGCAG (SEQ ID NO: 2), the thrombin or trypsin cleavage site consists of an amino acid sequence LVPR (SEQ ID NO: 3) encoded by a nucleic acid consisting of the sequence CTAGTACCACGC (SEQ ID NO: 4), the nisP or trypsin cleavage site consists of an amino acid sequence ASPR (SEQ ID NO: 5) encoded by a nucleic acid consisting of the sequence GCGAGCCCGCGC (SEQ ID NO: 6), the TEV cleavage site consists of an amino acid sequence ENLYFQG (SEQ ID NO: 7) encoded by a nucleic acid consisting of the sequence GAAAACTTGTATTTTCAAGGC (SEQ ID NO: 8), the factor Xa cleavage site consists of an amino acid sequence ATTGAAGGTCGT (SEQ ID NO: 9), the factor Xa cleavage site consists of an amino acid sequence ATTGAAGGTCGT (SEQ ID NO: 10), the factor Xa cleavage site consists of an amino acid sequence ATTGAAGGTCGT (SEQ ID NO: 11), the factor Xa cleavage site consists of an amino acid sequence ATTGAAGGTCGT (SEQ ID NO: 12), the factor Xa cleavage site consists of an amino acid sequence ATTGAAGGTCGT (SEQ ID NO: 13), the factor Xa cleavage site consists of an amino acid sequence ATTGAAGGTCGT (SEQ ID NO: 14), the factor Xa cleavage site consists of an amino acid sequence ATTGAAGGTCGT (SEQ ID NO: The amino acid sequence IEGR (SEQ ID NO: 9) is encoded by a nucleic acid consisting of: The method of claim 1 , wherein the fusion protein comprises a secretion signal peptide.

7. The method of claim 1, wherein the fluorescent fusion partner is selected from the group consisting of green fluorescent protein, yellow fluorescent protein, blue fluorescent protein, cyan fluorescent protein, and red fluorescent protein. 8 . The method according to claim 7 , wherein the green fluorescent protein is encoded by a nucleic acid consisting of the amino acid sequence of SEQ ID NO: 11 or the nucleotide sequence of SEQ ID NO:

12. 9 . The method according to claim 7 , wherein the red fluorescent protein is mCherry, which is encoded by a nucleic acid consisting of the amino acid sequence of SEQ ID NO: 13 or the nucleotide sequence of SEQ ID NO:

14.

10. The method of claim 1, wherein the heterologous polypeptide is selected from the group consisting of: lanthipeptides; bacteriocins; listeriolysin O and ActA.

11. The method of claim 10, wherein the lanthipeptide is nisin, epilancin 15X or Pep5.

12. The method according to claim 1, wherein the lytic protein is encoded by a nucleic acid consisting of an amino acid sequence of SEQ ID NO: 15 or SEQ ID NO: 17, or a nucleotide sequence of SEQ ID NO: 16 or SEQ ID NO:

18.

13. The method according to claim 1, wherein the promoter consists of the nucleic acid sequence of any one of SEQ ID NOs: 74-76.

14. The method according to claim 1, wherein the combination of the RNA thermometer and the promoter consists of a sequence as shown in any one of SEQ ID NOs: 77-100.

15. The method of claim 1, wherein expression of the lytic protein results in lysis of the E. coli host cells upon subsequent freezing and thawing of the cells and resuspension in a lysis buffer.

16. An E. coli cell, wherein the cell comprises: (i) at least one expression vector encoding a fusion protein comprising a heterologous polypeptide and a fluorescent fusion partner; and (ii) a nucleic acid encoding a stationary phase promoter operably linked to a lytic protein and an RNA thermometer, wherein the lytic protein is an endolysin or a bacterial murein hydrolase, and the RNA thermometer consists of a nucleic acid sequence of any one of SEQ ID NOs: 19-27 or SEQ ID NOs: 105-111, Wherein the RNA thermometer is capable of regulating the translation of the lytic protein.

17. The cell of claim 16, wherein the fusion protein comprises a purification tag.

18. The cell of claim 17, wherein the purification tag is a histidine (His) tag or a glutathione S-transferase (GST) tag.

19. The cell of claim 16, wherein the fusion protein comprises a protease cleavage site.

20. The cell of claim 19, wherein the protease cleavage site is selected from the group consisting of a WELQut site consisting of an amino acid sequence WELQ (SEQ ID NO: 1) encoded by a nucleic acid consisting of the sequence TGGGAACTGCAG (SEQ ID NO: 2), a thrombin or trypsin cleavage site consisting of an amino acid sequence LVPR (SEQ ID NO: 3) encoded by a nucleic acid consisting of the sequence CTAGTACCACGC (SEQ ID NO: 4), a nisP or trypsin cleavage site consisting of an amino acid sequence ASPR (SEQ ID NO: 5) encoded by a nucleic acid consisting of the sequence GCGAGCCCGCGC (SEQ ID NO: 6), a TEV cleavage site consisting of an amino acid sequence ENLYFQG (SEQ ID NO: 7) encoded by a nucleic acid consisting of the sequence GAAAACTTGTATTTTCAAGGC (SEQ ID NO: 8), a factor Xa cleavage site consisting of an amino acid sequence ATTGAAGGTCGT (SEQ ID NO: 9), a factor Xa cleavage site consisting of an amino acid sequence ATTGAAGGTCGT (SEQ ID NO: 10), a factor Xa cleavage site consisting of an amino acid sequence ATTGAAGGTCGT (SEQ ID NO: 11), a factor Xa cleavage site consisting of an amino acid sequence ATTGAAGGTCGT (SEQ ID NO: 12), a factor Xa cleavage site consisting of an amino acid sequence ATTGAAGGTCGT (SEQ ID NO: 13), a factor Xa cleavage site consisting of an amino acid sequence ATTGAAGGTCGT (SEQ ID NO: 14), a factor Xa cleavage site consisting of an amino acid sequence ATTGAAGGTCGT (SEQ ID NO: 15), a factor Xa cleavage site consisting of an amino acid sequence ATTGAAGGTCGT (SEQ ID NO: 16), a factor Xa cleavage site consisting of an amino acid sequence ATTGAAGGTCGT (SEQ ID The amino acid sequence IEGR (SEQ ID NO: 9) is encoded by a nucleic acid consisting of:

21. The cell of claim 16, wherein the fusion protein comprises a secretion signal peptide.

22. The cell of claim 16, wherein the fluorescent fusion partner is selected from the group consisting of green fluorescent protein, yellow fluorescent protein, blue fluorescent protein, cyan fluorescent protein, and red fluorescent protein.

23. The cell according to claim 22, wherein the green fluorescent protein is encoded by a nucleic acid consisting of the amino acid sequence of SEQ ID NO: 11 or consisting of the nucleotide sequence of SEQ ID NO:

12. 24 . The cell according to claim 22 , wherein the red fluorescent protein is mCherry, which is encoded by a nucleic acid consisting of the amino acid sequence of SEQ ID NO: 13 or consisting of the nucleotide sequence of SEQ ID NO:

14.

25. The cell of claim 16, wherein the heterologous polypeptide is selected from the group consisting of: lanthipeptides; bacteriocins; listeriolysin O and ActA.

26. The cell of claim 25, wherein the lanthipeptide is nisin, epilancin 15X or Pep5.

27. The cell of claim 16, wherein the lytic protein is encoded by a nucleic acid consisting of the amino acid sequence of SEQ ID NO: 15 or SEQ ID NO: 17, or consisting of the nucleotide sequence of SEQ ID NO: 16 or SEQ ID NO:

18.

28. The cell of claim 16, wherein the promoter consists of the nucleic acid sequence of any one of SEQ ID NOs: 74-76.

29. The cell of claim 16, wherein the combination of the RNA thermometer and the promoter consists of a sequence as shown in any one of SEQ ID NOs: 77-100.

30. The cell of claim 16, wherein expression of the lytic protein results in lysis of the E. coli host cells upon subsequent freezing and thawing of the cells and resuspending in lysis buffer.

31. A kit comprising: at least one expression vector for expressing a fusion protein comprising a heterologous polypeptide and a fluorescent fusion partner; and Escherichia coli cells, wherein the E. coli cell and / or the expression vector comprises a nucleic acid encoding a stationary phase promoter operably linked to a lytic protein and an RNA thermometer, wherein the lytic protein is an endolysin or a bacterial murein hydrolase, the RNA thermometer consists of a nucleic acid sequence of any one of SEQ ID NOs: 19-27 or SEQ ID NOs: 105-111, and wherein the RNA thermometer is capable of regulating the translation of the lytic protein.

Images