A strain specifically producing 2′-fucosyllactose and its application

By constructing nucleic acid molecules and expression vectors encoding SAMT proteins, combined with the transformation of E. coli, the problem of other fucosylation products in the 2′-fucosyl lactose products in microbial fermentation method is solved, and efficient and single product production is achieved, with great industrial application potential.

CN116769808BActive Publication Date: 2025-06-10JIANGNAN UNIV +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202310168797.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-27
Publication Date
2025-06-10
Estimated Expiration
2043-02-27

AI Technical Summary

Technical Problem

In the prior art, when producing 2'-fucosyl lactose by microbial fermentation, the catalytic activity of ɑ1,2-glycosyltransferase is insufficient, resulting in the presence of other fucosylated breast milk oligosaccharides in the product, affecting isolation and purification.

Method used

By constructing nucleic acid molecules and expression vectors encoding SAMT proteins, combined with the transformation of E. coli, the expression of the GDP-L-fucose pathway is strengthened, ensuring that microorganisms can efficiently convert lactose to produce 2′-fucosyl lactose, and avoid the production of other fucosylation products.

Benefits of technology

The single product 2′-fucosyl lactose was efficiently produced, with a yield of 112.56 g/L, simplifying the downstream separation and purification process and having great industrial application potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116769808B_ABST
    Figure CN116769808B_ABST
Patent Text Reader

Abstract

The present invention discloses a strain specifically producing 2′-fucosyllactose and its application, belonging to the technical field of microbial metabolic engineering. The present invention discloses a nucleic acid molecule encoding an SAMT protein, the nucleic acid molecule comprising a sequence as shown in SEQ ID NO.2 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.2. The SAMT protein encoded by this nucleic acid molecule is derived from Azospirillum lipoferum, and its amino acid sequence is as shown in SEQ ID NO.1. This protein has excellent α1,2-fucosyltransferase catalytic activity and strict substrate specificity. During the shake flask fermentation experiment, the ability of recombinant Escherichia coli BSS2 to produce 2′-fucosyllactose was 8.03 g / L, and in a 5 L fermenter, the yield of 2′-fucosyllactose reached 112.56 g / L, which is the highest yield reported so far and has the potential for industrial application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a strain specifically producing 2'-fucosyllactose and its application, belonging to the technical field of microbial metabolic engineering. Background Art

[0002] Breast milk is a beneficial nutrition customized for newborns, and its composition has evolved over thousands of years of human evolution to promote the health and development of infants. Breast milk has a remarkable feature, namely complex and abundant unbound glycans, i.e., human milk oligosaccharides (HMOs), which are minimally digested in the infant gastrointestinal tract, can reach the distal intestine directly, promote the colonization and utilization of probiotics, produce short-chain fatty acids, and provide many health benefits for the developing infant, such as cognitive development and immunomodulatory properties. 2'-Fucosyllactose (2'-FL), as the most abundant component in HMOs, has been widely confirmed in preclinical studies to have multiple benefits such as regulating the immune system, preventing necrotizing enterocolitis, promoting brain development, enhancing probiotic colonization, and improving intestinal health. In an observational study, introducing 2'-fucosyllactose into infant formula containing the probiotic Bifidobacterium lactis Bb12 or Lactobacillus reuteri DSM 17938 showed satisfactory gastrointestinal tolerance in developing infants. In addition, it was observed that there was no difference in circulating cytokine concentrations between infant formula containing 2'-fucosyllactose and breastfed infants, indicating good safety. Therefore, 2'-fucosyllactose not only has an irreplaceable physiological role but also has broad commercial application value. So far, 2'-fucosyllactose has been recognized by the US Food and Drug Administration (FDA) and the European Union and approved as an effective ingredient in commercial infant formula.

[0003] Currently, 2'-fucosyllactose can be produced by chemical method, enzymatic catalysis method, and microbial fermentation method. The chemical synthesis of 2'-fucosyllactose involves complex production conditions and strict and cumbersome steps, and the raw material cost is relatively high; although the enzymatic synthesis is mild and controllable and can obtain the target product relatively quickly, due to the high price of the synthetic precursor substances, the production cost is relatively high. In contrast, the microbial fermentation method can achieve large-scale production by directly adding the substrate lactose to the culture medium, with simple steps and high yields, which is suitable for industrial application.

[0004] In the production process of 2′-fucosyllactose, α1,2-glycosyltransferase plays a decisive role, but this depends on the catalytic activity of the enzyme. At present, among the numerous reported heterologous genes encoding α1,2-glycosyltransferase, in the production process of de novo synthesis of 2′-fucosyllactose, although microbial fermentation can achieve high-titer synthesis of 2′-fucosyllactose, other fucosylated human milk oligosaccharides, such as 3-fucosyllactose (3-FL) and difucosyllactose (DFL), are found in the products, which brings certain difficulties to the separation and purification in the later production stage. Summary of the Invention

[0005] Aiming at the problems of the currently reported α1,2-glycosyltransferase and the presence of other fucosylated human milk oligosaccharides in microbial fermentation products, the present invention provides a nucleic acid molecule, an expression vector and a microorganism for preparing human milk oligosaccharides, which can efficiently convert lactose to produce 2′-fucosyllactose and there is no production of other fucosylated human milk oligosaccharides, facilitating the downstream separation and purification work.

[0006] The first object of the present invention is to provide a nucleic acid molecule encoding a SAMT protein, and the nucleic acid molecule comprises a nucleotide sequence as shown in SEQ ID NO.2 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.2.

[0007] Preferably, the nucleic acid molecule comprises a nucleotide sequence having at least 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity with SEQ ID NO.2.

[0008] More preferably, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO.2.

[0009] Preferably, the amino acid sequence of the SAMT protein comprises a sequence as shown in SEQ ID NO.1 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.1.

[0010] More preferably, the amino acid sequence of the SAMT protein is as shown in SEQ ID NO.1, which is an α-1,2-glycosyltransferase derived from Azospirillum lipoferum, and the GeneBank number is SMH41196.1.

[0011] The second object of the present invention is to provide a transformant and an expression vector containing the above nucleic acid molecule.

[0012] Preferably, the expression vector is a pET expression vector and / or a pRSF expression vector.

[0013] In a preferred embodiment, the pET expression vector is pET-AB-SAMT, and the construction method of pET-AB-SAMT is as follows: Using plasmid pET-ABW as a template, replacing the wbgL gene in pET-ABW with the target fragment SAMT (sequence as SEQ ID NO.2), and finally obtaining the expression vector pET-AB-SAMT.

[0014] The plasmid pET-ABW is described in the Chinese patent document with the publication number CN114874964A, "Construction Method and Application of a Recombinant Escherichia coli with High Yield of 2'-Fucosyllactose".

[0015] The third object of the present invention is to provide a microorganism, which contains the above nucleic acid molecule and / or the above expression vector.

[0016] Preferably, the microorganism contains the above nucleic acid molecule and the above expression vector.

[0017] Furthermore, the microorganism is one or more of Corynebacterium glutamicum, Bacillus subtilis, and Escherichia coli; preferably, the microorganism is Escherichia coli.

[0018] In one embodiment, based on the strategy of enhancing the metabolic flux of the GDP-L-fucose pathway in Escherichia coli BL21(DE3), the competitive branches in the de novo synthesis process of 2′-fucosyllactose are deleted, namely, the β-galactosidase (lacZ) that degrades lactose and the UDP-glucose lipid carrier transferase (wcaJ) that synthesizes cell wall capsular acid, to avoid the use of the precursor substances GDP-L-fucose and lactose for the growth and metabolism of the cells themselves. In the metabolic pathway of the GDP-L-fucose pathway, the expression of key gene elements such as mannose 1-guanylyltransferase (manC), phosphomannomutase (manB), GDP-D-mannose-4,6-dehydratase (gmd), and GDP-fucose synthase (wcaG) is particularly important for the accumulation of the key donor GDP-L-fucose and the final production capacity of 2′-fucosyllactose. Therefore, in the de novo synthesis pathway, the key genes of the GDP-L-fucose pathway are selectively strengthened to enhance the accumulation of the GDP-L-fucose pool in the engineered bacteria ( Figure 1 ).

[0019] In a preferred embodiment, the recombinant Escherichia coli has knocked out the β-galactosidase-encoding gene lacZ and the UDP-glucose lipid carrier transferase-encoding gene wcaJ in the genome, and freely expresses the α1,2-glycosyltransferase-encoding gene derived from Azospirillum lipoferum, and freely expresses the key genes of the GDP-L-fucose pathway to enhance the accumulation and conversion of the donor GDP-L-fucose in the host.

[0020] In a preferred embodiment, the recombinant Escherichia coli integrally expresses the constitutive promoter P J23119 Enhanced α1,2-glycosyltransferase-encoding gene derived from Azospirillum lipoferum.

[0021] In a preferred embodiment, the constitutive promoter P is integrally expressed at the recA locus J23119 Enhanced α1,2-glycosyltransferase-encoding gene derived from Azospirillum lipoferum.

[0022] In a preferred embodiment, the key genes of the GDP-L-fucose pathway include the phosphomannomutase-encoding gene manB, the mannose-1-guanylyltransferase-encoding gene manC, the GDP-D-mannose-4,6-dehydratase-encoding gene gmd, and the GDP-fucose synthase-encoding gene wcaG.

[0023] In a preferred embodiment, the strong promoter P J23119 Is used to replace the promoter before the manC-manB gene cluster on the genome.

[0024] In a preferred embodiment, manB, manC, gmd, and wcaG are expressed using the pRSFDuet-1 vector.

[0025] In a preferred embodiment, using pETDuet-1 as the expression vector, the codon-optimized α1,2-glycosyltransferase-encoding gene SAMT derived from Azospirillum lipoferum is cloned into the multiple cloning site second position (MCS2) of the plasmid, and rcsA and rcsB are introduced into the multiple cloning site first position (MCS1) of the plasmid to indirectly enhance the expression of the key genes in the GDP-L-foucose pathway.

[0026] In a preferred embodiment, the amino acid sequence of the SAMT is as shown in SEQ ID NO.1.

[0027] In a preferred embodiment, the specific sequence of the optimized α1,2-glycosyltransferase gene SAMT derived from Azospirillum lipoferum is as shown in SEQ ID NO.2

[0028] In a preferred embodiment, the specific sequence of manC is as shown in SEQ ID NO.4, the nucleotide sequences of manB are as shown in SEQ ID NO.5, the nucleotide sequences of gmd are as shown in SEQ ID NO.6, and the nucleotide sequences of wcaG are as shown in SEQ ID NO.7.

[0029] In a preferred embodiment, the strong promoter P J23119 has a specific sequence as shown in SEQ ID NO.8.

[0030] In a preferred embodiment, the nucleotide sequences of rcsA and rcsB are as shown in SEQ ID NO.9 and SEQ ID NO.10 respectively.

[0031] In a preferred embodiment, the NCBI accession number of the β-galactosidase is NP_414878.1, and the NCBI accession number of the UDP-glucose lipid carrier transferase WcaJ is NP_416551.1.

[0032] In a preferred embodiment, the Escherichia coli includes but is not limited to Escherichia coli BL21(DE3).

[0033] The fourth object of the present invention is to provide a whole-cell catalyst, which includes the above-mentioned microorganism.

[0034] The fifth object of the present invention is to provide the use of the above nucleic acid molecule, or the above expression vector, or the above microorganism, or the above whole-cell catalyst in the preparation of human milk oligosaccharides; preferably, the human milk oligosaccharides are 2'-fucosyllactose and / or 3'-fucosyllactose; more preferably, the human milk oligosaccharides are 2'-fucosyllactose.

[0035] The sixth object of the present invention is to provide a method for producing 2′-fucosyllactose, which uses the above microorganism or the above whole-cell catalyst to produce human milk oligosaccharides.

[0036] Preferably, the human milk oligosaccharides are 2'-fucosyllactose and / or 3'-fucosyllactose.

[0037] More preferably, the human milk oligosaccharides are 2'-fucosyllactose.

[0038] In one embodiment, glycerol is used as the carbon source, lactose as the substrate, and IPTG as the inducer.

[0039] In one embodiment, the seed culture of the recombinant Escherichia coli is added to a batch fermentation system containing 20 g / L glycerol, and cultured at 37 °C and 220 rpm until the OD 600 reaches 0.6 - 0.8. Then, IPTG with a final concentration of 0.1 - 0.5 mM is added, and at the same time, lactose with a final concentration of 5 - 10 g / L is added. The induction culture is continued at 25 °C and 180 - 220 rpm for at least 72 h.

[0040] In one embodiment, the seed culture of the recombinant Escherichia coli is inoculated into a 5 L fermenter system (with a glycerol concentration of 30 g / L). When the fermentation temperature of the fermentation system is 37 °C, the stirring speed is 300 - 600 r / min, the aeration rate is 2.2 vvm, and the pH is 6.6 ± 0.05, and the OD 600 reaches 15 - 20, lactose with a final concentration of 5 g / L and IPTG with a final concentration of 0.1 - 0.5 mM are added, and the induction culture is carried out at 25 °C for at least 100 h.

[0041] In one embodiment, lactose and glycerol should be intermittently supplemented during the fermentation process to maintain the concentrations of lactose and glycerol at 5 g / L to maintain a stable cell production rate.

[0042] In one embodiment, the fermentation system also contains 13.5 g / L potassium dihydrogen phosphate, 4.0 g / L diammonium hydrogen phosphate, 1.7 g / L citric acid, 1.4 g / L magnesium sulfate heptahydrate, and 10 ml / L trace metal elements; the trace metal elements include: 10 g / L ferrous sulfate, 2.25 g / L zinc sulfate heptahydrate, 1.0 g / L anhydrous copper sulfate, 0.35 g / L manganese sulfate monohydrate, 0.23 g / L sodium borate decahydrate, 0.11 g / L ammonium molybdate, 2.0 g / L calcium chloride dihydrate.

[0043] The seventh object of the present invention is to provide a human milk oligosaccharide prepared by the above method; preferably, the human milk oligosaccharide is 2'-fucosyllactose and / or 3'-fucosyllactose; more preferably, the human milk oligosaccharide is 2'-fucosyllactose.

[0044] The eighth object of the present invention is to provide a composition, which includes the above human milk oligosaccharide; preferably, the human milk oligosaccharide is 2'-fucosyllactose and / or 3-fucosyllactose; more preferably, the human milk oligosaccharide is 2'-fucosyllactose.

[0045] The ninth object of the present invention is to provide the use of the above-mentioned human milk oligosaccharides or the above-mentioned composition in the preparation of drugs, foods or cosmetics containing human milk oligosaccharides; preferably, the human milk oligosaccharide is 2'-fucosyllactose and / or 3-fucosyllactose; more preferably, the human milk oligosaccharide is 2'-fucosyllactose.

[0046] Beneficial effects:

[0047] In the present invention, Escherichia coli BL21(DE3) is used as the starting strain, and a recombinant Escherichia coli specifically highly producing 2'-fucosyllactose is constructed by using the newly screened gene SAMT specifically encoding α1,2-glycosyltransferase of the present invention. In the present invention, the SAMT is integrated into the recA locus of Escherichia coli through the pEcCpf1 / pcrEG gene editing system (derived from the CRISPR-Cpf1 system), and through a series of modifications, a strain specifically highly producing 2'-fucosyllactose is obtained, and 112.56 g / L of 2'-fucosyllactose can be efficiently produced in a 5 L fermenter, and the product is single without the formation of other fucosylated products, which is the highest reported yield at present and has great potential for industrial application. Description of the drawings

[0048] Figure 1 It is a metabolic pathway diagram of 2'-fucosyllactose;

[0049] Figure 2 It is the result of gene sequence alignment of α1,2-glycosyltransferase SAMT derived from Azospirillum lipoferum and other α1,2-glycosyltransferases;

[0050] Figure 3 It is the LC-MS spectrum result of the engineered bacteria;

[0051] Figure 4 It is the ion chromatography result of the engineered bacteria BSS2 and BWW2. Detailed implementation manners

[0052] Description of the fermentation medium for 2'-fucosyllactose:

[0053] LB liquid medium (seed medium): peptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L).

[0054] Glycerol quantitative medium (fermentation medium): 20 g / L glycerol (shake flask fermentation) or 30 g / L glycerol (fermenter fermentation), 13.5 g / L potassium dihydrogen phosphate, 4.0 g / L diammonium hydrogen phosphate, 1.7 g / L citric acid, 1.4 g / L magnesium sulfate heptahydrate, 10 ml / L 10 g / L ferrous sulfate, 2.25 g / L zinc sulfate heptahydrate, 1.0 g / L copper sulfate anhydrous, 0.35 g / L manganese sulfate monohydrate, 0.23 g / L sodium borate decahydrate, 0.11 g / L ammonium molybdate, 2.0 g / L calcium chloride dihydrate.

[0055] Strain shake flask fermentation: Pick a single colony and inoculate it into 4 mL of liquid LB medium containing 1‰ ampicillin and kanamycin antibiotics, place it on a shaker at 37 °C overnight, pipette 2 mL of the culture solution and inoculate it into 100 mL of glycerol quantitative medium containing 1‰ ampicillin and kanamycin antibiotics, and shake culture it in a shaker at 37 °C until the OD 600 is between 0.6 and 0.8, then add 0.1 - 0.5 mM IPTG for induced recombinant expression, and inject 5 g / L or 8 g / L lactose as a substrate to generate 2′-fucosyllactose. Change the culture temperature to 25 °C, continue to culture for 72 h, then take the fermentation broth for HPLC detection of the production of 2′-fucosyllactose.

[0056] Detection of 2′-fucosyllactose (HPLC):

[0057] Detector: Differential refractometer; Mobile phase: 0.5 mmol / L, H 2 SO 4 ; Flow rate: 0.6 mL / min; Chromatographic column: Carbohydrate Analysis (Rezex ROA-organic acid H+(8%)); Column temperature: 60 °C; Injection volume: 10 μL;

[0058] Ion chromatography detection parameters:

[0059] Use a CarboPac PA10 chromatographic column (4 mm × 250 mm) to determine the concentrations of 2′-fucosyllactose, lactose, 3-fucosyllactose and difucosyllactose. Gradient elution uses three solutions: Eluent A: ultrapure water; Eluent B: 1 M sodium acetate; Eluent C: 250 mM NaOH; linear gradient elution at a flow rate of 1.0 mL / min;

[0060] Mass spectrometry detection parameters:

[0061] Mass spectrometry analysis was performed using a MALDI SYNAPT Q-TOF mass spectrometer (Waters, Milford, MA, USA). Capillary: 3.5 kV; cone, 20 V; source block temperature, 100 °C; desolvation temperature, 400 °C; desolvation gas flow rate: 700 L / h; cone gas flow rate: 50 L / h; collision energy: 6 eV; mass range (m / z): 50 - 1000; detector voltage: 2000 V.

[0062] Example 1

[0063] The original nucleotide sequence of SAMT (SAMT1) is shown in SEQ ID NO.3. The above sequence was codon-optimized, and the optimized nucleotide sequence of SAMT obtained is shown in SEQ ID NO.2 ( Figure 2 ).

[0064] Using plasmids pET-W and pET-ABW as templates, SAMT1 and SAMT were cloned into the above vector at the second position to replace the wbgL gene fragment with the SAMT1 and SAMT gene fragments respectively, and the recombinant plasmids pET-SAMT1 and pET-AB-SAMT were constructed, both of which were completed by Suzhou Genewiz Biotechnology Co., Ltd. Using the pET-AB-SAMT plasmid as a template and HP-Pet-SA-F1 / R1 as primers for amplification loop P, the DNA fragment was recovered by gel, and pET-SAMT was obtained.

[0065] HP-Pet-SA-F1: CCATGGAATTCGAGCTCGGCGCGCCTGCAGGTCGACAAGCTTGC

[0066] HP-Pet-SA-R1: CAGGCGCGCCGAGCTCGAATTCCATGGTATATCTCCTTCTTAAAG

[0067] Plasmids pET-ABW and pET-W are disclosed in the patent document with the publication number CN114874964A.

[0068] Plasmid pRSF-CBGW is disclosed in the patent document with the publication number CN112342176A.

[0069] Example 2

[0070] Knock out the gene wcaJ encoding UDP-glucose lipid carrier transferase WcaJ (NCBI accession number: NP_416551.1) and the gene lacZ encoding β-galactosidase LacZ (NCBI accession number: NP_414878.1) in Escherichia coli BL21. For the specific gene knockout method, refer to the patent with the publication number CN110804577A to obtain the recombinant bacterium BWL.

[0071] Use the CRISPR-Cas9 gene editing system to replace the native promoter of manC-manB in the genome of the recombinant bacterium BWL with the constitutive promoter P J23119 , and for the replacement method and primer information, refer to the patent with the publication number CN114874964A to obtain the recombinant bacterium BCB.

[0072] Use the pEcCpf1 / pcrEG gene editing system to integrate SAMT with P J23119 -initiated expression into the recA locus in the genome of the recombinant bacterium BCB to obtain the strain BS.

[0073] The operation is as follows:

[0074] Using the Escherichia coli BL21 genome as a template, and using primers UP-S-F / R and Down-ZH-F / R, respectively amplify the upstream and downstream target fragments UP and Down of the recA locus by PCR. Using the plasmid pET-SAMT constructed in Example 1 as a template, and using primers SAMT-ZH-F / R, amplify the P J23119 -SAMT-T7 term fragment by PCR. Assemble and construct the three fragments UP, Down and P J23119 -SAMT-T7 term through the primers recA-UH-OVER-F / R, and obtain the final fragment UP-P J23119 -SAMT-T7 term-Down as the donor template by gel extraction.

[0075] The N23 sequence that recognizes this domain was found at the recA locus to identify and locate the cleavage of recA for the integration of SAMT. Using the original commercial plasmid pEcgRNA as a template, pTarget-F-SAMT was obtained by looping P with primers pTarget-recA-N23-F / R. The obtained pTarget-F-SAMT (800 ng) and the donor template (200 ng) were co-electroporated into the target strain BCB with Cpf1 electrocompetent cells. The voltage of the electroporator was set at 2.5 kv (2 mm electroporation cuvette). Immediately after electroporation, 900 μL of ice-cold LB was added, and after incubation at 37 °C for 1 h, it was spread on a double-antibody plate containing kanamycin (Kan) and spectinomycin (Spc), and cultured overnight in an oven at 37 °C. After successful sequencing, the recombinant strain BS with SAMT was obtained.

[0076] The verified bacteria were inoculated into a 4 mL LB test tube containing rhamnose at a final concentration of 10 mM and 2 μL of kanamycin and cultured overnight at 37 °C. After that, it was streaked on an LB solid plate (containing kanamycin) and cultured at 37 °C. After single colonies grew on the plate, they were streaked on LB plates containing kanamycin or containing kanamycin and spectinomycin respectively and cultured at 37 °C. The bacteria that grew on the plate containing kanamycin but did not grow on the plate containing kanamycin and spectinomycin were successfully removed of pTarget-F-SAMT. Subsequently, the single colonies were further inoculated into an LB liquid medium containing 5 g / L glucose and cultured at 37 °C and 200 rpm for 10 - 12 h. Then, about 10 μL of the bacterial liquid was streaked on an LB plate containing 5 g / L glucose and 10 g / L sucrose and cultured at 37 °C for 10 - 12 h. Single colonies were randomly selected and streaked on an antibiotic-free LB plate and an LB plate containing kanamycin respectively. The bacteria that grew on the antibiotic-free plate and did not grow on the LB plate containing kanamycin were the final hosts that successfully removed the plasmid. The primer sequences used are shown in Table 1.

[0077] Table 1 Primer sequences for constructing recombinant engineering bacteria

[0078]

[0079]

[0080] Example 3

[0081] The plasmids pRSF-CBGW and pET-SAMT (or pET-AB-SAMT) in Example 1 were co-transformed into the target engineering bacteria, and the fermentation production of SAMT was investigated with the α-1,2-fucosyltransferase gene wbgL derived from Escherichia coli O126 as a control under the same combined conditions. The specific strain-plasmid combination information is shown in Table 2.

[0082] The recombinant plasmids were transferred into the competent cells of the engineered bacteria in combinations of pRSF-CBGW and pETDuet-SAMT or pRSF-CBGW and pETDuet-AB-SAMT, placed on ice for a 20-min ice bath, then heat-shocked at 42 °C for 90 s, and immediately transferred to an ice bath for 5 min; 900 μL of LB medium was added in a laminar flow hood and cultured with shaking at 37 °C for 1 h. After the culture ended, it was centrifuged at low speed for 2 min, and 100 μL of the bacterial solution was evenly spread on an LB solid plate and cultured overnight at 37 °C. Subsequently, single colonies were picked for shake flask fermentation, and the yield of 2′-fucosyllactose was determined by HPLC. The fermentation results of each strain are shown in Table 2.

[0083] Table 2 Information of engineered strains for 2′-fucosyllactose production

[0084]

[0085]

[0086] As shown in Table 2, the yield of the strain BS1 expressing codon-optimized SAMT was 3.51 times higher than that of the strain BS2 expressing non-optimized SAMT1; it shows that codon optimization for heterologous protein expression and selection of synonymous codons corresponding to highly abundant tRNAs are beneficial to enhancing the expression of this protein, thereby enabling it to have higher production potential.

[0087] In addition, after integrating SAMT into the genome of the strain, the titer of 2′-fucosyllactose of the strain BSS2 can reach 8.03 g / L, and the titer of 2′-fucosyllactose is higher than that of the strain BSW2 expressing wbgL under the same conditions.

[0088] Example 4

[0089] To verify the fermentation products of SAMT, the fermentation products of the strains BSS2 and BWW2 in Example 3 were detected by LC-MS. The results showed that compared with the standards of 2′-fucosyllactose and difucosyllactose ( Figure 3 ), both 2′-fucosyllactose and difucosyllactose were present in the fermentation products of the strain BWW2, while only the 2′-fucosyllactose product was contained in the fermentation products of the strain BSS2. Since the molecular weight of 3-fucosyllactose is the same as that of 2′-fucosyllactose, it cannot be accurately distinguished by LC-MS.

[0090] To further verify the specificity of the fermentation products of the strains BSS2 and BWW2 in Example 3, four standards were detected by ion chromatography to detect the components in the fermentation broth. The results are as Figure 4As shown, there are no other fucosylated lactose products in the fermentation product of strain BSS2 except 2′-fucosyllactose, showing good specificity. However, 3-fucosyllactose and difucosyllactose products are present in the fermentation product of strain BWW2.

[0091] Example 5

[0092] To further verify the production effect of strain BSS2 constructed in Example 3 in a 5L fermenter, the seed solution of strain BSS2 was inoculated into a 5L fermenter containing 1.5L of glycerol-defined medium (glycerol at 30 g / L) at an inoculation ratio of 10% (v / v). The dissolved oxygen was set at 30%, the growth temperature at 37°C, the stirring speed at 800 rpm, the aeration rate at 2 vvm, and the pH at 6.6 ± 0.05. The pH during the growth process was regulated with ammonia water to maintain the pH stability throughout the fermentation; when the OD 600 of the strain in the tank grew to 17, IPTG with a final concentration of 0.1 mM and lactose at 5 g / L were added, and the temperature was adjusted to 25°C. During this period, the consumption of lactose and glycerol was detected irregularly, and lactose (200 g / L lactose containing 1‰ ampicillin antibiotic and kanamycin antibiotic) and glycerol (600 g / L glycerol containing 20 g / L of magnesium sulfate heptahydrate, 0.2 g / L of thiamine, and 1‰ ampicillin antibiotic and kanamycin antibiotic) were supplemented to maintain the concentrations of lactose and glycerol in the fermentation system at 5 g / L. The total fermentation time was not less than 100 h, and the final yield of 2′-fucosyllactose reached 112.56 g / L, with a lactose conversion rate of 0.98 mol / mol.

[0093] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A microorganism capable of producing 2'-fucosyllactose, characterized in that, the microorganism is Escherichia coli BL21(DE3), and the β-galactosidase-encoding gene lacZ and UDP-glucose lipid carrier transferase-encoding gene wcaJ in the genome are knocked out; the phosphomannomutase-encoding gene manB, mannose 1-guanylyltransferase-encoding gene manC, GDP-D-mannose-4,6-dehydratase-encoding gene gmd and GDP-fucose synthase-encoding gene wcaG are expressed using the pRSFDuet-1 vector; using pETDuet-1 as the expression vector, the α1,2-glycosyltransferase-encoding gene derived from Azospirillum lipoferum is cloned into the second multiple cloning site of the plasmid, and rcsA and rcsB are introduced into the first multiple cloning site of the plasmid; Utilize the strong promoter P J23119 to replace the promoter before the manC - manB gene cluster on the genome; Integration and expression of the constitutive promoter P at the recA locus J23119 Enhanced α1,2-glycosyltransferase-encoding gene from Azospirillum lipoferum; the α1,2-glycosyltransferase-encoding gene derived from Azospirillum lipoferum is SAMT, and its sequence is as shown in SEQ ID NO.2; the specific sequence of manC is as shown in SEQ ID NO.4, the nucleotide sequence of manB is as shown in SEQ ID NO.5, the nucleotide sequence of gmd is as shown in SEQ ID NO.6, and the nucleotide sequence of wcaG is as shown in SEQ ID NO.7; the nucleotide sequences of rcsA and rcsB are as shown in SEQ ID NO.9 and SEQ ID NO.10 respectively.

2. A whole-cell catalyst, characterized in that, the whole-cell catalyst comprises the microorganism according to claim 1.

3. Use of the microorganism according to claim 1 or the whole-cell catalyst according to claim 2 in the preparation of human milk oligosaccharides; the human milk oligosaccharide is 2'-fucosyllactose.

4. A method for producing human milk oligosaccharides, characterized in that, the method comprises using the microorganism according to claim 1 or the whole-cell catalyst according to claim 2 to produce human milk oligosaccharides; the human milk oligosaccharide is 2'-fucosyllactose.

Citation Information

Patent Citations

  • Escherichia coli engineering bacterium for producing 2'-fucosyllactose

    CN110804577A

  • Genetically engineered bacterium for producing 2'-fucosyllactose and application of genetically engineered bacterium

    CN112342176A

  • Construction method and application of recombinant escherichia coli with high yield of 2 '-fucosyllactose

    CN114874964A

  • Cosmetic composition for skin irritation alleviation with 2'-fucosyllactose

    KR101972925B1