Key gene controlling the transformation of dent corn into flint corn

Abstract

The invention discloses a method for improving and creating flint corn germplasm resources, comprising the following steps: causing the coding gene function of ARF transcription factor ZmARF17 in the corn genome to lose function or down-regulate expression, thereby causing dent corn to transform into flint corn or enhancing the flint phenotype.

Description

Technical Field

[0001] This invention belongs to the field of maize breeding technology. Specifically, it relates to a key gene that controls the transformation of dent maize into flint maize and its application in improving and creating flint maize germplasm resources. Background Technology

[0002] Genetic improvement based on heterosis has always been the cornerstone of modern hybrid maize breeding. Flint and dent maize are two well-known maize kernel types among breeders, geneticists, and the general public, representing an important agronomic trait in maize breeding. However, this trait is controlled by multiple genes with minor effects, resulting in a complex molecular genetic mechanism. Therefore, throughout the long history of maize cultivation and genetic improvement, the molecular genetic mechanisms of flint and dent maize formation remain unclear, and the genes controlling flint and dent formation have not yet been cloned. Currently, production relies on traditional breeding methods for genetic improvement and germplasm innovation in flint and dent maize, which is time-consuming, labor-intensive, and inefficient. For a long time, there has been a lack of genes that can be directly applied to breeding practices for rapid, efficient, and low-cost improvement of flint and dent maize.

[0003] With the development of modern molecular biology, the genomes of several maize inbred lines have been sequenced and analyzed, including the classic dent maize B73, Mo17, and W22, tropical maize SK and K0326Y, and four important European flint maize lines F7, EP1, DK105, and PE0075 (Schnable, PS, et al. (2009). The b73 maize genome: complexity, diversity, and dynamics. Science, 326(5956), 1112-1115. Hirsch, C., et al., (2016). Draft assembly of elite inbred line PH207 provides insights into genomic and transcriptome diversity in maize. Plant Cell 28, 2700–2714. Springer, NM, et al., (2018). The maize W22 genome provides a foundation for functional genomics and transposon biology. Nature Genetics, 50, 1282–1288. Yang, N., et al., (2019). Genome assembly of a tropical maize inbred line provides insights into structural variation and crop improvement. Nature Genetics, 51, 1052–1059. Li, C., et al., (2020). Long-read sequencing reveals genomic structural variations that underlie creation of quality protein maize. Nature Communications 11,17.Li2020.Haberer,G.,et al.,(2020).European maize genomes highlight intraspeciesvariation in repeat and gene content.Nature Genetics,52,950–957.).These high-quality genomic information reveal the mysteries of maize genetic diversity, laying the foundation for maize genetic breeding and the genetic improvement of important agronomic traits. Meanwhile, in recent years, our research on maize kernel-related agronomic traits, including early kernel development (Yongcai, Huang, et al., (2019). Maize VKS1 Regulates Mitosis and Cytokinesis During Early Endosperm Development. The Plant Cell, 31(6):1238-1256.), maize hard endosperm formation (Wang, H., et al., (2020). Carotenoids modulate kernel texture in maize by influencing amyloplast envelope integrity. Nature Communications 11, 5346.), and maize endosperm filling regulation, has yielded a series of breakthroughs and accumulated knowledge, laying the foundation for elucidating the molecular genetic mechanisms of flint and dent maize formation. Summary of the Invention

[0004] To tackle major scientific questions regarding the formation and evolution of maize germplasm resources, the molecular basis of important traits, and to reveal the molecular genetic mechanisms of complex trait formation, rapidly create new maize germplasm and improve inbred lines, develop high-yielding hybrids, and further tap the yield potential of maize, we have, since 2016, through unremitting efforts, arduous exploration, and rigorous verification, finally discovered and cloned a key gene, Fln1, encoding the transcription factor ZmARF17, which controls the transformation of maize from dent to flint maize. Mutation and inactivation of Fln1 promote the accumulation of flavonoids in the seed coat and reduce auxin content, thereby affecting seed coat development and leading to the formation of flint maize. This can transform the vast majority of maize into flint maize. This not only greatly increases our understanding of the formation of the important traits of flint and dent maize but also makes the genetic improvement and germplasm resource innovation of flint maize more efficient and convenient.

[0005] Based on this important discovery, the first objective of this invention is to provide a method for improving and creating flint maize germplasm resources, comprising the following steps: losing or downregulating the function of the gene encoding the ARF (auxin response factor) transcription factor ZmARF17 in the maize genome, i.e., inactivating or downregulating the expression of the ARF transcription factor, thereby causing dent maize to transform into flint maize or enhancing the flint phenotype.

[0006] The amino acid sequence of the ARF transcription factor ZmARF17 (abbreviated as FLN1) can be SEQ ID NO:1, and the NCBI accession number is Zm00001d014013; the nucleotide sequence of the gene encoding the ARF transcription factor ZmARF17 is SEQ ID NO:2, and is named Fln1 in this paper.

[0007] SEQ ID NO:1 and SEQ ID NO:2 are the amino acid sequence and encoding gene sequence of the ZmArf17 protein in dent maize B73, respectively.

[0008] The above method can be implemented in the following optional ways:

[0009] (1) Knock out Fln1, the gene encoding ARF transcription factor in the maize genome, such as SEQ ID NO:2;

[0010] (2) Downregulate the expression level of Fln1, the gene encoding ARF transcription factor in the maize genome, such as SEQ ID NO:2;

[0011] (3) Replace the ARF transcription factor encoding gene Fln1 in the maize genome with a mutant gene encoding a lost or downregulated ARF transcription factor, such as SEQ ID NO:2, to inactivate or reduce the function of ARF transcription factors in maize; or

[0012] (4) Mutate the ARF transcription factor encoding gene and its three homologous genes simultaneously. The mutants cause the original function to be inactivated or downregulated. The three homologous genes are ZmArf2 (NCBI accession number Zm00001d032683, CDS region of ZmArf2 gene) with nucleotide SEQ ID NO:7, ZmArf19 (NCBI accession number Zm00001d014507, CDS region of ZmArf19 gene) with nucleotide SEQ ID NO:9, and ZmArf21 (NCBI accession number Zm00001d000358, CDS region of ZmArf21 gene) with nucleotide SEQ ID NO:9.

[0013] In the above methods, the knockout of the ARF transcription factor encoding gene in method (1), the replacement of the gene mutant in method (2), and the mutation of the gene in method (3) can all be implemented by gene editing technology. The gene editing uses the CRISPR-Cas9 system, CRISPR-Cas12 system, CRISPR-Cpf1 system, CRISPR-Cas related transposon system INTEGRATE system, or CAST system.

[0014] In this paper, ARF transcription factor gene mutants are represented as fln1-m; ZmArf2 gene is represented as arf2. WT The ZmArf2 gene mutant is represented as arf2m or arf2. cr The ZmArf19 gene is represented as arf19. WT The ZmArf19 gene mutant is represented as arf19m or arf19. cr The ZmArf21 gene is represented as arf21. WT The ZmArf21 gene mutant is represented as arf21m or arf21. cr The "cr" in the name stands for CRISPR-Cas, a gene-editing system that enables gene mutations through gene editing technology.

[0015] Method (2) can be selected from the following group:

[0016] (2-1) Mutation of the promoter region of Fln1, the gene encoding ARF transcription factor such as SEQ ID NO:2, leads to downregulation of the expression level of Fln1, the gene encoding ARF transcription factor such as SEQ ID NO:2;

[0017] (2-2) Mutations in the upstream regulators of Fln1, the gene encoding ARF transcription factors such as SEQ ID NO:2, lead to downregulation of the expression level of Fln1, the gene encoding ARF transcription factors such as SEQ ID NO:2; or

[0018] (2-3) Introduce interacting proteins of ARF transcription factors into maize to alter the function of the ARF transcription factor encoding gene Fln1, such as SEQ ID NO:2.

[0019] The interacting protein of the ARF transcription factor mentioned in (2-3) is the homolog of the transcription factor P1, which regulates the metabolism of maize flavonoids, Pericarp Color1,MYB40.

[0020] Preferably, the mutants of the ARF transcription factor gene in methods (3) and (4) above are selected from the following group:

[0021] Nucleotide SEQ ID NO:3, represented as fln1-m1, is mutated by a G to A mutation at position 995 of SEQ ID NO:2, resulting in Trp. 332 It becomes the stop codon;

[0022] Nucleotide SEQ ID NO:4, represented as fln1-m2, is mutated by a C toT mutation at position 466 of SEQ ID NO:2, resulting in Gln. 156It becomes the stop codon;

[0023] Nucleotide SEQ ID NO:5, represented as fln1-m3, is mutated by the deletion of base G at position 487 of SEQ ID NO:2, leading to premature termination.

[0024] Nucleotide SEQ ID NO:6, represented as fln1-m4, is prematurely terminated due to the deletion of two CG bases at positions 486 and 487 in SEQ ID NO:2.

[0025] In one implementation, the mutants of the three homologous genes in method (4) above are selected from the following group:

[0026] arf2 cr The mutation is caused by the deletion of base G at position 478 in SEQ ID NO:7 (NCBI accession number Zm00001d032683, CDS region of ZmArf2 gene), which leads to premature termination of translation.

[0027] arf19 cr The mutation is caused by the deletion of base G at position 475 in SEQ ID NO:8 (NCBI accession number Zm00001d014507, CDS region of ZmArf19 gene), which leads to premature termination of translation.

[0028] arf21 cr The mutation is caused by the deletion of base G at position 496 in SEQ ID NO:9 (NCBI accession number Zm00001d000358, CDS region of ZmArf21 gene), which leads to premature termination of translation.

[0029] Preferably, the above-mentioned method for improving and creating flint maize germplasm resources can be implemented on the parental lines of hybrid maize, Zheng 58 (maternal) and Chang 7-2 (paternal).

[0030] For the mutants of the ARF transcription factor genes mentioned above in the maize genome, SEQ ID NOs:3-6, and the mutants of the three homologous genes arf2, cr arf19 cr and ARF21 cr The following methods can be used to detect mutated genes:

[0031] 1. For detection of SEQ ID NO:3, the forward primer fln1-F is: AAGGGTCCTGGTGGGTACAT; the reverse primer fln1-R is: TGCTTTAGCGTGGGACTGAC. The PCR product is 638 bp; the sequencing primer is fln1-F. PCR detection can be performed using a standard PCRMIX program. The amplified sequence is SEQ ID NO:10, used as the fln1-m1 molecular marker.

[0032] 2. For detection of SEQ ID NO:4, the forward primer arf17-2-F is: GTCCTTCAAGAACGCCGACA; the reverse primer arf17-2-R is: CGCTCCCGTGTCTACTACTTCC. The PCR product is 657 bp; the sequencing primer is arf17-2-F. PCR detection can be performed using a standard PCR mix and program. The amplified sequence is SEQ ID NO:11, used as the fln1-m2 molecular marker.

[0033] 3. When detecting SEQ ID NO:5, the forward primer arf17 cr -F: TACATTCCTACTCCGCTTTG; reverse primer arf17 cr -R: CCTGCCCTACCCTCATAC. PCR product is 1798 bp; sequencing primer is ARF17. cr - Sequencing: CGCTCCCGTGTCTACTA; Target sequence: GTGCTCGCCAAGGACGTGCA. PCR detection was performed using KOD FX Neo high-fidelity enzyme (KFX-201T, TOYOBO) and its PCR program. Sequence analysis website: http: / / skl.scau.edu.cn / dsdecode / The template sequence is SEQ ID NO:12, which serves as a molecular marker for fln1-m3 or fln1-m4.

[0034] 4. When detecting SEQ ID NO:6, the forward primer is the same as in item "3" above, using arf17. cr -F: TACATTCCTACTCCGCTTTG; reverse primer arf17 cr -R: CCTGCCCTACCCTCATAC. PCR product is 1798 bp; sequencing primer is ARF17. cr Sequencing sequence: CGCTCCCGTGTCTACTA; Target sequence: GTGCTCGCCAAGGACGTGCA. PCR detection can be performed using KOD FX Neo high-fidelity enzyme (KFX-201T, TOYOBO) and its PCR program. The sequence analysis website is: http: / / skl.scau.edu.cn / dsdecode / The template sequence is SEQ ID NO:12, which serves as a molecular marker for fln1-m3 or fln1-m4.

[0035] 5. Detect ARF2 cr At that time, the forward primer arf2 cr -F: ACGAAGAGGAGGAGGAGT; reverse primer arf2 cr -R: TCAGGTGGGCTACAAACA. PCR product is 1349bp; sequencing primer is arf2. cr Sequencing sequence: CGCTCCCGTGTCTACTA; Target sequence: GTGCTTGCCAAGGACGTGCA. PCR detection was performed using KOD FX Neo high-fidelity enzyme (KFX-201T, TOYOBO) and the PCR program. The sequence analysis website is: http: / / skl.scau.edu.cn / dsdecode / The template sequence is SEQ ID NO:13, used as arf2. cr Molecular markers.

[0036] 6. Detect ARF19 cr At that time, the forward primer arrf19 cr -F: CCCCTTGCTTTCTTCTCAC; reverse primer arf19 cr -R: GCCGCCGTGGACGCCTTC. PCR product is 1987bp; sequencing primer is arf19. cr Sequencing sequence: GTGCCTGGACCCGCAGCTGTGG; Target sequence: GTGCTCGCCAAGGACGTGCA. PCR detection can be performed using KOD FXNeo high-fidelity enzyme (KFX-201T, TOYOBO) and PCR program. Sequence analysis website: http: / / skl.scau.edu.cn / dsdecode / The template sequence is SEQ ID NO:14, which is used as aarf19. cr Molecular markers.

[0037] 7. Detect ARF21 cr At that time, the forward primer arf21 cr -F: CCCGAATCCGTCGTTACCC; reverse primer arf21 cr -R: GCTTTGAGATGCCGTCCTT. PCR product is 1599bp; sequencing primer is arf21. crSequencing sequence: CAATTCCCGCCGAAACCG; Target sequence: GTGCTCGCCAAGGACGTGCA. PCR detection can be performed using KOD FX Neo high-fidelity enzyme (KFX-201T, TOYOBO) and PCR program. Sequence analysis can be performed at: http: / / skl.scau.edu.cn / dsdecode / The template sequence is SEQ ID NO:15, which is used as arc21. cr Molecular markers.

[0038] Those skilled in the art will readily understand that the above-described mutant gene detection method can use a kit to perform DNA sequencing, thereby determining whether the maize genome contains the aforementioned gene mutants (mutation sites). Therefore, another aspect of the present invention provides a kit for implementing the above-described mutant gene detection method, comprising kits for detecting SEQ ID NOs:3-6, arf2 cr arf19 cr and ARF21 cr The aforementioned primers, or DNA / RNA probes, or DNA / RNA probe microarray chips.

[0039] A second object of the present invention is to provide a polynucleotide selected from:

[0040] (A) Any one of the mutants of the ARF transcription factor genes mentioned above, SEQ ID NOs:3-6;

[0041] (B) A polynucleotide whose nucleotide sequence is ≥80%, preferably ≥85%, ≥90%, ≥95%, more preferably ≥98% homology with any of the nucleotide sequences shown in SEQ ID NOs:3-6;

[0042] (C) A nucleotide sequence complementary to any one of (A) or (B).

[0043] A third aspect of the invention is to provide the use of the aforementioned polynucleotide for introduction into maize to replace the ARF transcription factor encoding gene in the maize genome, thereby causing a conversion of dent maize to flint maize or enhancing the flint phenotype.

[0044] This invention is the first to discover that the ARF transcription factor ZmARF17 (NCBI accession number Zm00001d014013) has the function of controlling the formation of flint / dent maize. The loss of function of its encoding gene Fln1, or the allelic variant fln1-m (selected from SEQ ID NOs: 3-6), introduced into the maize genome can transform maize kernels into flint maize or enhance the flint phenotype. Therefore, the regulation of the Fln1 gene can be used to improve and create flint maize germplasm resources, greatly accelerating the breeding speed of flint maize genetic improvement and germplasm resource innovation, avoiding the lengthy and uncertain large-scale field exploration process, and has broad application prospects and enormous economic value. Attached Figure Description

[0045] Figure 1 Photographs of the reciprocal cross phenotypes of the hard-grained dentaceous self-cross line are shown.

[0046] Figure 2 The results show the phenotypic and variation statistics of mature kernels in dent maize B73 and the EMS mutant (fln1-m1). Where A, E: B73; B, F: fln1-m1; C, G: B73 x fln1-m1; D, H: fln1-m1 x B73; IK: Apex angle I of mature kernels grown in Shanghai, seed length J of mature kernels from reciprocal crosses, seed width K of mature kernels from reciprocal crosses, and seed length-to-width ratio L of mature kernels from reciprocal crosses; MP: Apex angle M of mature kernels grown in Sanya; seed length N of mature kernels from reciprocal crosses; seed width O of mature kernels from reciprocal crosses; and seed length-to-width ratio P of mature kernels from reciprocal crosses. Six ears of maize were collected, and at least 50 kernels were taken from each ear for seed testing. **, P < 0.01 as determined by Student's t-test.

[0047] Figure 3 The phenotypic and statistical results of the fln1-m1 mutant at different developmental stages are shown. AD: Seed A of B73 at 12, 15, 20, 25, and 30 days post-pollination (DAP), seed B of fln1-m1, longitudinal section C of B73 seed, and longitudinal section D of fln1-m1 seed planted at Songjiang Farm, Shanghai; EG: Seed length E, seed width F, and seed coat length G at different developmental stages planted in Shanghai; HJ: Seed length H, seed width I, and seed coat length J at different developmental stages planted in Sanya. Six ears of fruit were collected, and at least 50 kernels were taken from each ear for seed testing. See coat length was measured for 6 ears, and at least 6 kernels were measured from each ear. **, P < 0.01 as determined by Student's t-test.

[0048] Figure 4The cytological changes in the seed coat and endosperm of the mutant fln1-m1 are shown. Figure A: Transmission electron microscopy (TEM) section of the top seed coat of B73 seed; B: TEM section of the top seed coat of fln1-m1 seed; C: Semi-thin section of the far embryo side of B73 seed; D: Semi-thin section of the far embryo side of fln1-m1 seed; E: Semi-thin section of the near embryo side of B73 seed; F: Semi-thin section of the near embryo side of fln1-m1 seed; G: Length of top seed coat cells; H: Length of seed coat cells on the far embryo side; I: Length of seed coat cells on the near embryo side; J: Total number of seed coat cells; K: Semi-thin and TEM observations of the top endosperm at different developmental stages, showing different filling abilities. En, endosperm; Al, aleurone layer; Per, seed coat; S, amylopectin; P, proteosome. **, P < 0.01 as determined by Student's t-test.

[0049] Figure 5 The BSA localization of the Fln1 gene is shown in the figure. A, B73, and fln1-m1 are represented by F... 2:3 A. Population mapping; B. Stepwise distribution of ED6 on 10 chromosomes; C. Fitting results for ED6.

[0050] Figure 6 The expression pattern analysis of the candidate gene ZmArf17 is shown. Figure A shows the variation of ZmArf17 within the BSA mapping region; B shows the expression levels of ZmArf17 in the seed coat and endosperm at different developmental stages, with three biological replicates; C shows Western blot analysis of ZmArf17 expression levels in the endosperm and seed coat at different developmental stages; D shows in situ hybridization analysis of ZmArf17 in 12DAP seeds; E shows the negative control from in situ hybridization; F shows analysis of GFP transgenic maize driven by the ZmArf17 promoter. fln1* represents fln1-m1; En represents the endosperm; Em represents the embryo; Per represents the seed coat; WT represents the wild type.

[0051] Figure 7 The tissue expression pattern analysis of ZmArf17 is shown. Figure A shows the relative expression level of ZmArf17 in different maize tissues; Figure B shows the relative expression level of ZmArf17 in the seed coats B73 and fln1-m1 at different developmental stages. Three biological replicates are included. En represents the endosperm; Em represents the embryo; and Per represents the seed coat.

[0052] Figure 8The figure shows CRISPR knockout mutant combinations of ZmArf17 and its three homologs. The figure also shows the phenotypes of single-gene mutants of arf2, arf17, arf19, and arf21, as well as the phenotypes of different combinations of double, triple, and quadruple mutants. Red lines indicate the type of base deletion.

[0053] Figure 9 The mutants fln1-m1, arf17-2, and arf17 were shown. cr Allele detection results. The bolded portion represents the sequence of the mutation site in the wild type, and the dotted and dashed lines indicate the gene editing site.

[0054] Figure 10 This figure shows the RNA-seq analysis of seed coats from dent maize B73 and EMS-induced variant fln1-m1. Figure A shows the intersection of B73 and fln1-m1 seed coat RNA-seq at 12, 20, and 30 DPA; B shows the KEGG analysis of the intersection of B73 and fln1-m1 seed coat RNA-seq at 12, 20, and 30 DPA; C shows the expression levels of phenylpropanoid metabolic pathway genes in B73 and fln1-m1 seed coat RNA-seq at 12, 20, and 30 DPA; and D shows the quantitative PCR validation of phenylpropanoid metabolic pathway genes under different seasonal planting conditions. Data are presented in three biological replicates.

[0055] Figure 11 Metabolomic analysis of seed coats from dent maize B73 and EMS-induced variant fln1-m1 is presented. Metabolomic analysis was performed using seed coats from 15 and 25 DAP. Intersection analysis of differentially expressed metabolites from the two time periods showed specific enrichment of these metabolites in the flavonoid metabolic pathway. Data were presented in three biological replicates.

[0056] Figure 12 The changes in auxin content in the seed coat of the mutant fln1-m1 are shown. PC, placental chalaza; Ped, pedicel tissue; En, endosperm; Upper, seed coat tissue excluding basal tissue; Basal, seed basal tissue including PC and Ped. **, P < 0.01 as determined by Student's t test.

[0057] Figure 13The diagram shows the analytical spectra of FLN1 and P1 directly binding to inhibit transcriptional activation activity. In the figure: A, BiFC analysis; B, luciferase complementation assay; C, Co-IP assay; D, luciferase transcriptional activation assay of the CHS promoter; E, luciferase transcriptional activation assay of the DFR promoter; F, LUC transcriptional activation assay in the tobacco system; G, EMSA assay demonstrating that MYB40 can directly bind to the CHS promoter sequence, and that FLN1 enhances the binding function of MYB40; H, EMSA assay demonstrating that MYB40 can directly bind to the CHS promoter sequence, and that FLN1 enhances the binding function of MYB40. **, P < 0.01 as determined by Student's t-test.

[0058] Figure 14 The phenotypes of wild-type dent maize B73 and its mutant fln1-m1 were shown when grown at the Northeast Agricultural University experimental base in Harbin.

[0059] Figure 15 This diagram shows the creation of a hard-kernel hybrid by introducing the gene fln1-m1 into the parents of the hybrid Zhengdan 958, Zheng 58 and Chang 7-2. In Figure A, the phenotype of the plants in the main cultivar Zhengdan 958 after introducing the gene fln1-m1 into their parents shows no significant change compared to before improvement; in Figure B, the hard-kernel phenotype of the hybrid created after improving the parents of Zhengdan 958 with fln1-m1 is significantly enhanced; in Figure C, 100-kernel weight; in Figure D, moisture content; in Figure E, cob length; in Figure F, number of rows per ear; and in Figure G, number of kernels per row. Detailed Implementation

[0060] Flint and dent maize are important germplasm resources for modern hybrid maize breeding, and also important agronomic traits. Because flint dent maize is controlled by multiple genes with minor effects and a complex genetic mechanism, the QTLs controlling its formation are difficult to clone and have not yet been reported; furthermore, the formation mechanism of flint maize is unclear. Therefore, genetic improvement and germplasm expansion of flint maize through conventional breeding methods are not only time-consuming, labor-intensive, and inefficient, but also progress very slowly and lack clear direction.

[0061] We have discovered and cloned for the first time a key gene controlling the formation of flint / dent maize. Sequence analysis confirmed it to be Fln1, the encoding gene of the ARF transcription factor ZmARF17, with NCBI accession number Zm00001d014013. Loss-of-function allelic variants of Fln1, fln1-m (selected from SEQ ID NOs:3-6, i.e., fln1-m1, fln1-m2, fln1-m3, and fln1-m4), were introduced into conventional inbred lines. The genotype of fln1-m was identified by PCR and sequencing. Homozygous fln1-m resulted in maize kernels that were converted to flint type. Furthermore, we found that the three homologs of ZmArf17, ZmArf2, ZmArf19 and ZmArf21, could not lead to the dimpled phenotype, but the dimpled phenotype was more pronounced when Fln1 and its homologs ZmArf2, ZmArf19 and ZmArf21 were simultaneously knocked out using CRISPR.

[0062] In this document, for the sake of simplicity, the protein name, such as the transcription factor ZmARF17, is sometimes used interchangeably with the name of its encoding gene (DNA). Those skilled in the art should understand that they represent different substances in different descriptive contexts. For example, when describing the function or class of a transcription factor, ZmARF17 (gene) refers to the protein (SEQ ID NO:1); when describing it as a gene, it refers to the gene encoding the transcription factor (SEQ ID NO:2), and so on. This is readily understood by those skilled in the art.

[0063] The basis for this invention includes the following processes and analysis.

[0064] Creating a flint corn EMS mutant

[0065] Since 2016, we have been creating maize kernel development mutants by inducing EMS (ethyl methanesulfonate) mutagenesis in dent maize inbred lines such as B73, A619, and W64A. After self-pollination of the mutagenized seeds, we found that some ears did not show kernel segregation of the phenotype in the M2 generation. However, after another generation of self-pollination (M3), these seeds segregated into flint ears. Furthermore, when creating near-isogenic populations using flint inbred lines and the dent inbred line A619, we found that when the flint parent was used as the maternal parent and the pollen was crossed with A619, all ears had flint kernels; conversely, when A619 was used as the maternal parent and the pollen was crossed with flint parent, all ears had dent kernels; however, the F1 generation harvested only dent ears. These genetic phenomena indicate that flint and dent kernel types are determined by the maternal parent's genotype, and that flint kernel type is recessive relative to dent type. We then organized and analyzed the EMS mutants accumulated over many years, obtaining a series of stably inherited flinty mutants. Among them, a flinty mutant with a B73 background exhibited the most obvious phenotype and the best genetic stability, named fln1-m1. Reciprocal crosses between the maize mutant fln1-m1 and B73 both conformed to the aforementioned inheritance patterns of flinty and dentate maize, i.e., controlled by the maternal genotype. Subsequently, we conducted a series of cytological and developmental biological studies on this mutant, finding that compared to B73, fln1-m1 had shorter seed length, essentially unchanged seed width, shorter seed coat length, shorter seed coat cells, fewer seed coat cells, and more abundant endosperm filling at the seed apex. The slowed seed coat expansion and increased endosperm filling at the seed apex of fln1-m1 led to the formation of flinty maize.

[0066] BSA sequencing clones key genes controlling fluff corn formation

[0067] We crossed fln1-m1 and B73 to obtain F1, and then self-crossed F1 to obtain F2. More than 500 F2 seeds were planted, each plant was numbered and self-crossed, and the grain phenotype was analyzed after harvest. The grain type of individual ears was uniform without segregation, but flint and dent ears separated, with a segregation ratio of 3:1. This indicates that the flint mutant is controlled by a single gene. We selected ears with extreme dent and extreme flint phenotypes, and extracted DNA from the leaves corresponding to their numbers for BSA pooled sequencing analysis. The results showed a unique peak on chromosome 5. Further analysis revealed a gene for the auxin response factor (ARF) transcription factor ZmARF17 (NCBI accession number Zm00001d014013) located in the coding region. A G-to-A base mutation in the coding region caused Trp... 332The expression pattern changed to a stop codon (Stopgain), prematurely terminating protein translation. Gene expression patterns showed that ZmArf17 was predominantly highly expressed in the seed coat tissue at different developmental stages, relative to the roots, stems, leaves, endosperm, and embryo; moreover, its expression level was significantly reduced in the fln1-m1 mutant seed coat. Western blot experiments also showed that ZmArf17 protein was enriched in the seed coat but almost undetectable in the fln1-m1 seed coat. Furthermore, in situ hybridization experiments and fluorescence experiments of transgenic maize with ZmArf17 promoter-driven GFP also indicated that ZmArf17 was mainly highly expressed in the seed coat. Therefore, we will use ZmArf17 as a candidate gene for further research.

[0068] Genetic validation of candidate genes

[0069] ZmArf17 has three other homologous genes: ZmArf2, ZmArf19, and ZmArf21. To prevent functional redundancy, we used CRISPR to simultaneously knock out these four genes, and then isolated single, double, triple, and quadruple mutations of these four genes. Genotypes were accurately identified for different combinations of materials, followed by rigorous self-crossing to examine the phenotype. It was found that in all combinations, the presence of a loss-of-function mutation in ZmArf17 resulted in a flint phenotype; however, loss-of-function mutations in the other three genes, regardless of whether they were single, double, or triple mutations, did not lead to flint corn formation. Therefore, ZmArf17 is the key gene Fln1 regulating flint corn formation. Furthermore, it was found that simultaneous mutations in these four homologous genes—ZmArf2, ZmArf17, ZmArf19, and ZmArf21—resulted in a more pronounced flint phenotype.

[0070] FLN1 affects seed coat development by regulating flavonoid synthesis and thus auxin levels.

[0071] To clarify how FLN1 regulates flint maize formation, we conducted in-depth analysis of seed coat RNA-seq data from maize B73 and fln1-m1 varieties at 12, 20, and 30 days post-pollination (DAP). We found that the differentially expressed genes at these three developmental stages were primarily enriched in the phenylpropanoid metabolic pathway. RT-qPCR validation of these genes in the seed coat revealed changes in their expression at different developmental stages. Specifically, the key enzymes in the flavonoid synthesis pathway, CHS (chalcone synthase gene), DFR (dihydroflavonol reductase gene), and two UGTs (UDP-glycosyltransferase genes), were significantly upregulated in the fln1-m1 seed coat at all three developmental stages. Further metabolomics analysis of seed coats at 15 and 25 DAP revealed a specific enrichment of flavonoids and their derivatives in the intersection of differentially expressed metabolites at these two stages. These results indicate that phenylpropane metabolism, especially flavonoid metabolites, plays an important role in the seed coat development of B73 and fln1-m1.

[0072] Previous studies have shown that flavonoids and flavonoid derivatives have a structure similar to the auxin polar transport inhibitor NPA (N-1-naphthylphthalamic acid), and thus inhibit auxin transport. Therefore, we further examined the changes in auxin content during seed coat development in B73 and fln1-m1. By measuring auxin content, we found that the auxin content was significantly reduced in the entire seed coat, upper seed coat, and seed basal tissue of fln1-m1. This decrease in auxin content inhibited seed coat cell growth. These results indicate that loss of FLN1 function promotes flavonoid accumulation in the seed coat and reduces auxin content, thereby affecting seed coat development and leading to the formation of flint maize.

[0073] FLN1 and MYB40 bind to inhibit their transcriptional activation activity, thereby regulating the flavonoid metabolism pathway.

[0074] To understand how FLN1 regulates the flavonoid metabolism pathway, we used BiFC, LUC complementation, and pull-down experiments to discover that FLN1 interacts with MYB40 (Zm00001d040621), a homolog of P1 (Pericarp Color1), a key transcription factor regulating maize flavonoid metabolism. Previous studies have shown that P1 can bind to the promoters of the key flavonoid synthesis genes CHS and DFR, positively regulating their expression and thus the flavonoid metabolism pathway. Our LUC transcriptional activation experiments on maize leaf protoplasts and tobacco leaves demonstrated that MYB40 can activate the CHS and DFR promoters, while FLN1 cannot. Co-transformation of FLN1 and MYB40 inhibited the activation activity of P1 on the CHS and DFR promoters. Further EMSA experiments showed that MYB40 can bind to the CHS and DFR promoters in vitro, and the addition of FLN1 enhances the DNA-binding ability of MYB40. These results indicate that FLN1 negatively regulates the flavonoid metabolism pathway in maize seed coat by directly binding to MYB40 and inhibiting its transcriptional activation activity on flavonoid synthesis genes, thereby affecting seed coat development.

[0075] Genetic stability test of the mutant fln1-m1 flint maize

[0076] We conducted planting studies at the Songjiang Farm of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences in Shanghai, the Sanya Damao Cotton Research Institute base, the Northeast Agricultural University experimental base in Harbin, and Weifang, Shandong. The fln1-m1 flint phenotype remained highly stable across different years and locations. This indicates strong genetic stability of the gene and its applicability to large-scale genetic improvement and germplasm resource innovation in flint maize.

[0077] A hard-grained hybrid was created by introducing fln1-m1 into the two parents of the main cultivar Zhengdan 958.

[0078] To test the application potential of the fln1-m1 gene mutant, we introduced fln1-m1 into the parents of the main cultivar Zhengdan 958, Zheng58 and Chang7-2, and then hybridized them to create an improved version of Zhengdan 958. The plant type, 100-kernel weight, cob length, number of rows per ear, and number of kernels per row did not show significant changes in the improved parents and the hybrid. However, the kernels all changed from dent to flint type, and the kernel moisture content decreased significantly. These results indicate that the fln1-m1 gene alone can improve traditional dent maize into flint maize and reduce kernel moisture content, demonstrating its significant application value.

[0079] The advantages of the technical solution of this invention are mainly reflected in the following aspects:

[0080] I. fln1-m exhibits strong function and good genetic stability. Introducing fln1-m into different maize inbred lines through hybridization can transform their kernels into flint kernels. Theoretically, this is effective for most inbred lines, which will greatly expand the germplasm resources for flint and dent maize. Furthermore, fln1-m demonstrates excellent genetic stability, exhibiting very stable phenotypes in Northeast China, the Huang-Huai-Hai Plain, and Sanya.

[0081] Second, the time required for improving flint corn using fln1-m is shorter. Because the genes and mechanisms controlling flint corn formation are unclear, conventional flint corn genetic improvement requires large-scale field investigations at multiple locations over many years to obtain stable materials. However, when using fln1-m for flint corn improvement, simply hybridizing it with other inbred lines, followed by one generation of self-pollination, and then identifying fln1-m homozygous plants using our developed molecular markers, will produce flint-type seeds regardless of whether the ears are self-pollinated or hybridized with other corn pollen. Furthermore, during the introduction process, only one ear needs to be retained for hybridization and self-pollination to obtain stable flint material, significantly reducing workload.

[0082] Third, the operation of fln1-m for improving flint corn is simple and suitable for large-scale operations. Corn hybridization and self-pollination techniques are relatively simple and can be mastered by ordinary workers. We have developed molecular marker primers for fln1-m, which can facilitate genotyping identification. The involved corn leaf DNA extraction, PCR reaction, and sequencing are all routine molecular experiments that can be performed in ordinary laboratories and sequencing companies.

[0083] Fourth, fln1-m is a low-cost method for improving flint corn. Compared to traditional corn genetic improvement, fln1-m offers stronger, more stable, faster, and less labor-intensive results, significantly reducing costs. Furthermore, the molecular experiments for fln1-m genotyping are routine and inexpensive.

[0084] Fifth, fln1-m can be used to create flint hybrid maize. By introducing the fln1-m genotype into the parents of major maize varieties, we can quickly obtain flint hybrid maize while maintaining the original hybrid vigor. Promoting this technology can create huge economic and social benefits.

[0085] The technical solution of the present invention is illustrated and verified through the following embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the present invention.

[0086] Example

[0087] The embodiments in this article involve the addition amount, content and concentration of various substances. Unless otherwise specified, the percentage content mentioned refers to the mass percentage content.

[0088] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-30°C).

[0089] Materials and methods

[0090] The self-pollination, hybridization, transgenic operations, and field breeding of maize are carried out in accordance with conventional breeding methods.

[0091] The primer synthesis and gene sequencing in the examples were all completed by Shanghai Boshan Biotechnology Co., Ltd.

[0092] The molecular biology experiments in the examples included plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, and culture medium preparation, etc., mainly referring to "Molecular Cloning: A Laboratory Manual" (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. Specific experimental conditions can be determined through simple experiments if necessary.

[0093] PCR amplification experiments should be performed according to the reaction conditions provided by the reagent supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0094] Example 1: Creation of Genetic Materials

[0095] When we created near-isogenic genetic populations using a flint inbred line and the dent cultivar A619, we found that when the flint parent was used as the female parent, hybridization with A619 pollen resulted in all ears having flint kernels; conversely, when A619 was used as the female parent, hybridization with flint parent pollen resulted in all ears having dent kernels. (See [link to relevant documentation]). Figure 1 This indicates that the hard-grained and dentate varieties are determined by the maternal genotype.

[0096] Example 2: Phenotype of EMS mutant

[0097] EMS mutagenesis

[0098] (1) Preparation of female ears: Usually, 50-100 corn plants are induced each time. The female ears are pruned one afternoon in advance so that the silks are neat the next day. When EMS is applied, the silks are about 1-2 cm long.

[0099] (2) Preparation of EMS chemical mutagen (added in fume hood): Add 40 μl of EMS reagent to 40 mL of mineral oil to treat about 40 corn female ears with good silking (plan the number of plants to be treated in advance and prepare the amount of reagent accordingly).

[0100] (3) Preparation of EMS / pollen solution: In the morning, collect pollen by placing the male flowers in a large bag (let the pollen disperse for at least half an hour). During this time, prepare the EMS chemical mutagen (prepared in step 2). Then, filter the pollen using a fine mesh bag. Add 5-8 mL of pollen to 40 mL of EMS mutagen solution to obtain the EMS / pollen solution. Perform mutagenesis treatment for 45 min, continuously shaking or gently agitating to ensure the pollen is evenly dispersed in the EMS mutagen.

[0101] (4) Applying EMS-treated pollen to female ears: Use a brush to apply EMS / pollen solution to well-coated corn ears. Immediately after application, cover the ears with a bag to prevent contamination by other pollen. After EMS mutagenesis, spray a stopping agent onto the ears. The stopping agent is 10% sodium thiosulfate (containing 1% Tween 20), which can quickly inactivate EMS into low / harmless substances.

[0102] Through the above EMS mutagenesis, we screened for a mutant with the most obvious and stable fudge phenotype, based on the B73 background, and named it fln1-m1. B73 is a typical dent maize variety with a concave apex and a small concavity angle (see...). Figure 2 (A, E, I); fln1-m1 is a hard kernel type, with a convex top and a larger angle ( Figure 2 (B, F, I); B73 as the female parent for the cross fln1-m1 pollen, the seed phenotype is similar to B73, being dent ( Figure 2 (C, G, I); fln1-m1 was used as the female parent for crossbreeding B73. The seed phenotype was similar to fln1-m1, being a hard-kernel type. Figure 2 The results (D, H, I) indicate that the fudge phenotype conforms to the genetic laws of maternal genotype control. Simultaneously, the seed length of the fudge from reciprocal crosses is significantly shorter than that of the dentate cross, while the seed width remains relatively unchanged, resulting in a decreased length-to-width ratio. Figure 2 (GL). Phenotypic and experimental data of reciprocal crosses during planting in Sanya ( Figure 2 The results from the Chinese MP plantation are consistent with those from Shanghai. Figure 2 (IL).

[0103] Example 3: Seed coat development and cell biological phenotype study of mutant fln1-m1

[0104] Our developmental biology studies on the mutant fln1-m1 revealed that, compared to B73, fln1-m1 exhibited significantly shorter seed length, essentially unchanged seed width, and significantly shorter seed coat length at different developmental stages after pollination. Furthermore, the phenotypes observed at different developmental stages in Sanya were consistent with those in Shanghai (see...). Figure 3 ).

[0105] Cellular studies have revealed that the length of the seed coat cells at the apex of fln1-m1 seeds is significantly shorter than that of B73. Figure 4In seeds A, B, and G, the seed coat cells on both sides of fln1-m1 are significantly shorter than those in B73. Figure 4 (CD, H, I), and the number of seed coat cells is significantly reduced ( Figure 4 (J). These data indicate that the shortening of fln1-m1 seed coat cells and the reduction in cell number lead to a shorter seed coat and smaller seeds. Changes in seed coat development affect endosperm filling.

[0106] We found that starting at 20 days post-aperture (DAP), the endosperm cells at the top of B73 seeds were significantly less filled with starch than those of fln1-m1. By 30 DAP, during the grain dehydration period, the starch and protein bodies in the top endosperm cells of B73 began to dehydrate and aggregate, creating cavities. This pulled the top seed coat cells inward, causing a depression and resulting in dented maize. In contrast, the top endosperm cells of fln1-m1 were more fully filled with starch, and even at 30 DAP, the endosperm cells were still not dehydrated, with starch and protein bodies filling them more completely. This prevented the top seed coat from collapsing inward, thus forming a hard-kernel phenotype. Figure 4 (Middle K). Developmental and cell biological studies have shown that the slower expansion of the fln1-m1 seed coat is conducive to the filling of the apical endosperm cells, thereby forming hard granules.

[0107] Example 4: BSA sequencing clones of the key gene Fln1 controlling fluff maize formation

[0108] We created the F1 generation by crossing fln1-m1 and B73, and then self-pollinated the F1 to obtain the F2 generation. We planted F2 seeds with more than 500 kernels each, numbered each plant, and self-pollinated them. After harvest, we analyzed the kernel phenotype and found that the kernel type of each ear was uniform, with no kernel type segregation. However, we observed segregation between flint and dent ears, with a segregation ratio of 3:1 (see [link to relevant documentation]). Figure 5 (A)

[0109] Ears exhibiting extreme dent and extreme hard kerosene phenotypes were selected, and DNA was extracted from the leaves corresponding to their assigned numbers for BSA pooled sequencing analysis. DNA extraction, library construction, sequencing, and bioinformatics analysis were outsourced to Shanghai Ouyi Biomedical Technology Co., Ltd. BSA sequencing results showed a unique peak on chromosome 5. Figure 5 Further analysis revealed a mutation in the ARF transcription factor ZmARF17 gene Zm00001d014013 located in the coding region, specifically a G-to-A (C-to-T) mutation (fln1-m1) in the coding region, which affects Trp. 332 The change to a stop codon (Stop gain) causes premature termination of protein translation. Figure 6 (A)

[0110] Gene expression patterns indicate that ZmArf17 is predominantly highly expressed in the seed coat tissue at different developmental stages, relative to the root, stem, leaf, endosperm, embryo, and seed coat. Figure 7 (A); and the expression level in the seed coat of the fln1-m1 mutant was significantly reduced ( Figure 6 B; Figure 7 (B); Western blot experiments also showed that ZmARF17 protein was enriched in the seed coat and almost undetectable in fln1-m1 seed coat. Figure 6 (C). Meanwhile, in situ hybridization experiments and fluorescence experiments of transgenic maize with ZmArf17 promoter-driven GFP also showed that ZmArf17 is mainly highly expressed in the seed coat. Figure 6 (ZmArf17 is a candidate gene for further research).

[0111] Example 5: Genetic verification of whether ZmArf17 is the key gene Fln1 controlling fluffy maize formation

[0112] Since ZmArf17 has three other homologous genes: ZmArf2, ZmArf19, and ZmArf21, to prevent functional redundancy, we used CRISPR to knock out all four genes simultaneously, and then isolated the single, double, triple, and quadruple mutations of these four genes.

[0113] Taking the CRISPR knockout of the homologous gene arf2 as an example, CRISPR knockout results in the deletion of base G at position 478 in the CDS region of Zm00001d032683, ZmArf2 (i.e., SEQ ID NO:7), leading to premature termination of translation. This includes the following steps:

[0114] 5.1 CRISPR vector construction and transformation

[0115] (1) Knockout target sequences were designed using the online website http: / / cbi.hzau.edu.cn / CRISPR2 / and specificity was verified using http: / / www.rgenome.net / cas-offinder / . Homologous sequences of the following four genes were selected as target sequences: GTGCTTGCCAAGGACGTGCA.

[0116] (2) PCR was performed using primers U6Pro-F(TCGAGCTCGGTACCCGGGAAGTCGTAAAATAGTG)+ARF17-R(TTGCTATTTCTAGCTCTAAAACTGCACGTCCTTGGCGAGCAC) and primers gRNA-F(GTTTTAGAGCTAGAAATAGCAA)+U6Ter-R (GCTTGCATGCCTGCAGGCGAGGGCTAAATCGT) to introduce the target sequence between the U6 promoter and the U6 terminator to construct a gRNA expression system;

[0117] (3) After recovering the two fragments, the gRNA expression system was homologously recombined into the Cas9 vector using the SmaI and PstI sites;

[0118] (4) The vector was transformed into Agrobacterium EHA105 strain after being verified by sequencing.

[0119] (5) The vector was transformed into maize high II B x A lines embryos by Agrobacterium-mediated transformation to obtain CRISPR transgenic maize.

[0120] 5.2 Maize DNA was extracted using the CTAB method for subsequent identification.

[0121] (1) Take corn leaves and place them in a 2mL tube. Add a steel column, treat with liquid nitrogen, and then grind (60Hz, 60s).

[0122] (2) After grinding, add 0.6 mL of CTAB extraction buffer and mix well.

[0123] (3) Place in a 65℃ oven for 60 minutes, mixing every 10-15 minutes during the process.

[0124] (4) Remove the tube and place it at room temperature for 5-10 minutes. Add an equal volume of chloroform:isoamyl alcohol (24:1) to the centrifuge tube, seal it, and shake for 5 minutes.

[0125] (5) Centrifuge at 13,000 rpm for 15 min at room temperature, and transfer the supernatant to a new 1.5 mL centrifuge tube.

[0126] (6) Add an equal volume of isopropanol, mix by inverting back and forth, and let stand at -20 degrees Celsius for 20 minutes.

[0127] (7) Centrifuge at 12,000 rpm for 1 min at room temperature and discard the supernatant. Wash the DNA precipitate 1 to 2 times with 1 mL of 75% ethanol, centrifuging at 12,000 rpm for 1 min each time, and then discard the ethanol.

[0128] (8) Briefly centrifuge, remove excess liquid, and air dry the DNA precipitate at room temperature.

[0129] (9) Add 0.3 mL of H2O to dissolve the DNA precipitate.

[0130] 5.3 Detection of arf2 in maize genes cr During mutation, the forward primer arf2 cr -F: ACGAAGAGGAGGAGGAGT; Reverse primer arf2 cr -R: TCAGGTGGGCTACAAACA. PCR product is 1349bp; sequencing primer is arf2. cr - Sequencing: CGCTCCCGTGTCTACTA; Target sequence: GTGCTTGCCAAGGACGTGCA. PCR detection was performed using KOD FX Neo high-fidelity enzyme (KFX-201T, TOYOBO) and the PCR program. Sequence analysis can be found at: http: / / skl.scau.edu.cn / dsdecode / The template sequence is SEQ ID NO:13.

[0131] Following the above method, mutants of ZmArf17, ZmArf19, and ZmArf21 were constructed using CRISPR gene editing technology, and the mutant genes of maize were identified. Among them, ZmArf17... cr Methods include CRISPR knockout to cause premature termination of the B73 reference genome ZmArf17 (CDS region of Zm00001d014013, SEQ ID NO:2) by deletion of base G at position 487 (fln1-m3); and premature termination by deletion of bases CG at positions 486 and 487 in the CDS region (fln1-m4). ZmArf19 cr The method involved CRISPR knockout, resulting in the deletion of base G at position 475 of the CDS region of Zm00001d014507, ZmArf19 (i.e., SEQ ID NO:8), leading to premature termination of translation. ZmArf21 cr The method involved CRISPR knockout, which resulted in the deletion of base G at position 496 of the CDS region of Zm00001d000358, ZmArf21 (i.e., SEQ ID NO:9), leading to premature termination of translation.

[0132] Genotypes of maize experimental materials from different wild-type (WT) mutant (cr) combinations were accurately identified, followed by rigorous self-pollination to examine the maize kernel phenotype. It was found that in all combinations, a loss-of-function mutation in ZmArf17 resulted in a flint phenotype; however, loss-of-function mutations in the other three genes, ZmArf2, ZmArf19, and ZmArf21, regardless of whether they were single, double, or triple mutations, did not lead to flint maize formation. Therefore, ZmArf17 is the key gene Fln1 regulating flint maize formation.

[0133] Furthermore, it was found that simultaneous mutations in these four homologous genes ZmArf2 / ZmArf17 / ZmArf19 / ZmArf21 resulted in a more pronounced daturoid phenotype (see [link]). Figure 8 We also identified another mutation site, arf17-2 (fln1-m2), in the EMS-induced variant fln1m, where a C-to-T mutation caused the 156th amino acid, Gln, to become a stop codon. We then compared fln1-m1 with arf17-2 (fln1-m2) and arf17... cr Allelic testing of (CRISPR knockout material of ZmArf2) revealed that different heterozygous mutation sites within this gene can lead to fluffy corn (see...). Figure 9 This further indicates that ZmArf17 is the key gene Fln1 controlling flint maize formation.

[0134] Example 6: Investigating changes in gene expression in maize kernel seed coat

[0135] We conducted an in-depth analysis of seed coat RNA-seq data and found that the differentially expressed genes at the three developmental stages were mainly enriched in the phenylpropanone metabolic pathway. Figure 10 (A, B). We performed RT-qPCR validation of phenylpropanoid metabolism pathway genes expressed in the seed coat. The steps included:

[0136] 6.1 RNA extraction:

[0137] (1) Take seed coat tissues of B73 and fln1-m1 at different developmental stages, quick freeze with liquid nitrogen, grind them thoroughly with a grinding machine, and quickly transfer them to an ultra-low temperature freezer at -80℃ for storage.

[0138] (2) Place approximately 50 mg of sample into a 2 mL tube, add 400 μL of RNA extraction SDS buffer, vortex thoroughly, and place on ice. SDS buffer is shown in the table below:

[0139]

[0140] (3) Add 400 μL of phenol-chloroform (phenol saturated in NaAc / HAc, 1:1 mixture, phenol pH 4.2, placed at 4℃, use the lower layer after separation), shake vigorously for 30s, place on ice for 5min, shake during the process, centrifuge at 12000 rpm at 4℃ for 10min, and aspirate 350 μL of supernatant into a new 1.5 mL centrifuge tube.

[0141] (4) Add 1 mL of Trizol extract to the supernatant tube, shake well, and place on ice for 5 min; then add 200 μL of chloroform to the mixture, shake well, place on ice for 5 min, centrifuge at 12000 rpm at 4℃ for 10 min, and transfer 500 μL of supernatant (do not aspirate into the middle layer and the organic phase below) into a new centrifuge tube.

[0142] (5) Add 500 μL of isopropanol to the supernatant, shake well, place on ice for 10 min, centrifuge at 12000 rpm at 4℃ for 10 min, and then discard the supernatant.

[0143] (6) Add 1 mL of 70% ethanol solution, gently tap to make the precipitate float, place on ice for 1 min, centrifuge at 12000 rpm at 4℃ for 5 min, and discard the supernatant.

[0144] (7) Centrifuge briefly and use a pipette tip to remove excess liquid. Air dry the RNA precipitate at room temperature for about 2 minutes, then add 100 μL of ddH2O to dissolve the precipitate.

[0145] (8) Using the QIAGEN RNeasy Plus Mini Kit, the above-mentioned initial RNA was purified by column chromatography according to the standard method of the kit, which involved the use of DNase I to remove DNA, and finally dissolved in 30 μL of RNase-free H2O.

[0146] 6.2 RNA-seq analysis

[0147] Library construction, sequencing, and subsequent bioinformatics analysis in the RNA-seq process were outsourced to Shanghai Ouyi Biomedical Technology Co., Ltd.

[0148] 6.3 Quantitative RT-PCR Identification of RNA-seq Results

[0149] (1) Reverse transcription of RNA: The reverse transcription kit (ImProm-II) from Pomega was used. TM The Reverse Transcription System was used to reverse transcribe RNA, following the standard method specified in the kit.

[0150] (2) Specific primers were designed using NCBI and specificity analysis was performed, with Actin as the internal reference gene.

[0151] (3) Quantitative analysis was performed according to the standard method of Takara's SYBR Green kit. Each sample was tested in triplicate. The reverse transcribed cDNA samples were diluted 8-fold and used in a 20 μL reaction system for quantitative analysis. Using SYBR Green Mix, 10 μL of mix, 0.5 μL of each primer, 3 μL of diluted cDNA, and 6 μL of ddH2O were added to a 20 μL reaction system.

[0152] (4) Gene expression levels were detected by two-step PCR amplification using a BIO-RAD fluorescence quantitative analyzer CFX. The reaction conditions were: pre-denaturation 95℃, 30s; amplification: 95℃, 5s, 60℃, 35s, 40 cycles; termination: 95℃, 15s; 60℃, 60s; 95℃, 15s.

[0153] (5) Quantitative data were analyzed using Excel 2010 and the ΔΔCT method.

[0154] 6.4 Primers for quantitative RT-PCR are shown in the table below.

[0155]

[0156]

[0157]

[0158] RT-qPCR results showed that the expression of these genes changed at different developmental stages. Among them, the key enzymes in the flavonoid synthesis pathway—CHS (chalcone synthase gene), DFR (dihydroflavonol reductase gene), and two UGTs (UDP-glycosyltransferase genes)—were significantly upregulated in the fln1 seed coat at all three developmental stages. Figure 10 (D).

[0159] Example 7: Investigation of flavonoids in corn kernel seed coat

[0160] We then commissioned Jiaxing Maiwei Metabolic Biotechnology Co., Ltd. to perform metabolomics analysis on seed coats from 15 and 25 DAP. The analysis revealed that the overlap of differential metabolites from these two periods specifically enriched flavonoids and their derivatives. Figure 11 These results indicate that phenylpropane metabolism, especially flavonoids, plays an important role in the seed coat development of B73 and fln1.

[0161] Example 8: Detection of auxin content in corn kernel seed coat

[0162] Weigh 50 mg of fresh seed coat sample, add 1 ml of 80% methanol, and extract for 4 h; centrifuge at 15000 rpm for 10 min, transfer the supernatant to a new centrifuge tube, and incubate overnight at -20℃; centrifuge at 15000 rpm for 10 min, transfer the supernatant to a new centrifuge tube, and incubate overnight at -20℃; centrifuge at 15000 rpm for 10 min, transfer 100 μL of supernatant to a sample loading tube, and detect using a quadrupole ion trap tandem mass spectrometer.

[0163] Experiments showed that the content of IAA (auxin) in the entire seed coat, upper seed coat, and seed base tissue of fln1-m1 was significantly decreased. Figure 12 (F). Decreased auxin content inhibits seed coat cell growth. These results indicate that loss of FLN1 function promotes flavonoid accumulation in the seed coat, reduces auxin content, and thus affects seed coat development, leading to flint corn formation.

[0164] Example 9: Protein Study Interacting with FLN1

[0165] 9.1 Bimolecular Complementary Fluorescence (BiFC) Detection:

[0166] 9.1.1 Vector construction: The full-length CDS of ZmArf17 and ZmMyb40 were amplified and then inserted into pSAT4-nEYFP and pSAT4-cEYFP plasmids, respectively.

[0167] 9.1.2 Isolation and Transformation of Maize Protoplasts: B73 seedlings were cultured in the dark at 28℃ for 7 days. Leaves were then cut into 1 mm pieces and reacted in an enzymatic digestion buffer (1.5% Cellulase R10, 0.5% Macerozyme R10, 0.4 M Mannitol, 20 mM KCl, 20 mM MES pH 5.7, 10 mM CaCl2, 0.1% BSA, 5 mM β-Mercaptoethanol) at 22℃ for 3 hours. The protoplasts were then terminated with W5 buffer (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 5 mM MMglucose, 0.03% MES, pH 5.7), washed, and collected. The protoplast concentration was then adjusted by adding MMG (0.4 M Mannitol, 15 mM MgCl2, 0.1% MES, pH 5.7). Add 10 μg of plasmid and 110 μL of PEG (45% PEG4000, 0.2 M Mannitol, 100 mM CaCl2) to each 100 μL protoplast buffer for transformation. After reacting at room temperature for 15 min, add 440 μL of W5 buffer to terminate the reaction. After removing the supernatant, add 1 ml of WI (20 mM KCl, 0.6 M Mannitol, 4 mM MES pH 5.7) and incubate the protoplasts for 16 h.

[0168] 9.1.3 YFP signals were captured by a laser confocal scanning microscope (LSM880) on protoplasts.

[0169] 9.2 Luciferase Complementation Imaging (LCI) Assay

[0170] 9.2.1 Vector Construction: ZmArf17 CDS was cloned into JW771 (NLUC), and ZmMyb40 CDS was cloned into JW772 (CLUC). Each ORF was fused into the C-terminal half (CLUC-X) and N-terminal half (X-NLUC) of the LUC sequence, respectively. Empty 771 and 772 were used as negative controls.

[0171] 9.2.2 The constructed vector was transferred into Agrobacterium tumefaciens GV3101.

[0172] 9.2.3 The transformed Agrobacterium cells were resuspended in osmotic buffer (10 mM MgCl2, 10 mM MES and 150 mM acetylsyl syringone) with an OD600 between 0.8 and 1.

[0173] 9.2.4 Inject the suspension onto the underside of the leaves of *Hedysarum benthamiana* and incubate for 2 days.

[0174] 9.2.5 Inject the luciferase solution into the test leaves in the same area, and then use the Tanon-5200 chemiluminescence imaging system to detect the luciferase signal.

[0175] 9.3 Determination of Dual-Luciferase Reporter Gene (DLR) in Maize Protoplasts

[0176] 9.3.1 Vector construction: The full-length CDS of ZmArf17 and ZmMyb40 were amplified and inserted into the 35S-driven effect plasmid 62SK, respectively; the promoter sequence was amplified and ligated upstream of the reporter vector pGreenII 0800 LUC.

[0177] 9.3.2 Then, the plasmid was extracted using the NucleoBond Xtra Midi(50) plasmid extraction kit, and the plasmid concentration was adjusted to 1 μg / μL.

[0178] 9.3.3 Transform maize protoplasts, see step 9.1.2.

[0179] 9.3.4 After incubating protoplasts for 16 hours, use... Total protein was extracted using the Reporter Assay System and reacted, and then the ratio of LUC to REN was analyzed using a photometer (Promega 20 / 20).

[0180] 9.4 EMSA Experiment

[0181] 9.4.1 Construction of prokaryotic expression vectors: The coding sequence of ZmMyb40 was amplified and cloned into the pCold vector, then fused with the N-terminal GST tag. The coding sequence of ZmARF17 was amplified and cloned into the pET30a vector, then fused with the His tag.

[0182] 9.4.2 Expression and purification of recombinant protein: The prokaryotic expression vector was transformed into Escherichia coli BL21(DE3)(EC1002), and induced with 0.5 mM isopropyl β-D-thiogalactoside (IPTG) at 20 °C for 20 h. The bacterial cells were then purified on Ni-NTA agarose (QIAGEN) according to the manufacturer's instructions.

[0183] 9.4.3 Promoter probe preparation: The 100bp region of the target promoter containing the CAAC element was labeled with the 5' end of fluorescein amidite (primers were synthesized by Shanghai Boshan Biotechnology Co., Ltd.).

[0184] 9.4.4 EMSA Assay: 0.05 pmol of labeled probe and 100 ng of purified recombinant protein were reacted in 20 μL of reaction mixture (1 μL of 1 mg / mL salmon sperm DNA, 20 mM Tris-HCl, pH 7.9, 5% glycerol, 0.04 mg / mL bovine serum albumin, 2 mM MgCl2, 0.2 mM dithiothreitol, 40 mM KCl, and ultrapure water to a final volume of 20 μL) at room temperature for 30 minutes. Unlabeled DNA fragments were added to the reaction at 10-fold, 50-fold, and 100-fold increases for competitive assay.

[0185] 9.4.5 Electrophoresis: Electrophoresis was performed in a 4% polyacrylamide gel with 0.5M Tris-borate-EDTA at a constant voltage of 110V and 4℃ for about 80 minutes.

[0186] 9.4.6 Imaging: Fluorescence was detected using a Starion FLA-9000 instrument (FujiFilm, Japan).

[0187] 9.5 Pull-down experiment:

[0188] 9.5.1 Equal amounts of ZmARF17 recombinant protein and MYB40 recombinant protein were incubated overnight at 4°C in buffer (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.2 v / v% Triton X-100, 10 v / v% glycerol, Roche (REF: 04693132001)) and glutathione agarose beads (c650031-0010).

[0189] 9.5.2 Wash three times with washing buffer (50 mM Tris-HCl, pH 8.0, 140 mM NaCl, 0.1% Triton X-100 and Roche (REF: 04693132001)) to remove unbound proteins. The bound proteins were then analyzed by Western blotting using anti-GST (ab clone) and anti-Flint (ab clone) antibodies.

[0190] 9.5.3 Western blotting: Proteins were separated by 10% SDS-PAGE gel electrophoresis and then transferred to a PVDF membrane. The membrane was incubated with primary antibody at 4°C overnight, followed by incubation with secondary antibody at room temperature. The membrane was then treated with chemiluminescent substrate reagent (Invitrogen, catalog number WP20005), and the immunoreaction bands were detected using the Tanon-5200 system.

[0191] 9.6 Primer list for vector construction:

[0192]

[0193]

[0194] We discovered through BiFC (bimolecular fluorescence complementation), LUC (luciferase complementation) assays, and pull-down assays (in vitro protein binding assays) that FLN1 (i.e., ZmARF17) can interact with MYB40, a homolog of P1 (Pericarp Color1), a key transcription factor regulating maize flavonoid metabolism. Figure 13 (AC). Through LUC transcriptional activation experiments using maize leaf protoplasts and tobacco leaves, we demonstrated that MYB40 can activate the CHS and DFR promoters, while FLN1 cannot activate the expression of these two genes; co-transformation of FLN1 and MYB40 inhibits the activation activity of MYB40 on the CHS and DFR promoters. Figure 13 (DFR). Further EMSA experiments demonstrated that MYB40 can bind to the CHS and DFR promoters in vitro, and the addition of FLN1 enhances the DNA binding ability of MYB40. Figure 13 These results indicate that FLN1 negatively regulates the flavonoid metabolism pathway in maize seed coat by directly binding to MYB40 and inhibiting its transcriptional activation activity on flavonoid synthesis genes, thereby affecting seed coat development.

[0195] Example 10: Investigating the performance of fln1m flint maize under different ecological conditions

[0196] Since 2018, we have been conducting research at the Songjiang Farm of the Shanghai Institute of Molecular Plant Sciences, Chinese Academy of Sciences, the Sanya Damao Cotton Research Institute base, and the Northeast Agricultural University experimental base in Harbin. Figure 14 Wild-type dent maize B73 and its mutant fln1-m were planted separately. After four years of observation, it was found that the fln1-m flear phenotype was very stable in different years and locations. This indicates that the fln1-m gene has strong genetic stability and can be applied to the genetic improvement and germplasm resource innovation of large-scale flear maize.

[0197] Example 11: fln1m flint maize hybridization experiment

[0198] To test the application potential of the Fln1 gene mutant, we introduced fln1-m1 into the parents of the main cultivated variety Zhengdan 958, Zheng 58 and Chang 7-2, and then hybridized them to create an improved version of Zhengdan 958. Figure 15The improved parents and hybrids did not show significant changes in plant type, 100-kernel weight, cob length, number of rows per ear, and number of kernels per row. However, the kernels all changed from dent to flint, and the kernel moisture content decreased significantly. These results indicate that the fln1-m1 gene alone can improve traditional dent maize into flint maize and reduce kernel moisture content, demonstrating its significant application value. Flint maize is an important germplasm resource in hybrid breeding. The fln1-m gene will greatly promote the genetic improvement and germplasm resource innovation of flint maize, possessing very broad application prospects and enormous economic value.

[0199] Although the above embodiments only use maize as an example to verify the function of transcription factor ZmARF17, those skilled in the art should understand that, without departing from the spirit of the present invention, they can make various modifications or alterations on this basis, such as applying it to the improvement of other grains or the creation of new varieties. The equivalent forms of various variations or modifications made therefrom should also fall within the scope of the present invention. sequence list <110> Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences <120> Key genes controlling the transformation of dent maize into flint maize <130> SHPI2110583 <160> 15 <170> SIPOSequenceListing 1.0 <210> 1 <211> 644 <212> PRT <213> Zea mays L. B73 <400> 1 Met Lys Glu Ala Gly Glu Glu Arg Cys Leu Asp Pro Gln Leu Trp His 1 5 10 15 Ala Cys Ala Gly Gly Met Val Gln Met Pro Pro Val Arg Ser Arg Val 20 25 30 Tyr Tyr Phe Pro Gln Gly His Ala Glu His Ala His Gly Gly Gly Gly 35 40 45 Ala Thr Asp Leu Ala Gly Ala Arg Ala Arg Pro Leu Pro Pro Leu Val 50 55 60 Leu Cys Thr Val Ala Gly Val Arg Phe Leu Ala Asp Pro Glu Thr Asp 65 70 75 80 Glu Val Phe Ala Lys Ile Arg Leu Val Pro Ala Ala Pro Gly Glu Val 85 90 95 Glu Phe Gly Glu Pro Arg Glu Phe Gly Ile Asp Pro Glu Asp Ala Arg 100 105 110 Glu Lys Leu Ser Ser Phe Ala Lys Thr Leu Thr Gln Ser Asp Ala Asn 115 120 125 Asn Gly Gly Gly Phe Ser Val Pro Arg Tyr Cys Ala Glu Thr Ile Phe 130 135 140 Pro Lys Leu Asp Tyr Arg Ala Asp Pro Pro Val Gln Thr Val Leu Ala 145 150 155 160 Lys Asp Val His Gly Glu Val Trp Lys Phe Arg His Ile Phe Arg Gly 165 170 175 Thr Pro Arg Arg His Leu Leu Thr Thr Gly Trp Ser Ala Phe Val Asn 180 185 190 Gln Lys Lys Leu Val Ala Gly Asp Ser Ile Val Phe Leu Arg Thr Glu 195 200 205 His Gly Glu Leu Cys Val Gly Ile Arg Arg Ala Lys Arg Val Ser Cys 210 215 220 Gly Gly Met Glu Cys Ile Ser Gly Trp Asn Ala Pro Val Tyr Gly Ala 225 230 235 240 Leu Ser Ala Phe Leu Lys Asp Glu Glu Gly Lys Ile Thr Lys Gly Pro 245 250 255 Gly Gly Tyr Met Arg Gly Arg Gly Lys Val Glu Ile Thr Asp Val Val 260 265 270 Glu Ala Ala Ser Leu Ala Ala Ser Gly Gln Pro Phe Glu Val Val Tyr 275 280 285 Tyr Pro Arg Ala Ser Thr Pro Glu Phe Val Val Lys Ala Ala Ser Val 290 295 300 Gln Asn Ala Met Arg Asn Gln Trp Cys Pro Gly Met Arg Phe Lys Met 305 310 315 320 Ala Phe Glu Thr Glu Asp Ser Ser Arg Ile Ser Trp Phe Met Gly Thr 325 330 335 Ile Ala Ser Ala Gln Val Ala Asp Thr Ile Arg Trp Pro Asn Ser Pro 340 345 350 Trp Arg Leu Leu Gln Val Ser Trp Asp Glu Pro Asp Leu Leu Gln Asn 355 360 365 Val Lys Cys Val Asn Pro Trp Leu Val Glu Ile Val Ser Ser Ile Pro 370 375 380 Pro Ile His Leu Gly Thr Phe Ser Pro Pro Arg Lys Lys Leu Arg Val 385 390 395 400 Ala Gln His Pro Asp Phe Pro Phe Glu Gly Gln Leu Leu Asn Pro Ile 405 410 415 Phe His Gly Asn Pro Leu Gly Pro Ser Asn Ser Pro Leu Arg Cys Phe 420 425 430 Ser Asp Ile Ala Pro Ala Gly Ile Gln Gly Ala Arg His Ala Gln Phe 435 440 445 Gly Leu Pro Leu Thr Asp Tyr Gln Leu Asn Gln Leu His Leu Gly Phe 450 455 460 Asn Arg Leu Gly Ala Met Thr Pro Thr Pro Arg Ile Ser Lys Gly Phe 465 470 475 480 Val Ile Ser Ser Ala Pro Ala Ser Glu Ser Val Ser Cys Leu Leu Thr 485 490 495 Ile Gly Thr Pro Gln Ala Thr Glu Lys Ser Asp Asp Ile Lys Arg Pro 500 505 510 His Ile Met Leu Phe Gly Lys Pro Ile Leu Thr Glu Gln Gln Met Asp 515 520 525 Ser Gly Gly Ser Arg Glu Gly Leu Ser Gln Asp Arg Lys Ala Ser Glu 530 535 540 Leu Gly Leu Glu Asp Gly His Cys Lys Val Phe Met Glu Ser Glu Asp 545 550 555 560 Val Gly Arg Thr Ile Asp Leu Ser Val Phe Gly Ser Tyr Glu Glu Leu 565 570 575 Tyr Gly Gln Leu Ala Asp Met Phe Gly Ile Glu Lys Ala Glu Ile Met 580 585 590 Arg His Leu Cys Tyr Arg Asp Ala Ala Gly Ala Val Arg His Thr Gly 595 600 605 Glu Glu Pro Phe Asn Asp Phe Met Lys Val Ala Arg Arg Leu Thr Ile 610 615 620 Ile Glu Gly Thr Glu Gly Arg Pro Gln Lys Pro Leu Val Glu Tyr Met 625 630 635 640 Val Glu Arg Ala <210> 2 <211> 1935 <212> DNA <213> Zea mays L. B73 <400> 2 atgaaggagg cgggcgagga gaggtgcctt gacccgcagc tgtggcacgc gtgcgccggc 60 ggcatggtgc agatgccccc cgtgcgctcc cgtgtctact acttcccgca gggccacgcg 120 gaacacgcgc acggcggcgg cggcgccacg gacctcgccg gggcgcgggc gcgacctctc 180 ccgccgctcg tgctctgcac cgtcgccggg gtgcgcttcc tggccgatcc ggagaccgac 240 gaggtcttcg ccaagatccg cctcgtgccg gccgcgcccg gcgaggtgga gttcggagag 300 ccccgcgagt tcggcatcga ccccgaggac gcccgggaga agctgtcctc cttcgccaag 360 acgctcacgc agtccgacgc caacaacggc ggcggcttct ccgtgccgcg ctactgcgcc 420 gagaccatct tccccaagct cgactaccgg gccgacccgc cggtgcagac ggtgctcgcc 480 aaggacgtgc acggggaggt ctggaagttc cgccacattt tccggggcac gccgcgccgg 540 catttgctca ccacgggatg gagcgcgttc gtcaaccaga agaagctcgt cgccggggac 600 tccatcgtct tcctgcgcac cgagcatggc gagctgtgcg tcgggatacg ccgtgccaag 660 cgggtgtcct gtggtggcat ggagtgcatc tctggctgga acgccccggt gtacggggcc 720 ttgtcggcgt tcttgaagga cgaggaaggt aagatcacta agggtcctgg tgggtacatg 780 agaggcaggg ggaaggtgga gatcacggac gttgttgagg ccgcaagctt agccgcgagc 840 gggcagccat ttgaggtggt gtactacccg agagctagca ctccagagtt tgttgtgaag 900 gctgcatcgg tacagaacgc gatgaggaac cagtggtgcc ctgggatgag gttcaagatg 960 gcatttgaga cagaggattc gtcaaggatc agctggttta tggggacgat agcttctgct 1020 caggttgctg acacaatcag atggccaaat tcaccgtgga ggcttcttca ggtgtcatgg 1080 gatgaaccag acttgctgca gaatgtgaaa tgtgtcaatc catggcttgt ggagattgta 1140 tcaagcattc caccgattca cctagggaca ttttctccac ctagaaagaa gttgcgggtg 1200 gcccaacatc cagactttcc atttgagggt cagctgttga atccaatttt ccatggcaac 1260 ccacttggtc caagcaacag cccacttcgc tgtttctcgg acatcgctcc tgcaggcata 1320 cagggagcca ggcatgctca atttggttta cccctaacag actaccagct taaccagctg 1380 cacctcggtt tcaaccggct tggtgctatg actccgacgc cccgtatatc caagggtttt 1440 gtgatcagca gcgcaccagc cagtgagagt gtctcttgct tgctgacaat cggcacacca 1500 caggccacag agaaatctga tgacataaag agaccccaca taatgctgtt cggaaagcct 1560 atccttactg agcagcagat ggattctgga ggatcgaggg aaggcctatc ccaagaccgc 1620 aaggcttctg agcttgggct agaagacggg cactgcaagg tgtttatgga atcagaggat 1680 gttggccgca ccattgacct atctgtcttt ggttcgtacg aagagctgta cggccagtta 1740 gcggacatgt ttggaattga gaaggcggaa ataatgaggc acctttgcta ccgtgatgct 1800 gctggtgctg tcaggcatac tggtgaagag ccgttcaatg acttcatgaa agtagcacgg 1860 aggctcacca ttatagaggg cacggagggg agaccgcaga aacctctcgt ggaatacatg 1920 gtcgagcggg cttga 1935 <210> 3 <211> 1935 <212> DNA <213> Artificial Sequence <400> 3 atgaaggagg cgggcgagga gaggtgcctt gacccgcagc tgtggcacgc gtgcgccggc 60 ggcatggtgc agatgccccc cgtgcgctcc cgtgtctact acttcccgca gggccacgcg 120 gaacacgcgc acggcggcgg cggcgccacg gacctcgccg gggcgcgggc gcgacctctc 180 ccgccgctcg tgctctgcac cgtcgccggg gtgcgcttcc tggccgatcc ggagaccgac 240 gaggtcttcg ccaagatccg cctcgtgccg gccgcgcccg gcgaggtgga gttcggagag 300 ccccgcgagt tcggcatcga ccccgaggac gcccgggaga agctgtcctc cttcgccaag 360 acgctcacgc agtccgacgc caacaacggc ggcggcttct ccgtgccgcg ctactgcgcc 420 gagaccatct tccccaagct cgactaccgg gccgacccgc cggtgcagac ggtgctcgcc 480 aaggacgtgc acggggaggt ctggaagttc cgccacattt tccggggcac gccgcgccgg 540 catttgctca ccacgggatg gagcgcgttc gtcaaccaga agaagctcgt cgccggggac 600 tccatcgtct tcctgcgcac cgagcatggc gagctgtgcg tcgggatacg ccgtgccaag 660 cgggtgtcct gtggtggcat ggagtgcatc tctggctgga acgccccggt gtacggggcc 720 ttgtcggcgt tcttgaagga cgaggaaggt aagatcacta agggtcctgg tgggtacatg 780 agaggcaggg ggaaggtgga gatcacggac gttgttgagg ccgcaagctt agccgcgagc 840 gggcagccat ttgaggtggt gtactacccg agagctagca ctccagagtt tgttgtgaag 900 gctgcatcgg tacagaacgc gatgaggaac cagtggtgcc ctgggatgag gttcaagatg 960 gcatttgaga cagaggattc gtcaaggatc agctagttta tggggacgat agcttctgct 1020 caggttgctg acacaatcag atggccaaat tcaccgtgga ggcttcttca ggtgtcatgg 1080 gatgaaccag acttgctgca gaatgtgaaa tgtgtcaatc catggcttgt ggagattgta 1140 tcaagcattc caccgattca cctagggaca ttttctccac ctagaaagaa gttgcgggtg 1200 gcccaacatc cagactttcc atttgagggt cagctgttga atccaatttt ccatggcaac 1260 ccacttggtc caagcaacag cccacttcgc tgtttctcgg acatcgctcc tgcaggcata 1320 cagggagcca ggcatgctca atttggttta cccctaacag actaccagct taaccagctg 1380 cacctcggtt tcaaccggct tggtgctatg actccgacgc cccgtatatc caagggtttt 1440 gtgatcagca gcgcaccagc cagtgagagt gtctcttgct tgctgacaat cggcacacca 1500 caggccacag agaaatctga tgacataaag agaccccaca taatgctgtt cggaaagcct 1560 atccttactg agcagcagat ggattctgga ggatcgaggg aaggcctatc ccaagaccgc 1620 aaggcttctg agcttgggct agaagacggg cactgcaagg tgtttatgga atcagaggat 1680 gttggccgca ccattgacct atctgtcttt ggttcgtacg aagagctgta cggccagtta 1740 gcggacatgt ttggaattga gaaggcggaa ataatgaggc acctttgcta ccgtgatgct 1800 gctggtgctg tcaggcatac tggtgaagag ccgttcaatg acttcatgaa agtagcacgg 1860 aggctcacca ttatagaggg cacggagggg agaccgcaga aacctctcgt ggaatacatg 1920 gtcgagcggg cttga 1935 <210> 4 <211> 1935 <212> DNA <213> Artificial Sequence <400> 4 atgaaggagg cgggcgagga gaggtgcctt gacccgcagc tgtggcacgc gtgcgccggc 60 ggcatggtgc agatgccccc cgtgcgctcc cgtgtctact acttcccgca gggccacgcg 120 gaacacgcgc acggcggcgg cggcgccacg gacctcgccg gggcgcgggc gcgacctctc 180 ccgccgctcg tgctctgcac cgtcgccggg gtgcgcttcc tggccgatcc ggagaccgac 240 gaggtcttcg ccaagatccg cctcgtgccg gccgcgcccg gcgaggtgga gttcggagag 300 ccccgcgagt tcggcatcga ccccgaggac gcccgggaga agctgtcctc cttcgccaag 360 acgctcacgc agtccgacgc caacaacggc ggcggcttct ccgtgccgcg ctactgcgcc 420 gagaccatct tccccaagct cgactaccgg gccgacccgc cggtgtagac ggtgctcgcc 480 aaggacgtgc acggggaggt ctggaagttc cgccacattt tccggggcac gccgcgccgg 540 catttgctca ccacgggatg gagcgcgttc gtcaaccaga agaagctcgt cgccggggac 600 tccatcgtct tcctgcgcac cgagcatggc gagctgtgcg tcgggatacg ccgtgccaag 660 cgggtgtcct gtggtggcat ggagtgcatc tctggctgga acgccccggt gtacggggcc 720 ttgtcggcgt tcttgaagga cgaggaaggt aagatcacta agggtcctgg tgggtacatg 780 agaggcaggg ggaaggtgga gatcacggac gttgttgagg ccgcaagctt agccgcgagc 840 gggcagccat ttgaggtggt gtactacccg agagctagca ctccagagtt tgttgtgaag 900 gctgcatcgg tacagaacgc gatgaggaac cagtggtgcc ctgggatgag gttcaagatg 960 gcatttgaga cagaggattc gtcaaggatc agctggttta tggggacgat agcttctgct 1020 caggttgctg acacaatcag atggccaaat tcaccgtgga ggcttcttca ggtgtcatgg 1080 gatgaaccag acttgctgca gaatgtgaaa tgtgtcaatc catggcttgt ggagattgta 1140 tcaagcattc caccgattca cctagggaca ttttctccac ctagaaagaa gttgcgggtg 1200 gcccaacatc cagactttcc atttgagggt cagctgttga atccaatttt ccatggcaac 1260 ccacttggtc caagcaacag cccacttcgc tgtttctcgg acatcgctcc tgcaggcata 1320 cagggagcca ggcatgctca atttggttta cccctaacag actaccagct taaccagctg 1380 cacctcggtt tcaaccggct tggtgctatg actccgacgc cccgtatatc caagggtttt 1440 gtgatcagca gcgcaccagc cagtgagagt gtctcttgct tgctgacaat cggcacacca 1500 caggccacag agaaatctga tgacataaag agaccccaca taatgctgtt cggaaagcct 1560 atccttactg agcagcagat ggattctgga ggatcgaggg aaggcctatc ccaagaccgc 1620 aaggcttctg agcttgggct agaagacggg cactgcaagg tgtttatgga atcagaggat 1680 gttggccgca ccattgacct atctgtcttt ggttcgtacg aagagctgta cggccagtta 1740 gcggacatgt ttggaattga gaaggcggaa ataatgaggc acctttgcta ccgtgatgct 1800 gctggtgctg tcaggcatac tggtgaagag ccgttcaatg acttcatgaa agtagcacgg 1860 aggctcacca ttatagaggg cacggagggg agaccgcaga aacctctcgt ggaatacatg 1920 gtcgagcggg cttga 1935 <210> 5 <211> 1934 <212> DNA <213> Artificial Sequence <400> 5 atgaaggagg cgggcgagga gaggtgcctt gacccgcagc tgtggcacgc gtgcgccggc 60 ggcatggtgc agatgccccc cgtgcgctcc cgtgtctact acttcccgca gggccacgcg 120 gaacacgcgc acggcggcgg cggcgccacg gacctcgccg gggcgcgggc gcgacctctc 180 ccgccgctcg tgctctgcac cgtcgccggg gtgcgcttcc tggccgatcc ggagaccgac 240 gaggtcttcg ccaagatccg cctcgtgccg gccgcgcccg gcgaggtgga gttcggagag 300 ccccgcgagt tcggcatcga ccccgaggac gcccgggaga agctgtcctc cttcgccaag 360 acgctcacgc agtccgacgc caacaacggc ggcggcttct ccgtgccgcg ctactgcgcc 420 gagaccatct tccccaagct cgactaccgg gccgacccgc cggtgcagac ggtgctcgcc 480 aaggactgca cggggaggtc tggaagttcc gccacatttt ccggggcacg ccgcgccggc 540 atttgctcac cacgggatgg agcgcgttcg tcaaccagaa gaagctcgtc gccggggact 600 ccatcgtctt cctgcgcacc gagcatggcg agctgtgcgt cgggatacgc cgtgccaagc 660 gggtgtcctg tggtggcatg gagtgcatct ctggctggaa cgccccggtg tacggggcct 720 tgtcggcgtt cttgaaggac gaggaaggta agatcactaa gggtcctggt gggtacatga 780 gaggcagggg gaaggtggag atcacggacg ttgttgaggc cgcaagctta gccgcgagcg 840 ggcagccatt tgaggtggtg tactacccga gagctagcac tccagagttt gttgtgaagg 900 ctgcatcggt acagaacgcg atgaggaacc agtggtgccc tgggatgagg ttcaagatgg 960 catttgagac agaggattcg tcaaggatca gctggtttat ggggacgata gcttctgctc 1020 aggttgctga cacaatcaga tggccaaatt caccgtggag gcttcttcag gtgtcatggg 1080 atgaaccaga cttgctgcag aatgtgaaat gtgtcaatcc atggcttgtg gagattgtat 1140 caagcattcc accgattcac ctagggacat tttctccacc tagaaagaag ttgcgggtgg 1200 cccaacatcc agactttcca tttgagggtc agctgttgaa tccaattttc catggcaacc 1260 cacttggtcc aagcaacagc ccacttcgct gtttctcgga catcgctcct gcaggcatac 1320 agggagccag gcatgctcaa tttggtttac ccctaacaga ctaccagctt aaccagctgc 1380 acctcggttt caaccggctt ggtgctatga ctccgacgcc ccgtatatcc aagggttttg 1440 tgatcagcag cgcaccagcc agtgagagtg tctcttgctt gctgacaatc ggcacaccac 1500 aggccacaga gaaatctgat gacataaaga gaccccacat aatgctgttc ggaaagccta 1560 tccttactga gcagcagatg gattctggag gatcgaggga aggcctatcc caagaccgca 1620 aggcttctga gcttgggcta gaagacgggc actgcaaggt gtttatggaa tcagaggatg 1680 ttggccgcac cattgaccta tctgtctttg gttcgtacga agagctgtac ggccagttag 1740 cggacatgtt tggaattgag aaggcggaaa taatgaggca cctttgctac cgtgatgctg 1800 ctggtgctgt caggcatact ggtgaagagc cgttcaatga cttcatgaaa gtagcacgga 1860 ggctcaccat tatagagggc acggagggga gaccgcagaa acctctcgtg gaatacatgg 1920 tcgagcgggc ttga 1934 <210> 6 <211> 1933 <212> DNA <213> Artificial Sequence <400> 6 atgaaggagg cgggcgagga gaggtgcctt gacccgcagc tgtggcacgc gtgcgccggc 60 ggcatggtgc agatgccccc cgtgcgctcc cgtgtctact acttcccgca gggccacgcg 120 gaacacgcgc acggcggcgg cggcgccacg gacctcgccg gggcgcgggc gcgacctctc 180 ccgccgctcg tgctctgcac cgtcgccggg gtgcgcttcc tggccgatcc ggagaccgac 240 gaggtcttcg ccaagatccg cctcgtgccg gccgcgcccg gcgaggtgga gttcggagag 300 ccccgcgagt tcggcatcga ccccgaggac gcccgggaga agctgtcctc cttcgccaag 360 acgctcacgc agtccgacgc caacaacggc ggcggcttct ccgtgccgcg ctactgcgcc 420 gagaccatct tccccaagct cgactaccgg gccgacccgc cggtgcagac ggtgctcgcc 480 aaggatgcac ggggaggtct ggaagttccg ccacattttc cggggcacgc cgcgccggca 540 tttgctcacc acgggatgga gcgcgttcgt caaccagaag aagctcgtcg ccggggactc 600 catcgtcttc ctgcgcaccg agcatggcga gctgtgcgtc gggatacgcc gtgccaagcg 660 ggtgtcctgt ggtggcatgg agtgcatctc tggctgggaac gccccggtgt acggggcctt 720 gtcggcgttc ttgaagggacg aggaaggtaa gatcactaag ggtcctggtg ggtacatgag 780 aggcagggg aaggtggaga tcacggacgt tgttgaggcc gcaagcttag ccgcgagcgg 840 gcagccattt gaggtggtgt actacccgag agctagcact ccagagtttg ttgtgaaggc 900 tgcatcggta cagaacgga tgaggaacca gtggtgccct gggatgaggt tcaagatggc 960 atttgagaca gaggattcgt caaggatcag ctggtttatg gggacgatag cttctgctca 1020 ggttgctgac aaatcagat ggccaaattc accgtggagg cttcttcagg tgtcatggga 1080 tgaaccagac ttgctgcaga atgtgaaatg tgtcaatcca tggcttgtgg agattgttatc 1140 aagcattcca ccgattcacc tagggacatt ttctccacct agaaagagt tgcgggtggc 1200 ccaacatcca gactttccat ttgagggtca gctgttgaat ccaattttcc atggcaaccc 1260 acttggtcca agcaacagcc cacttcgctg tttctcggac atcgctcctg caggcataca 1320 gggagccagg catgctcaat ttggtttacc cctaacagac taccagctta accagctgca 1380 cctcggttc aaccggcttg gtgctatgac tccgacgccc cgtatatcca agggttttgt 1440 gatcagcagc gcaccagcca gtgagagtgt ctcttgcttg ctgacaatcg gcacaccaca 1500 ggccacagag aaatctgatg acataaagag accccacata atgctgttcg gaaagcctat 1560 ccttactgag cagcagatgg attctggagg atcgagggaa ggcctatccc aagaccgcaa 1620 ggcttctgag cttgggctag aagacgggca ctgcaaggtg tttatggaat cagaggatgt 1680 tggccgcacc attgacctat ctgtctttgg ttcgtacgaa gagctgtacg gccagttagc 1740 ggacatgttt ggaattgaga aggcggaaat aatgaggcac ctttgctacc gtgatgctgc 1800 tggtgctgtc aggcatactg gtgaagagcc gttcaatgac ttcatgaaag tagcacggag 1860 gctcaccatt atagagggca cggaggggag accgcagaaa cctctcgtgg aatacatggt 1920 cgagcgggct is 1933 <210> 7 <211> 2076 <212> DNA <213> Zea mays L. <400> 7 atgaaggagg tggccgagga aaggtgcctt gacccgcagc tgtggcacgc gtgcgctggc 60 ggcatggtgc agatgccgcc cgtgcgctcc cgtgtctact acttcccgca gggtcacgcg 120 gagcacgcgc atggcggcgg ggcgcggac ctcgccgggg cgcgagcgct cccgtcgctc 180 gtgctctgca gcgtcaccgg ggtgcgcttc ctggccgatc cggagaccga cgaggtcttc 240 gccaagatcc gcctggtgcc ggtcgcgccc ggcgaggtgg agttccgaga gcccgatgag 300 ttcagcgtcg accccgcgga cgcccgggag aagctttctt cttcgccaa gacgctgacg 360 cagtccgacg ccaacaacgg tggcggcttc tcggtgccgc gctactgcgc cgagaccatc 420 ttccccaagc tcgactaccg ggccgaccg ccggtgcaga cggtgcttgc caaggacgtg 480 cacggggagg tctggaagtt ccgccacatt taccggggca cgccgcgccg gcatttgctc 540 accacgggat ggagcacgt cgtcaaccag aagaagctcg tcgccgggga ctccatcgtc 600 ttcctgcgca ctgagcatgg cgagctgtgc gtcgggatac ggcgtgtcaa gcgggtgtcc 660 tgtggtggca tggagtgcat gtctgggtgg aacgccccgg ggtatggggc cttgtcggca 720 ttcttgaagg atgaggaggg taagatgatg aagagtcatg gtgggtacat gagaggtagg 780 gggaaggtga agatcacgga tgttgtcaac gccgcaagtc tagcagcgag cggacaacca 840 tttgaagttg tgtactaccc gagagctagc acaccggagt ttgttgtgaa ggctgcatcg 900 gtacagaacg cgatgaggaa ccagtggtgc ccggggatga ggttcaagat ggcatttgag 960 acagaggatt cgtcaaggat cagttggttt atggggacga tagcttctgc tcaggttgct 1020 gacccaatca gatggccaaa ttcaccgtgg aggcttcttc aggttttgct tgatcacatg 1080 tttccaatac ttgtggcatg ggatgaaccg gacttgctgc agaacgtgaa atgtgtgaac 1140 ccatggctcg tggagatcgt atcaagcatt ccaccgatcc acctgggacc attttctcca 1200 cctaggaaga agctgcgggt gccccaccat ccggacttcc cgttcgacgg ccagctgttg 1260 aatccgattt tccacggcaa cccactcggt ccgagcaacg gcggcggtgc tcttcgctgt 1320 ttctcggaca tcgctcctgc aggcatacag ggagccaggc atgctcagtt cggtctacca 1380 ctaacagacc gccagcttaa caagctgcac ctcggtctgt tccaaggcgg cggttttaag cggcggcttg acgctatcac tccaccatgc cctatatcca ggggctttgt gatcggcagt gcaccggtcg acgagagcgt ctcttgcgtg ctgacgatcg gcacgccacg ggccgcagag 1560 agatctgacg acaggaaga accacatcta atgctgttcg gaaagcctat ccttaccgag cagcagatga gctctagagg gtcaaggga acactctccc ctgaggccac tgggaacagt tccgatggca gtgttcagaa aacgggaaac gtatccgatg gctccggctc gtcgatctgc atcggttcct cgtcccgagg ccgcgaggct tctaggctcg ggttcgaatt tgaagccgggg cactgcaagg tatttgtgga gtcggaggat gtcggtcgca cactcgacct gtccgtcttt ggctcgtacg aagagctgta cggtcagttg gccgacatgt ttggaatcga gaaggcagag gtaatgagcc acctttgtta ccgtgatgct gctggcgctg tcaagcgtac tggcgacgag ccgttctgtg acttcatgaa agtggcacgg aggctcacca tagtag caccgagggg aggctgcaga aacctctcgt cgagtacatg gcttga <210> 8 <211> 2151 <212> DNA <213> Zea mays L. <400> 8 atggagcggg agcgggagag tgacaggtgc ctggacccgc agctgtggca cgcctgcgcc 60 ggcgggatgg tccagatgcc ggcggtgcac tccaaggtgt actacttccc gcagggccac 120 gcggagcacg cgcagggccc cgtggacctc cccgccggcc gggtcccgc gctcgtcctc 180 tgccgcgtcg ccgccgtccg cttcatggcc gatccggaca ccgacgaggt cttcgccaag 240 atccgcctgg ccccggtccg tcccaacgag ccgggctacg ccgacgacgc cattggcgcc 300 gcggcggcgt cgggcgcgca ggaggacaag cccgcgtcct tcgccaagac gctcacgcag 360 tccgacgcca acaacggcgg gggcttctc gtgccgcgct actgcgccga gaccatctttc 420 ccgcggctcg actactcggc cgaccccccc gtgcagaccg tgctcgccaa ggacgtgcac 480 ggcgtggtct ggaagttccg ccacatctac cgcggcacgc cccggcgcca cctgctcacc 540 accggctgga gcaccttcgt gaaccagaag aagctcgtcg cgggggactc catcgtgttc 600 atgcggacgg agaacgggga cctctgcgtc ggcatccggc gcgccaagaa gggcggcatc 660 ggagggccgg agttcatgca ccaccaccac cagcagccgc ccccgccgca gggcggcggg 720 tacgccgggt tctccatgtt cctgcgaggg gaagaggacg gcggcaagat gatggccgcg 780 gccgccacga gggggaaggc cgccagggtg cgggtgcggc cagaggaggt cgtcgaggcc 840 gctaacctgg ccgtgagcgg gcagccgttc gaggtggtgt actacccgag ggcgagcacg 900 ccagagttct gcgtcaaggc gggggcggtg cgcgccgcca tgcgcaccca gtggtgcccc 960 gggatgaggt tcaagatggc cttcgagacg gaggactcgt cccggatcag ctggttcatg 1020 ggcactgtct ccgccgtgca cgtcgctgac cccatccgat ggcccaattc accctggagg 1080 cttctccagg tcgcctggga tgagccggac ctgttacaga acgtgaagag ggtgagccca 1140 tggctggttg agctggtgtc gaacatgccg gtcatccatc acctcacagc cacgcccttc 1200 tcgccgccca ggaagaagct gtgcgtccca ctgtacccgg agcttccgct ggagggccag 1260 ttcccggcgc cgatgttcca cggaagcccc ctcctcggcc gtggcggcgc cggtggcccg 1320 atgtgctact tcccggacgg cactcctgca ggcatacagg gagccaggca tgctcaattc 1380 ggcatatcct tatcagatct ccacctgaac aagctgcagc cggggcctgtc accgcacggg 1440 ctccaccgcc agctcgacca cggcgtgcag gtgcaggtgc agcagccgag gatcgccgcc 1500. gggctcatcg tcggcggcca cccggcggcc cgagacgacg tctcgtgtct gctcaccatc 1560 ggcaccccaa agagcaaga gccaccgtca gacgtcaaga aggcgtccac ggcggcggca ccgcagctga tgctcttcgg gaaagcgatc ctcaccgagc agcagatatc gctaggcggc 1680. ggcaatgtcg tgccggcgct ggcgaagaag agcccctccg acgacgacga cgacgtggcc 1740. gagaggacgg tgagcaactc ggacgtgtcg agccctggga ggagcaacca ggacggcacg tccagtggcg gaggcccggc ggcgcgggcg tgctggcagg aggaggagtg caacaacagg gcggcaggtt ctgaggacga cctcctcggg cactgcaagg tgttcatgca gtcggaggac 1920 gtcgggcgca cgctggacct ctccgccgtc gcgtcgtacg aggagctcta ccagaggctc 1980 gccgacatgt tcggcgtcga caaggccgag ctgaccagcc acgtgttcta ccgcgacgac gcttccggag cgctcaagca ccctggcgac gagcctttca gtgagttcac caagaccgcc cggaggctga ccatactgac ggacgagagc agcgacagct tagcgaggta g 2151 <210> 9 <211> 2103 <212> DNA <213> Zea mays L. <400> 9 atgattactt tcgtggactc ggcggccatg gagctggaga gggagagcgg caggtgcctg 60 gtggacccgc agctgtggca cgcctgcgcc ggcggcatgg tccagatgcc gccggtgcac 120 tccagggtgt actacttccc gcagggccac gccgagcacg cgcagggcca cgcccacgcc 180 gacctccccg ccggccgggt cccggccctc gtcctctgcc gcgtcgacgc cgtccggttc 240 ctggccgatc cggacaccga cgaggtgctc gccagggtcc gcctcgcccc cgtccggccc 300 aacgagccgg accacgccga cgccgcggcg ccgggcgcgc gggaggacaa gcccgcgtcc 360 ttcgccaaga cgctcacgca gtccgacgcc aacaacggcg ggggcttctc cgtgccgcgg 420 tactgcgccg agaccatctt cccgcggctg gactactccg ccgacccgcc cgtccagacc 480 gtgctcgcca aggacgtgca cggcgtcgtc tggaagttcc gccacatcta ccgcggcacg 540 ccccggcgcc acctgctcac caccgggtgg agcgccttcg tgaaccagaa gaggctcgtc 600 gcggggact ccatcgtgtt catgaggacg gggaacgggg acctctgcgt cggcatccgg 660 cgcgccaaaa agggcggcat cggaggggg ccggagttcc cgcaccacca gccgccagac 720 ggcggcgggt acgggtacgg gtacgccggc ttctccacgt tcctgagagg agaagaggac 780 gacgcggccg cgaggggcaa ggtcagggtg ctggtgcggc cggaggggt cgtcgaggcc 840 gccaacctcg cggcgagcgg gcagccgttc gaggtggtct actacccgag ggcgagcacg 900 ccggagttct gcgtcaaggc gggggcggtc cgcgcggcca tgcgcaccca gtggtgcgcc 960 gggatgaggt tcaagatggc cttcgagacg gaggactcgt ccaggatcag ctggttcatg 1020 ggcactgtcg ccgccgtgca ggtcgctgac cccatccgat ggcccaattc accctggagg 1080 cttcttcagg tcgcttggga tgaaccggac ttgttacaga acgtgaagag agtgagccca 1140 tggctggtcg agcttgtctc aagcacgccg gccatccacc acctcacgcc gttctcgccg 1200 ccaagcagga agaagctgtg tatcccattg tacccggagg gccaccagct cccggcgccg 1260 atgttccacg gaagccctct ggtgggccgt ggtgttggcc cgatgcgcta cttccccggac 1320 ggcggcactc ctcctgcagg catacaggga gccaggcatg cgcaattcgg catatcttta 1380 ccagatctcc accacctcac caggctgcag tcgagtctat cgccgcacgc gcacgggctt 1440 cgccaccagc tcgaccacgg cgcgcggccg aggatcgccg gcggcctcat cgtcggccac 1500 ccggcagctc gggacgacat ctcgtgcttg ctcaccattg gcaccgcccc gcacaagaaa 1560 ccatcagacg tcaagtcggc cgcggcggcg ccggcgccgc agctgatgct gtttgggaaa 1620 ccgattctca ccgagcagca gatatctcta ggctttcggc cgctgccggc gccgaagaag 1680 agcccgtccg acgacgctgc tgagactgag aggacggtga gcaacaactc ggatgcctcg 1740 agcccagctg ggactgcgag tgggagcacg ccgtccatca gtggaggcgc cccgtcgtcg 1800 tgccaggaca acaaggcggc ggcgacggcg acggcgactg atgacgacga tctcctcggg 1860 cactgcaagg tgttcatgca gtcggaggac gtcgggcgca cgctcgacct ctcggctgtc 1920 gcgtcgtacg aggagctcta ccagaggctg gccgacatgt tcggcgtcga cagggccgag 1980 ctgacgagcc atgtcttcta ccgcgacggc gcttctggag cgctcaagca cgccggcgac 2040 gagcctttca gtgagttcac caagaccgct cggaggctga ccatacaaac ggacgcgagg 2100 tag 2103 <210> 10 <211> 638 <212> DNA <213> Artificial Sequence <400> 10 aagggtcctg gtgggtacat gagaggcagg gggaaggtgg agatcacgga cgttgttgag 60 gccgcaagct tagccgcgag cgggcagcca tttgaggtgg tgtactaccc gagagctagc 120 actccagagt ttgttgtgaa ggctgcatcg gtacagaacg cgatgaggaa ccagtggtgc 180 cctgggatga ggttcaagat ggcatttgag acagaggatt cgtcaaggat cagctggttt 240 atggggacga tagcttctgc tcaggttgct gacacaatca gatggccaaa ttcaccgtgg 300 aggcttcttc aggttttgct tcatcccatg tttcccatac ctatatgcca tacttcatta 360 tgaactgatg attgctactt ttaacttccc gtttggggtt aataattaat aggtgttagt 420 gtttctggta cccataaaat gcttaatgcc ctgtgaaatt aactgctgtt atggaactgt 480 tggttcaatg ttaatatgga acatgcagcg aaatggcctc tagccgagtt ggttaggtgg 540 tctgagtatc actcctcaag tcctggtttt gactctctgt gggagcgaat ctcaggctgt 600 ggttaaaaaa attccctcgt cagtcccacg ctaaagca 638 <210> 11 <211> 657 <212> DNA <213> Artificial Sequence <400> 11 cgctcccgtg tctactactt cccgcagggc cacgcggaac acgcgcacgg cggcggcggc 60 gccacggacc tcgccggggc gcgggcgcga cctctcccgc cgctcgtgct ctgcaccgtc 120 gccggggtgc gcttcctggc cgatccggag accgacgagg tcttcgccaa gatccgcctc 180 gtgccggccg cgcccggcga ggtggagttc ggagagcccc gcgagttcgg catcgacccc 240 gaggacgccc gggagaagct gtcctccttc gccaagacgc tcacgcagtc cgacgccaac 300 aacggcggcg gcttctccgt gccgcgctac tgcgccgaga ccatcttccc caagctcgac 360 taccgggccg acccgccggt gcagacggtg ctcgccaagg acgtgcacgg ggaggtctgg 420 aagttccgcc acattttccg gggcacgccg cgccggcatt tgctcaccac gggatggagc 480 gcgttcgtca accagaagaa gctcgtcgcc ggggactcca tcgtcttcct gcgcaccgag 540 catggcgagc tgtgcgtcgg gatacgccgt gccaagcggg tgtcctgtgg tggcatggag 600 tgcatctctg gctggaacgc cccggtgtac ggggccttgt cggcgttctt gaaggac 657 <210> 12 <211> 1798 <212> DNA <213> Artificial Sequence <400> 12 60. tacattccta ctccgctttg cccggtgcca gagcgtttct cccggagtag cggttgcgcc gcctcatgat ctgccaattg gaacccctgg gcgtgcgcag aggaggtatc gctcgctcct 120 gctgtctgtg tccgtttcgt ttcaatcgcg tgcttttcgt tcagttccgt tttgtggggg 180 ttgcgtgggg tggtttagta cttgggttcg cgcaataac gggagacgtt gcaggttgct 240 ctgcagctgg acagtgatcg cgtttggtgg gtgtggcggc ggtggagga gacgacacga cgaagacgag gaggtcagga ggccatgaag gaggcggggcg aggagaggtg ccttgacccg 360 cagctgtggc acgcgtgcgc cggcggcatg gtgcagatgc cccccgtgcg ctcccgtgtc 420 tactacttcc cgcagggcca cgcggaacac gcgcacggcg gcggcggcgc cacggacctc 480 gccggggcgc gggcgcgacc tctcccgccg ctcgtgctct gcaccgtcgc cggggtgcgc 540 ttcctggccg atccggagac cgacgaggtc ttcgccaaga tccgcctcgt gccggccgcg 600 cccggcgagg tggagttcgg agagccccgc gagttcggca tcgaccccga ggacgcccgg 660 gagaagctgt cctccttcgc caagacgctc acgcagtccg acgccaacaa cggcggcggc 720 ttctccgtgc cgcgctactg cgccgagacc atcttcccca agctcgacta ccgggccgac 780 ccgccggtgc agacggtgct cgccaaggac gtgcacgggg aggtctggaa gttccgccac 840 attttccggg gcacgccgcg ccggcatttg ctcaccacgg gatggagcgc gttcgtcaac 900 cagaagaagc tcgtcgccgg ggactccatc gtcttcctgc gcaccgagca tggcgagctg 960 tgcgtcggga tacgccgtgc caagcgggtg tcctgtggtg gcatggagtg catctctggc 1020 tggaacgccc cggtgtacgg ggccttgtcg gcgttcttga aggacgagga aggtaagatc 1080 actaagggtc ctggtgggta catgagaggc agggggaagg tggagatcac ggacgttgtt 1140 gaggccgcaa gcttagccgc gagcgggcag ccatttgagg tggtgtacta cccgagagct 1200 agcactccag agtttgttgt gaaggctgca tcggtacaga acgcgatgag gaaccagtgg 1260 tgccctggga tgaggttcaa gatggcattt gagacagagg attcgtcaag gatcagctgg 1320 tttatgggga cgatagcttc tgctcaggtt gctgacacaa tcagatggcc aaattcaccg 1380 tggaggcttc ttcaggtttt gcttcatccc atgtttccca tacctatatg ccatacttca 1440 ttatgaactg atgattgcta cttttaactt cccgtttggg gttaataatt aataggtgtt 1500 agtgtttctg gtacccataa aatgcttaat gccctgtgaa attaactgct gttatggaac 1560 tgttggttca atgttaatat ggaacatgca gcgaaatggc ctctagccga gttggttagg 1620 tggtctgagt atcactcctc aagtcctggt tttgactctc tgtgggagcg aatctcaggc 1680 tgtggttaaa aaaattccct cgtcagtccc acgctaaagc acaggtctaa ctctaaggcc 1740 cggtcgcggt ggtttctcac atgggctacg gtgccactgt gtatgagggt agggcagg 1798 <210> 13 <211> 1349 <212> DNA <213> Artificial Sequence <400> 13 acgacgaaga ggaggaggag taggccatga aggaggtggc cgaggaaagg tgccttgacc 60 cgcagctgtg gcacgcgtgc gctggcggca tggtgcagat gccgcccgtg cgctcccgtg 120 tctactactt cccgcagggt cacgcggagc acgcgcatgg cggcggggcc gcggacctcg 180 ccggggcgcg agcgctcccg tcgctcgtgc tctgcagcgt caccggggtg cgcttcctgg 240 ccgatccgga gaccgacgag gtcttcgcca agatccgcct ggtgccggtc gcgcccggcg 300 aggtggagtt ccgagagccc gatgagttca gcgtcgaccc cgcggacgcc cgggagaagc 360 tttcttcctt cgccaagacg ctgacgcagt ccgacgccaa caacggtggc ggcttctcgg 420 tgccgcgcta ctgcgccgag accatcttcc ccaagctcga ctaccgggcc gacccgccgg 480 tgcagacggt gcttgccaag gacgtgcacg gggaggtctg gaagttccgc cacatttacc 540 ggggcacgcc gcgccggcat ttgctcacca cgggatggag cacgttcgtc aaccagaaga 600 agctcgtcgc cggggactcc atcgtcttcc tgcgcactga gcatggcgag ctgtgcgtcg 660 ggatacggcg tgtcaagcgg gtgtcctgtg gtggcatgga gtgcatgtct gggtggaacg 720 ccccggggta tggggccttg tcggcattct tgaaggatga ggagggtaag atgatgaaga 780 gtcatggtgg gtacatgaga ggtaggggga aggtgaagat cacggatgtt gtcaacgccg 840 caagtctagc agcgagcgga caaccatttg aagttgtgta ctacccgaga gctagcacac 900 cggagtttgt tgtgaaggct gcatcggtac agaacgcgat gaggaaccag tggtgcccgg 960 ggatgaggtt caagatggca tttgagacag aggattcgtc aaggatcagt tggtttatgg 1020 ggacgatagc ttctgctcag gttgctgacc caatcagatg gccaaattca ccgtggaggc 1080 ttcttcaggt tttgcttgat cacatgtttc caatacttgt atgcaatact gcattgtgag 1140 ctgatgcgtg ttatttttaa cttacttctg tcgaagtgtt attttttagc ttacctatgg 1200 tatctcccat tccatctccc atttcaaact tacctttgtg aacaatgcgg tctatagtgc 1260 aaaaacggtg ttttgtacag cttttgggtg aactggctag cgcggacaac acatagtgta 1320 tagtgctcaa ctgtttgtag cccacctga 1349 <210> 14 <211> 1987 <212> DNA <213> Artificial Sequence <400> 14 ccccttgctt tcttctcacc ccccctcccg ctgcttcttt tcccccagcc tttttcttca 60 gcggtaggct ctgatcatga tggtggtggt gatggcggct gtccagcgga aaggcttctt 120 ctcgtgctag tggaggaggc gtgaaatttc atccataaag gctgtcgcgg tgggtggaga 180 tcttgcccaa ttccgctgaa atcgcctccg gctacgggtt gggtcgggtc gggtagcgtg 240 gccgtgggcg gtgggagatg attactttcg tggactcggc ggccatggag cgggagcggg 300 agagtgacag gtgcctggac ccgcagctgt ggcacgcctg cgccggcggg atggtccaga 360 tgccggcggt gcactccaag gtgtactact tcccgcaggg ccacgcggag cacgcgcagg 420 gccccgtgga cctccccgcc ggccgggtcc ccgcgctcgt cctctgccgc gtcgccgccg 480 tccgcttcat ggccgatccg gacaccgacg aggtcttcgc caagatccgc ctggccccgg 540 tccgtcccaa cgagccgggc tacgccgacg acgccattgg cgccgcggcg gcgtcgggcg 600 cgcaggagga caagcccgcg tccttcgcca agacgctcac gcagtccgac gccaacaacg 660 gcgggggctt ctccgtgccg cgctactgcg ccgagaccat cttcccgcgg ctcgactact 720 cggccgaccc ccccgtgcag accgtgctcg ccaaggacgt gcacggcgtg gtctggagagt 780 tccgccacat ctaccgcggc acgccccggc gccacctgct caccaccggc tggagcacct 840 tcgtgaacca gaagaagctc gtcgcggggg actccatcgt gttcatgcgg acggagaacg 900 gggacctctg cgtcggcatc cggcgcgcca agaagggcgg catcggaggg ccggagttca 960 tgcaccacca ccaccagcag ccgcccccgc cgcagggcgg cgggtacgcc gggttctcca 1020 tgttcctgcg agggaagag gacggcggca agatgatggc cgcggccgcc acgaggggga 1080 aggccgccag ggtgcgggtg cggccagagg aggtcgtcga ggccgctaac ctggccgtga 1140 gcgggcagcc gttcgaggtg gtgtactacc cgagggcgag cacgccagag ttctgcgtca 1200 aggcggggc ggtgcgcgcc gccatgcgca cccagtggtg ccccgggatg aggttcaaga 1260 1320 tgcacgtcgc tgaccccatc cgatggccca attcaccctg gaggcttctc caggtaaacg 1380 aaccaagctc cataactatc aaagttgatg atttgcttgc ggcaatgcat gctgatgatt 1440 tgtgtgtgtg ccggggacag gtcgcctggg atgagccgga cctgttacag aacgtgaaga 1500 gggtgagccc atggctggtt gagctggtgt cgaacatgcc ggtcatccat cacctcacag 1560 ccacgccctt ctcgccgccc aggaagaagc tgtgcgtccc actgtacccg gagcttccgc 1620 tggagggcca gttcccggcg ccgatgttcc acggaagccc cctcctcggc cgtggcggcg 1680 ccggtggccc gatgtgctac ttcccggacg gcactcctgc aggcatacag ggagccaggc 1740 atgctcaatt cggcatatcc ttatcagatc tccacctgaa caagctgcag ccgggcctgt 1800 caccgcacgg gctccaccgc cagctcgacc acggcgtgca ggtgcaggtg cagcagccga 1860 ggatcgccgc cgggctcatc gtcggcggcc acccggcggc ccgagacgac gtctcgtgtc 1920 tgctcaccat cggcacccca aagagcaaga agccaccgtc agacgtcaag aaggcgtcca 1980 cggcggc 1987 <210> 15 <211> 1599 <212> DNA <213> Artificial Sequence <400> 15 cccgaatccg tcgttacccc tgctttggag ggatctgaag gtgctggtgg cctgctgctg 60 cctgcctgtc tgccaggagc ccagaggcca gaggtgagtg actggcccga tgaattccgc aatcttgtgg agctgtggtg ctggcgtggc gctgccgtgc tgctgggttg gttgggttcc 180 ctttccctcc ctgcaaaatt ttctgaggcg gagaaaaag taatatctcc attgcttccc cctgcttcct tttttcagca gagactgtgg tggtggtgat ggcggctgtg cagcggaag gcttctcgtc gtggtactag tggaggaggc gtgaaatttc atccataaag gctgtcgcgg 360 tggccggtgg gtggagatcg cgctcaattc ccgccgaaac cgcctccggg gtagcgtggc 420 cgcgggaagt gggagtggga gatgattact ttcgtggact cggcggccat ggagctggag 480 agggagagcg gcaggtgcct ggtggacccg cagctgtggc acgcctgcgc cggcggcatg 540 gtccagatgc cgccggtgca ctccagggtg tactacttcc cgcagggcca cgccgagcac 600 gcgcagggcc acgcccacgc cgacctcccc gccggccggg tcccggccct cgtcctctgc 660 720. cgcgtcgacg ccgtccggtt cctggccgat ccggacaccg acgaggtgct cgccagggtc cgcctcgccc ccgtccggcc caacgagccg gaccacgccg acgccgcggc gccggggcgcg 780 cgggaggaca agcccgcgtc cttcgccaag acgctcacgc agtccgacgc caacaacggc 840 gggggcttct ccgtgccgcg gtactgcgcc gagaccatct tcccgcggct ggactactcc 900 gccgacccgc ccgtccagac cgtgctcgcc aaggacgtgc acggcgtcgt ctggaagttc 960 cgccacatct accgcggcac gccccggcgc cacctgctca ccaccgggtg gagcgccttc 1020 gtgaaccaga agaggctcgt cgcgggggac tccatcgtgt tcatgaggac ggggaacggg 1080 gacctctgcg tcggcatccg gcgcgccaaa aagggcggca tcggaggagg gccggagttc 1140 ccgcaccacc agccgccaga cggcggcggg tacgggtacg ggtacgccgg cttctccacg 1200 ttcctgagag gagaagagga cgacgcggcc gcgaggggca aggtcagggt gctggtgcgg 1260 ccggaggagg tcgtcgaggc cgccaacctc gcggcgagcg ggcagccgtt cgaggtggtc 1320 tactacccga gggcgagcac gccggagttc tgcgtcaagg cgggggcggt ccgcgcggcc 1380 atgcgcaccc agtggtgcgc cgggatgagg ttcaagatgg ccttcgagac ggaggactcg 1440 tccaggatca gctggttcat gggcactgtc gccgccgtgc aggtcgctga ccccatccga 1500 tggcccaatt caccctggag gcttcttcag gtagatgaaa ccaacctcca taactgtccg 1560 tccatgcgta ctctcatctc aaggacggca tctcaaagc 1599

Claims

1. A method for improving and creating flint-grain corn germplasm resources, comprising the following steps: causing the coding gene of ARF transcription factor ZmARF17 in the corn genome to lose its function or down-regulate its expression, resulting in the transformation of dent corn to flint-grain corn, or enhancing the flint phenotype, wherein the amino acid sequence of the ARF transcription factor ZmARF17 is SEQ ID NO: 1, and the NCBI accession number is Zm00001d014013.

2. The method according to claim 1, characterized in that The nucleotide sequence of the gene encoding the ARF transcription factor ZmARF17 is SEQ ID NO:

2.

3. The method according to claim 1 or 2, characterized in that Implemented by: (1) Knock out the gene encoding the ARF transcription factor in the maize genome; (2) Down-regulating the expression level of genes encoding ARF transcription factors in the maize genome; (3) Replace the ARF transcription factor encoding gene in the maize genome with a gene mutant encoding a loss-of-function or downregulated ARF transcription factor; or (4) causing the ARF transcription factor encoding gene and its three homologous genes to mutate simultaneously, so that their mutants lead to inactivation of the original function or down-regulation of expression, wherein the three homologous genes are respectively ZmArf2 , nucleotides of SEQ ID NO: 8 ZmArf19 and nucleotide sequence of SEQ ID NO: 9 ZmArf21 .

4. The method according to claim 3, characterized in that Method (2) is selected from the following group: (2-1) Mutation of the promoter region of the gene encoding the ARF transcription factor leads to downregulation of the expression level of the gene encoding the ARF transcription factor; (2-2) mutation of the upstream regulatory factor of the gene encoding the ARF transcription factor leads to downregulation of the expression level of the gene encoding the ARF transcription factor; or (2-3) An ARF transcription factor interacting protein is introduced into maize to change the function of the ARF transcription factor encoding gene. The ARF transcription factor interacting protein is the transcription factor MYB40, Zm00001d040621, which regulates maize flavonoid metabolism.

5. The method according to claim 3, characterized in that The gene encoding the ARF transcription factor is SEQ ID NO:

2. The mutant of the ARF transcription factor gene in method (3) and method (4) is selected from the following group: The nucleotide sequence SEQ ID NO: 3, represented as fln1-m1, is mutated in the manner that the mutation from G to A at position 995 in SEQ ID NO: 2 results in Trp 332 becomes a stop codon; The nucleotide sequence SEQ ID NO: 4 is represented as fln1-m2, and the mutation is a C to T mutation at position 466 in SEQ ID NO: 2, resulting in Gln 156 becomes a stop codon; The nucleotide SEQ ID NO: 5, represented as fln1-m3, is mutated in such a way that the 487th base G in SEQ ID NO: 2 is deleted, resulting in premature termination; The nucleotide SEQ ID NO: 6 is represented as fln1-m4, and its mutation is that the two bases CG at positions 486 and 487 in SEQ ID NO: 2 are deleted, resulting in premature termination.

6. The method according to claim 3, characterized in that In method (4), the mutants of the three homologous genes are selected from the following group: arf2 cr , the mutation is that the 478th base G in SEQ ID NO: 7 is deleted, resulting in premature termination of translation; arf19 cr , the mutation is that the 475th base G in SEQ ID NO: 8 is deleted, resulting in premature termination of translation; arf21 cr The mutation is that the 496th base G in SEQ ID NO: 9 is deleted, resulting in premature termination of translation.

Images