Electrostatic Nanoparticles and Their Applications

Abstract

This invention relates to a method for generating nanoparticles, the method comprising (c) contacting an antibody with a composition comprising a first conjugate (A), the first conjugate comprising a positively charged polypeptide conjugated to a bifunctional linker, characterized in that the composition is substantially free of unconjugated bifunctional linkers, thereby obtaining a second conjugate (B), the second conjugate comprising a positively charged polypeptide, the bifunctional linker, and the antibody; and (d) contacting the second conjugate (B), the positively charged polypeptide, and a negatively charged molecule to form nanoparticles. The invention also relates to nanoparticles obtainable by the method of the invention, and to nanoparticles comprising (a) a positively charged polypeptide; (b) a second conjugate (B) comprising an antibody conjugated to the positively charged polypeptide; and (c) one or more negatively charged molecules. The invention further relates to compositions comprising the nanoparticles of the invention, and to nanoparticles or compositions of the invention for therapeutic use.

Description

[0001] Cross-references to related applications

[0002] This application claims the benefit of priority to Luxembourg Patent Application No. 102272, filed on December 2, 2020; European Patent Application No. 21175260.5, filed on May 21, 2021; and European Patent Application No. 21205482.9, filed on October 29, 2021, the contents of which are incorporated herein by reference in their entirety for all purposes. Technical Field

[0003] This invention relates to a method for producing nanoparticles, the method comprising (c) contacting an antibody with a composition comprising a first conjugate (A), the first conjugate comprising a positively charged polypeptide conjugated to a bifunctional linker, characterized in that the composition is substantially free of unconjugated bifunctional linkers, thereby obtaining a second conjugate (B) comprising the positively charged polypeptide, the bifunctional linker, and the antibody; and (d) contacting the second conjugate (B), the positively charged polypeptide, and a negatively charged molecule to form nanoparticles. The invention also relates to nanoparticles obtainable by the method of the invention, and to nanoparticles comprising (a) a positively charged polypeptide; (b) a second conjugate (B) comprising an antibody conjugated to the positively charged polypeptide; and (c) one or more negatively charged molecules. The invention further relates to compositions comprising the nanoparticles of the invention, and to nanoparticles or compositions of the invention for therapeutic use. Background Technology

[0004] RNA repression (RNAi) has raised high hopes for medical applications and was awarded the Nobel Prize in 2006. This method, through the selection and synthesis of gene-specific siRNA oligonucleotides, demonstrates high efficiency by inactivating mRNA and subsequently silencing the expression of almost any gene. While this method has revolutionized molecular biology, translating this principle into therapeutic applications has proven difficult due to numerous specific problems.

[0005] siRNA oligonucleotides, when attacked by nucleases, exhibit improved immunogenicity and renal clearance; therefore, the half-life and cycling time of "naked siRNA" are typically much lower than expected. Consequently, siRNA has been compounded with stabilizers such as nanoparticles or capsules. Using these stabilizers, the cycling time and bioavailability of siRNA are improved, but a target-cell determinant structure is still lacking, which a) targets cells with specific surface molecules and delivers siRNA to these cells, and b) enables target-specific transfer of anionic siRNA across anionic cytoplasmic membranes.

[0006] Despite numerous Phase I-III clinical trials conducted to treat neurological disorders, viral infections, and cancer, the FDA has so far approved only one siRNA. For example, Patisiran (brand name Onpattro) is a drug for treating polyneuropathy in people with hereditary thyroxine-mediated amyloidosis. Hereditary thyroxine-mediated amyloidosis is a deadly rare disease that is estimated to affect 50,000 people worldwide.

[0007] To develop modular therapeutic approaches for treating cancer, we have developed a system that conjugates siRNA to antibodies targeting specific surface molecules of cancer cells. The system delivers the siRNA to the target cancer cells via a specific cationic peptide—protamine—which binds to the corresponding surface molecules (such as receptors) and induces internalization in a receptor-dependent manner upon binding.

[0008] Protamine is a cationic nucleic acid-binding peptide that transports the complete set of genomic DNA condensed in the sperm head. Because protamine can complex nucleic acids and facilitate their transfer across the cell membrane, it has attracted numerous researchers to investigate its applications in transfection, targeted delivery, and gene therapy (Choi et al., 2009; Chono et al., 2008; Hansen et al., 1979; He et al., 2014; Liu, B., 2007). Protamine has been tested as a nucleic acid delivery vector and linked to various cell-determining targeting moieties. In 2005, Song et al. (Song et al., 2005a) proposed a gene fusion protein that linked a Fab fragment (F105) targeting the HIV gp160 envelope protein to a truncated protamine peptide. This fusion protein complexed with HIV-targeting... A siRNA of the gag protein was developed, and this conjugate was able to target HIV-infected T cells that are difficult to transfect and HIV envelope-transfected melanoma cells. This siRNA-F105 vector conjugate inhibited HIV replication in infected T cells. To validate the targeting principle, the same strategy was applied to target ErbB2 with an Erb2 single-chain antibody fused with protamine. Thus, gene fusion between protamine and cellular determinants has been followed in many publications, but this concept has never been successfully translated into clinical practice.

[0009] In previous work, according to N. et al., 2016 Nat.Protoc.11, 22-36. N. et al., 2018 PLoS One 13, e0200163; and The chemical conjugation scheme described in S. et al., 2015 Clin Cancer Res 21, 1383-94, involves the conjugation of an anti-EGFR monoclonal antibody (mAB) cetuximab with a cationic peptide protamine via a bispecific cross-linked sulfonyl-SMCC. The resulting IgG-protamine conjugate molecule is capable of internalizing the EGF receptor and delivering siRNA to target cells.

[0010] The object of this invention is to provide further and preferred improved means and methods for delivering anionic molecules to target cells. Summary of the Invention

[0011] The present invention relates to a method for producing nanoparticles, the method comprising (c) contacting an antibody with a composition comprising a first conjugate (A), the first conjugate comprising a positively charged polypeptide conjugated to a bifunctional linker, characterized in that the composition is substantially free of unconjugated bifunctional linkers, thereby obtaining a second conjugate (B), the second conjugate comprising the positively charged polypeptide, the bifunctional linker and the antibody; and (d) contacting the second conjugate (B), the positively charged polypeptide and a negatively charged molecule to form nanoparticles.

[0012] The present invention also relates to a nanoparticle that can be obtained by the method of the present invention.

[0013] The present invention also relates to a nanoparticle comprising: (a) a positively charged polypeptide; (b) a second conjugate (B) comprising an antibody conjugated to the positively charged polypeptide via a bifunctional linker; and (c) one or more negatively charged molecules.

[0014] The present invention also relates to a composition comprising the nanoparticles of the present invention.

[0015] The present invention also relates to a nanoparticle or composition of the present invention for use in treatment. Attached Figure Description

[0016] Figure 1 : By applying ( The conjugation method disclosed in N. et al. (2016) leads to the formation of large quantities of antibody-SMCC-protamine conjugates. The reaction does not deplete excess sulfonyl-SMCC (e.g., ...). Figure 2Residual cross-linking agents can form a variety of different conjugates with IgG, protamine-SMCC, and reactive sulfonyl-SMCC. Examples of unintended byproducts observable by SDS-PAGE include IgG (A and B: anti-EGFR-mAB cetuximab) internally cross-linked with excess sulfonyl-SMCC, accompanied by the same cross-linking as protamine. Additionally, we observed high molecular weight IgG polymers that are non-reducible (A), accompanied by the same cross-linking as protamine (see gel B). At extremes, the complexity of unintended byproducts can lead to a cloud-like appearance (B), which may be formed from a mixture of all possible conjugates (ad). HC: heavy chain, LC: light chain. The depletion of unreacted SMCC can lead to the formation of undesirable byproducts that may interfere with the function of the intended product (c). For example, reactive SMCC can lead to cross-linking of the light chain with the heavy chain in a given IgG molecule (a) or cross-linking of two IgG molecules forming an IgG dimer (d).

[0017] Figure 2 :( Modifications to the conjugation method disclosed in N. et al., 2016. A: After conjugating sulfo-SMCC with protamine, excess sulfo-SMCC is not depleted, and residual cross-linking agent can form various different conjugates with IgG, protamine-SMCC, and reactive sulfo-SMCC. Unlike previous protocols, the antibody-SMCC-protamine conjugate was desalted after the conjugation process. This step is omitted in the new protocol. (C: anti-EGFR antibody cetuximab, D: anti-IGF1R antibody ImcA12). Examples of unexpected byproducts observable by SDS-PAGE are highlighted with circles. B: The new conjugation protocol now includes a purification step after conjugation of sulfo-SMCC and protamine. The SMCC-protamine conjugate in unbound sulfo-SMCC is depleted using a Zeba-Spin gel purification column, which retains free sulfo-SMCC and elutes the SMCC-protamine conjugate. As a result, a defined conjugation product is now formed of SMCC-protamine with the heavy chain (HC) and light chain (LC) of the IgG antibodies cetuximab (Cet; E) and ImcA12 (A12; F), and it can be observed in Coomassie-stained SDS-PAGE. HC: heavy chain, LC: light chain, P: protamine. The omission of depletion of unreacted SMCC may lead to the formation of undesirable byproducts that could interfere with the function of the intended product (c). For example, reactive SMCC may lead to crosslinking of the light and heavy chains in a given IgG molecule (a) or crosslinking of two IgG molecules to form an IgG dimer (d).

[0018] Figure 3: Antibody-mediated siRNA targeting KRAS in NSCLC. A: Targeting construct between anti-EGFR monoclonal antibody (mAB) cetuximab and protamine. B: Anti-EGFR-mAB-protamine / free protamine (P / P) complex (α-EGFR-mAB) binds up to 8 mol siRNA / mol antibody. C: Cetuximab (anti-EGFR-mAB-)protamine / free SMCC-protamine (P / P) transports Alexa488-tagged (white dot, top left small image) siRNA to endosomes, but not to lysosomes, because Alexa488-positive vesicles do not overlap with the lysosomal marker lysotracker (white dot, top right small image). D: NSCLC cells treated with α-EGFR-mAB-protamine / free protamine / siRNA (α, anti; containing P / P) showed that KRAS siRNA silenced KRAS expression, while control siRNA did not. E: Cells treated with α-EGFR-mAB-protamine / free protamine / siRNA (P / P) showed significantly reduced colony formation, containing KRAS siRNA targeting the WT and G12D mutant alleles. F: Systemic application of α-EGFR-mAB-protamine / free protamine in combination with control and KRAS-siRNA was well tolerated in CD1- nude mice with subcutaneous xenografted SKLU1 and A549 cells, and α-EGFR-mAB-protamine / free protamine / KRAS-siRNA significantly inhibited tumor growth in SKLU- and A549- tumors. G: Although the control (hybrid) siRNA carrying cetuximab-P / P therapeutically suppressed A549 tumors, the tumor weight in the KRAS siRNA treatment group was significantly lighter than in any control group. Resected tumors are shown in H. Statistical analysis: Mean + / - standard deviation for all experiments except F; standard error mean (SEM) is selected here. Significance: *P < 0.05, two-tailed t-test.

[0019] Figure 4 The proliferation marker Ki67 was present in low amounts in KRAS-knockdown NSCLC xenografts. Immunofluorescence assays of the proliferation marker Ki67 (gray dots in A, C, E and G, I, K) on histological xenograft sections were performed. Compared to PBS and control siRNA vector treatment groups, the number of Ki67-positive cell nuclei was significantly reduced in tumor tissue sections treated with KRAS siRNA in A549(AF) and SK-LU1(GL).

[0020] Figure 5NSCLC xenografts showed a higher abundance of apoptotic cells. Immunohistochemical localization of apoptosis in xenograft tumor sections analyzed by TUNEL. AL: In both xenograft cell lines, an increased rate of apoptosis was observed in tumors treated with the KRAS siRNA vector compared to the control group. MN: Statistical analysis of TUNEL-positive cell nuclei in sections: The number of TUNEL-positive cell nuclei increased twofold in A549 tumors treated with EGFR-mAB-protamine / free protamine (mAB-P / P) compared to PBS treatment, and threefold in tumors treated with the KRAS siRNA vector. In SK-LU1, only EGFR-mAB-protamine / free protamine KRAS siRNA treatment resulted in a fourfold increase in apoptotic cells. α, anti; cntr, control.

[0021] Figure 6 The antibody-siRNA complex can target rhabdomyosarcoma (RMS) cell lines. A: Expression of EGFR and IGFR1R receptors on the cell surface in both RMS cell lines; both IGFR1R and EGFR are expressed in both cell lines. B: Cetuximab-protamine (EGFR-mAB-P containing free SMCC-protamine ( / P / P)) enabled the Alexa488-labeled control siRNA to shuttle into most RD cells (>90% in FACS Figure C), but the effect was poor in RH-30 cells (not shown in FACS). RH-30 cells were further shuttled by anti-IGF1R-directed GR11L-protamine (P / P) to bypass the Alexa488 control siRNA labeling.

[0022] Figure 7In soft agar analysis, cetuximab-protamine / free SMCC-protamine (P / P) targeting RD (embryonic RMS, ERMS) and RH30 (alveolar RMS, ARMS) cells with siRNAs that mediate knockdown of cyc / NRAS and KRAS, as well as PAX3 in RH30 cells, reduced colony growth. Cells were harvested, treated with 30 nM cetuximab-protamine / P (EGFR-mAB-P containing free SMCC- / P) conjugated to either control (scr) or, as shown, two effective anti-c-Myc and NRAS siRNAs, seeded in 96 soft agar plates, cultured for two weeks, stained, and counted (A). The combination of the two effective siRNAs reduced the colony count in the control group from 87% to 63% normalized to the PBS control (B). C: Treatment of RD cells with EGFR-mAB-P / P conjugated to KRAS or NRAS-specific siRNAs moderately reduced NRAS expression in the corresponding cells. P < 0.001, two-tailed T-test. D: Sequences GGCCTCTCACCTCAGAATTC (siPF1, SEQ ID NO:49), GCCTCTCACCTCAGAATTCA (siPF2, SEQ ID NO:50), and CCTCTCACCTCAGAATTCAA (siPF3, SEQ ID NO:51) show the corresponding positions of the siRNAs, which cover the breakpoint region of the fusion oncogene PAX3-FKHR shown by sequence TGGCCTCTCACCTCAGAATTCAATTCGTC (SEQ ID NO:48), with the PAX3 portion in light gray and the FKHR portion in dark gray. E: In soft agar analysis, cetuximab-protamine / P-mediated siRNA knockdown of PAX3-FKHR in RH30 cells reduced colony growth. Colony growth was significantly inhibited by applying cetuximab-mediated breakpoint-guided siRNA siPF2 (siRNA walking observed in D). P < 0.05, two-tailed T-test.

[0023] Figure 8The formation of the antibody-siRNA-P / P complex can be used for IGF1R targeting. A: Flow cytometry shows that A673 Ewing sarcoma cells internalize the mouse anti-IGF1R antibody GR11L-sulfo-SMCC-protamine / P complex at 37°C, as with the unconjugated GR11L antibody, depicted by a leftward shift of the histogram signal compared to the non-internalized 4°C control. B: Green fluorescent cytoplasmic vesicle structures in A673 cells composed of Alexa Fluor488-siRNA are internalized by GR11L-protamine containing free SMCC-P (arrow, right inset), but not in the control experiment lacking the antibody conjugate (left inset). The internalized Alexa Fluor488-siRNA can be viewed as white vesicle deposits (white arrow). The nuclei are shown as kidney-shaped structures in gray by Hoechst multistaining. The boxed areas show higher magnification of the indicated cells. Scale bar, 20 μm. C: The GSP complex was then conjugated to siRNA targeting the oncogenic fusion protein EWS-FLI1 mRNA, and A673 cells were treated with these complexes. As a result, EWS-FLI1 expression was downregulated, as detected in Western blots of FLI1 expression. EWS-FLI1 (E / F)-specific siRNA 2 reduced EWS-FLI1 protein expression by 80% compared to the control siRNA and PBS control. Other E / F-specific siRNAs (siRNA1 and FLI1-esiRNA) showed significantly lower efficacy. EWS-FLI1 travels in a ~64 kDa dual band, while actin is 43 kDa. Its expression in (… Published in N. et al., 2016.

[0024] Figure 9 : Anti-IGF1R-mAbs A12 and Tepro for targeting Ewing sarcoma cells. A: IGF1R-targeting mAbs A12 (cetulumab) and Tepro (tetulumab) were expressed and purified in our lab and conjugated with protamine / P to enable siRNA binding and transport. The IgG-protamine / P conjugate showed appropriate molecular weight shifts (arrows). HC = heavy chain, LC = light chain, -P = SMCC-protamine. B: Band transfer analysis using anti-IGF1R-mAbs-protamine and different proportions of siRNA. C: Anti-IGF1R-mAbs-protamine (containing free SMCC-P) enabled Alexa488-labeled control siRNA to shuttle into SKNM-C Ewing cells (white spots).

[0025] Figure 10Compared with the control, breakpoint siRNA significantly reduced colony formation in Ewing SKNM-C cells. SKNM-C cells were treated with protamine / P-conjugated A12 (A) or Tepro (B) and the indicated siRNA, and colony formation was analyzed. E / F-siRNA is an siRNA that interferes with the mRNA driving Ewing sarcoma EWS-Fli1. BCL2, anti-BCL2 siRNA. P < 0.05, two-sided T-test.

[0026] Figure 11 : A cross-sectional illustration of an example of a nanoparticle-like structure that satisfies the conditions for an effective antibody-SMCC-protamine / p-siRNA or-SM-1 / RF carrier complex derived from our experiments. An electrostatic binding bridge is formed between the mAb (some of which contains protamine conjugated to the targeting antibody) and the corresponding anionic cargo, which includes siRNA (A) and anionic small molecules such as SM-1 / RF (B) or both (C).

[0027] Figure 12 Antibody-protamine / free protamine conjugates can bind single-stranded antisense oligonucleotides (ASOs). Band transfer analysis revealed that 1 mol of EGFR-antibody-protamine-conjugate binds 8-32 mol of ASO.

[0028] Figure 13 Description of the molecular composition of the effective siRNA binder. Anti-CD20 mAB was conjugated to SMCC-protamine with a molar amount exceeding mAB as indicated. The ability of the resulting conjugated mixture to bind siRNA was then tested. Regardless of the molar excess of protamine-SMCC provided, the ability of the resulting bound siRNA was not significantly different, ranging from approximately 16 mol siRNA per mol of carrier binder.

[0029] Figure 14 A: CD20-mAB rituximab-protamine / P conjugate bound to 8 mol siRNA. Coomassie-stained SDS-PAGE shows anti-CD20-mAB, anti-CD20-mAB conjugated with 30x SMCC-protamine, and the molecular marker (M); HC = heavy chain, LC = light chain, -P = SMCC-protamine. B: Band transfer analysis using CD20-mAB-protamine / P and siRNA in different ratios.

[0030] Figure 15Targeting DLBCL cell lines with antibody-P / P-siRNA complexes. Top inset: FACS analysis of CD20 and CD33 expression in selected DLBCL cell lines. Middle inset (white dot): Alexa488-labeled siRNA binds to protamine-conjugated CD20 (rituximab) and CD33 (gemituzumab) monoclonal antibodies (both containing free SMCC-protamine), and the corresponding cell lines are treated with this composition overnight. The siRNA is internalized and condensed in cytoplasmic vesicle structures via the corresponding antibody-targeting mAbs. Both targeting mAbs (left: anti-CD20, right: anti-CD33) show siRNA delivery to the corresponding cell lines. Bottom inset: DLBCL cell lines are seeded into methylcellulose and treated with the antibody-protamine / P-siRNA conjugate shown. Despite high CD33 expression in all cell lines and rituximab delivering siRNA into intracellular vesicles, the response to key gene knockdown, as measured by colony-forming ability, was low, indicating a problem with endosome release. In contrast, gemtuximab, targeting lower CD33 expression, showed a better response to gene knockdown: significant*p<0.01. In this study, HBL-1 cells, in particular, showed a good response to BTK kinase knockdown, as well as to other components of the cytosolic kinase SYK and B-cell receptor signaling pathways, such as CARD11b, CD79B, and MYD88.

[0031] Figure 16 : Used for the synthesis of polyanionic small molecule (SM) derivatives transported electrostatically by monoclonal antibodies. SM-1 is conjugated to a polyanionic red fluorescent chromophore (RF) to form a low molecular weight (1.44 kDa) polyanion.

[0032] Figure 17 : Conjugation of CD20-mAB rituximab-protamine / P conjugate and EGFR-mAB cetuximab-protamine / P conjugate to SM-1 / RF. A: Band transfer analysis using different ratios of SM-1 / RF up to 1:32 with CD20-mAB-protamine / P and EGFR-mAB-protamine / P. B: Band transfer analysis using different molecular excesses of SM-1 / RF up to 1:200 with CD20-mAB-protamine / P and EGFR-mAB-protamine / P. Antibody-protamine conjugates containing free SMCC-protamine can conjugate at least 100 mol of SM-1 / RF.

[0033] Figure 18CD20-mAB rituximab-protamine / P conjugate and EGFR-mAB cetuximab-protamine / P conjugate transport SM-1 / RF. A: CD20-positive HBL-1 DLBCL cells with internalized CD20-mAB-protamine / P / SM-1 / RF (containing free SMCC-P) complex (gray shading, left hand). B: EGFR-positive A549 NSCLC cells with internalized EGFR-mAB-protamine / P / SM-1 / RF / P complex (white dot, left hand).

[0034] Figure 19 After exhaustion of free SMCC-protamine by HPLC, the EGFR-mAB cetuximab-protamine conjugate could not effectively bind siRNA. A: Coomassie-stained SDS-PAGE showed the HPLC fractions of anti-EGFR-mAB, anti-EGFR-mAB conjugated with 32x SMCC-protamine, and anti-EGFR-mAB conjugated with 32x SMCC-protamine after exhaustion of unbound SMCC-protamine (25-31); HC = heavy chain, LC = light chain, -P = SMCC-protamine. B: Band transfer analysis.

[0035] Figure 20 Colony formation analysis of NSCLC cells treated with different siRNA vectors containing and without free protamine in soft agar. A: A549 cells treated with EGFR-mAB-protamine / P-KRAS-siRNA formed significantly fewer colonies in soft agar than cells treated with EGFR-mAB-protamine / P / contr(scr)-siRNA. B: SK-LU1 cells. Compared with PBS-treated cells, when A549(A) or SK-LU1(B) cells were treated with EGFR-mAB-protamine conjugates without free protamine (see [link to study]). Figure 19 No difference in colony formation was observed when A (grade 29 / 30) or when only the same amount of SMCC-protamine was used. Photographs of the colony analysis and the mean ± SD of three independent experiments are shown here. An asterisk indicates a significant difference (P < 0.05, two-tailed t-test).

[0036] Figure 21After exhaustion of free SMCC-protamine by HPLC, the CD33-mAB gemutazine-protamine conjugate did not effectively bind siRNA. A: Coomassie-stained SDS-PAGE showed the HPLC fractions 24-30 for anti-CD33-mAB, anti-CD33-mAB conjugated with 32x SMCC-protamine, and anti-CD33-mAB conjugated with 32x SMCC-protamine after exhaustion of unbound SMCC-protamine; HC = heavy chain, LC = light chain, -P = SMCC-protamine. B: Band transfer analysis. C: Colony formation analysis. OCI-AML2 cells treated with CD33-mAB-protamine / P-DNMT3A-siRNA (containing free SMCC-P) formed significantly fewer colonies in soft agar than cells treated with CD33-mAB-protamine / P-Contr(scr)-siRNA (containing free SMCC-P). No difference in colony formation was observed when OCI-AML2 cells were treated with a CD33-mAB-protamine conjugate containing no free SMCC-protamine compared to PBS-treated cells (see A+B, grade 30). The results shown here are mean ± SD from three independent experiments. *P < 0.033, two-tailed t-test.

[0037] Figure 22 After depletion of free SMCC-protamine by HPLC, the CD20-mAB rituximab-protamine conjugate did not effectively bind SM-1 / RF. A: Coomassie-stained SDS-PAGE showed HPLC fractions 19-25 / 26 for anti-CD20-mAB, anti-CD20-mAB conjugated with 32x SMCC-protamine, and anti-CD20-mAB conjugated with 32x SMCC-protamine after depletion of unbound SMCC-protamine; HC = heavy chain, LC = light chain, -P = SMCC-protamine. B: Band transfer analysis with protamine-depleted CD20-mAB (left) and protamine-containing CD20-mAB formulation (right). The CD20-mAB formulation without SMCC-protamine depletion bound >32 mol of SM-1 / RF.

[0038] Figure 23After depletion of free SMCC-protamine by HPLC, the anti-IGF1R monoclonal AB IMCA-12(A12)-protamine conjugate did not effectively bind siRNA. A: Coomassie-stained SDS-PAGE shows HPLC fractions 15-21 for anti-IGF1R, anti-IGF1R-mAB conjugated with 32x SMCC-protamine, and anti-IGF1R-mAB conjugated with 32x SMCC-protamine after depletion of unbound SMCC-protamine; HC = heavy chain, LC = light chain, -P = SMCC-protamine. B: Band transfer analysis was performed with depleted protamine (below; fraction 20; see A) and the IGF1R-mAB formulation containing SMCC-protamine (above). The IGF1R-mAB formulation without SMCC-protamine depletion bound 8 mol of siRNA.

[0039] Figure 24 Colony formation analysis of SKNM-C Ewing sarcoma cells in soft agar treated with and without free protamine A12 vector. SKNM-C cells treated with IGF1R(A12)-mAB-protamine / P-EWS-FLI1-siRNA containing free SMCC-P formed significantly fewer colonies in soft agar than cells treated with IGF1R(A12)-mAB-protamine / P-Contr(scr)-siRNA containing free SMCC-P. No difference in colony formation was observed when SKNM-C cells were treated with EGFR-mAB-protamine conjugate without free protamine. Mean ± SD of three independent experiments are shown here. An asterisk indicates statistical significance (*P<, two-tailed t-test).

[0040] Figure 25 Colony formation analysis of SKNM-C Ewing sarcoma cells in soft agar treated with different siRNA vectors containing or without free SMCC-protamine. SKNM-C cells treated with IGF1R(A12)-mAB-protamine / P / EWS-FLI1(E / F) siRNA containing free SMCC-P formed significantly fewer colonies in soft agar than cells treated with IGF1R(A12)-mAB-protamine / P / contr(scr)-siRNA containing free SMCC-P. When SKNM-C cells were treated with EGFR-mAB-protamine conjugates containing or without free SMCC-protamine, (see...) Figure 19No difference in colony formation was observed between cells treated with SMCC-protamine (grade 29 / 30) or with the same amount of SMCC-protamine alone, and cells treated with scr-siRNA (scr, co-occurring). Mean ± SD of three independent experiments are shown here. An asterisk indicates a significant difference (P < 0.05, two-tailed T-test).

[0041] Figure 26 Colony formation analysis of SKNM-C Ewing sarcoma, OCI-AML-2 leukemia, and A549 NSCLC cells treated with the same concentration of undepleted A12 anti-IGF1R mAB in the putative IgG-protamine-SMCC-protamine / / free protamine / siRNA complex versus non-antibody-bound SMCC-protamine in soft agar. A: SKNM-C cells treated with IGF1R(A12)-mAB-protamine / EWS-FLI1-siRNA / free SMCC-P formed significantly fewer colonies in soft agar than cells treated with IGF1R(A12)-mAB-protamine / contr(scr)-siRNA / free SMCC-P. Conversely, conjugating effective EWS-FLI1(E / F)-siRNA with only 1800 nM SMCC-protamine proved ineffective (A, right). B: Similarly, combining SMCC-protamine with potent DNMT3a siRNA without targeting antibodies in the AML cell line OCI-AML2 did not show inhibition of colony formation. C: Finally, testing in A549 with the same settings as the effective KRAS siRNA bound to free SMCC-protamine yielded no effect and was not different from the control. Mean ± SD of the three independent experiments are shown here. An asterisk indicates a significant difference (P < 0.05, two-tailed T-test).

[0042] Figure 27 Vesicle tracing in A549 NSCLC cells. Cells treated with EGFR-mAB-protamine / free SMCC-P-Alexa488 siRNA were stained with Lysotracker red. Vesicles containing Alexa488 (white dots, right inset) rarely colocalized with Lysotracker staining (gray dots, middle inset).

[0043] Figure 28 Internalization of different anti-EGFR-mAB (cetuximab) agents in SK-LU1 EGFR-positive NSCLC cells treated with different complexes. SK-LU1 cells were treated with EGFR-mAB-protamine / P / Alexa488-control-siRNA containing (white dots in the upper inset) and without free SMCC-protamine (lower inset).

[0044] Figure 29 Internalization of different anti-EGFR-mAB (cetuximab) agents in EGFR-positive NSCLC cells A549 treated with different complexes and free SMCC-protamine. A549 cells were treated with EGFR-mAB-protamine / P / Alexa488-control-siRNA and free SMCC-protamine (C and F) containing (nuclear staining in A and white dots for siRNA in D) or without free SMCC-protamine (B and E). AC: Nuclear staining using Hoechst; DF: Green channels (white dots) depicting vesicles internalized with Alexa488-siRNA in the same cells as in AC.

[0045] Figure 30 Internalization of different anti-CD33-mAB (gemituzumab) agents in CD33-positive AML cells OCI-AML2 treated with different complexes. OCI-AML2 cells were treated with anti-CD33-mAB-protamine / P / Alexa488-control-siRNA containing (A and D) and without free SMCC-protamine (B and E), and free SMCC-protamine (C and F). AC. Nuclear staining using Hoechst (gray dots), DF. Green channels (white dots in D) depicting vesicles internalized with Alexa488-siRNA in the same cells as in AC.

[0046] Figure 31 Internalization of different anti-IGF1R-mAB (ImcA12) agents in IGF1R-positive Ewing sarcoma cells SKNM-C treated with different complexes. SKNM-C cells were treated with anti-IGF1R-mAB-protamine / P / Alexa488-control-siRNA containing (A and D) and without free SMCC-protamine (B and E), and free SMCC-protamine (C and F). AC: Nuclear staining using Hoechst, DF: Green channels (white dots in D) depicting vesicles internalized with Alexa488-siRNA in the same cells as in AC.

[0047] Figure 32Different anti-EGFR-mAB (cetuximab) formulations exist in EGFR-negative SKNMC cell cultures. The inset below depicts a higher magnification of the inset shown in the white box above. A: Unconjugated cetuximab does not transport Alexa488-control siRNA into SKNMC cells. B: Protamine-conjugated cetuximab does not transport Alexa488-control siRNA into SKNMC cells; Alexa488-positive vesicle structures appear only near cells (white dots, arrows in the inset above) and in cell-free areas of the culture (arrows in the inset below). C: Protamine-conjugated cetuximab without free SMCC-protamine (which was removed by HPLC) no longer forms Alexa488-positive vesicle structures.

[0048] Figure 33 EGFR-mAB cetuximab-protamine conjugates in DLS measurements. Top inset: Coomassie-stained PAGE gels depicting isolated or different conjugates used for measurements in the bottom inset. Bottom inset: EGFR-mAB-P containing and without free SMCC-protamine, as well as SMCC-protamine alone, were incubated at room temperature for 2 hours and then measured by dynamic light scattering (DLS) on a zeta counter (MALVERN). Different peaks represent particles of different sizes in nm. Although the highest peak of EGFR-mAB-P with free SMCC-protamine / siRNA appears at approximately 427 nm, EGFR-mAB-P without free SMCC-protamine produces only a peak at approximately 3.2 nm, while free SMCC-protamine / siRNA produces a peak at 5.7 nm.

[0049] Figure 34 EGFR-mAB cetuximab-protamine / P conjugate was measured by DLS during incubation at room temperature for 0 to 24 hours. After mixing, siRNA monomers (approximately 1.92 nm) were assembled into larger structures using the cetuximab-protamine / unbound protamine carrier system, which stabilized and further assembled into even larger macrostructures (~500 nm). After 24 hours in an unprotected environment in PBS, these macrostructures began to partially disassemble again. The numbers below indicate particle size measurements in nm.

[0050] Figure 35Antibody-protamine / free SMCC-P (P / P) conjugates exhibiting fluorescent Alexa488-siRNA (white spots) on a chamber slide after overnight cell-free incubation. A: EGFR-mAB-P / P, B: CD20-mAB-P / P, C: CD33-mAB-P / P, D: IGF1R-mAB-P / P at 40x magnification, scale bar = 10 μm. EH: Higher magnification of AD, scale bar still 10 μm.

[0051] Figure 36 Antibody-protamine conjugates containing and without free SMCC-protamine, and SMCC-protamine alone, exhibiting fluorescent Alexa488-siRNA (white spots) on a chamber slide after overnight cell-free incubation. Antibody complexes containing free SMCC-protamine: A. EGFR-mAB-P, B. CD20-mAB-P, C. CD33-mAB-P, D. IGF1R-mAB-P, E. Free SMCC-protamine. Antibody complexes without free SMCC-protamine: F. EGFR-mAB-P, G. CD20-mAB-P, H. CD33-mAB-P, I. IGF1R-mAB-P, all at 40x magnification.

[0052] Figure 37 Fluorescence microscopy (A and B) and laser scanning microscopy (LSM) images of a confocal optical section (C and D) of the antibody complex. Formation of cetuximab anti-EGFR-mAB-protamine / free SMCC_P conjugates (A and C) and anti-CD20-mAB-protamine / free SMCC-P (B and D) with fluorescent Alexa488-siRNA (white dots) on a chamber slide after overnight cell-free incubation.

[0053] Figure 38 Anti-EGFR antibody-protamine conjugate containing free SMCC-protamine was incubated overnight at different cell-free temperatures on a chamber slide. The conjugate showed fluorescent Alexa488-siRNA (white spots).

[0054] Figure 39 : Conjugation of cetuximab with different ratios of antibody and SMCC-protamine. A: Detailed formulations for each conjugation process. B: Coomassie-stained SDS-PAGE showing a comparison between unconjugated anti-EGFR-antibody cetuximab and conjugated products as shown in A.

[0055] Figure 40Functional analysis of cetuximab conjugates with different ratios of antibody and SMCC-protamine. AF: Band transfer analysis using different conjugates as shown in the figure. GL: No cell vesicle formation on the slide when different conjugates were incubated with Alexa488-siRNA (white dots, especially in J). MR: Internalization of different cetuximab-SMCC-protamine / P / Alexa488-siRNA complexes into EGFR-positive A549 cells (white dots, arrows). SX: Colony formation of A549 cells treated with different cetuximab-SMCC-protamine / P conjugates containing free protamine, either conjugated with control (“scr”) siRNA or anti-KRAS siRNA (“KRAS”). The conjugates were nonspecifically toxic when using more than 50X SMCC-protamine. Mean ± SD of three independent experiments are shown here. An asterisk indicates a significant difference (P < 0.009, 2-tailed T-test).

[0056] Figure 41 Functional analysis of vesicle formation in anti-EGFR-mAB-protamine with different proportions of supplemented SMCC-protamine or protamine alone. No cell vesicle formation was observed on the slide after incubation with Alexa488-siRNA. As shown in the figure (white dots), anti-EGFR-mAB-protamine without free SMCC-protamine did not form vesicles. When free SMCC-protamine was added stepwise, no vesicle formation occurred at levels from 1×SMCC-protamine (A), down to a low level of 10×SMCC-protamine (B), and up to a high level of 32×SMCC-protamine (C). When free protamine not conjugated with sulfonyl-SMCC was added stepwise, no vesicle formation occurred at levels from 1×SMCC-protamine (D), down to a low level of 10×SMCC-protamine (E), and up to a high level of 32×SMCC-protamine (white dots in F).

[0057] Figure 42Formation of anti-CD20-mAB-protamine / free SMCC-P conjugates with fluorescent Alexa488-siRNA and / or SM-1 / RF on a chambered slide under cell-free incubation. A.-C. Green fluorescent channel (white spot), D.-F. Red fluorescent channel (gray spot), A. and D. with anti-CD20-mAB-P / P containing Alexa488-siRNA, B. and E. with anti-CD20-mAB-P / P containing red fluorescent SM-1 / RF, C. and F. with anti-CD20-mAB-P / P containing both Alexa488-siRNA and red fluorescent SM-1 / RF, 40x magnification, scale bar = 10 μm.

[0058] Figure 43 Formation of anti-EGFR-mAB-protamine / free SMCC-P conjugates with fluorescent Alexa488-siRNA and / or SM-1 / RF on a chambered slide under cell-free incubation. AD: Green fluorescent channel (white spot), EH: Red fluorescent channel (gray spot). A and E. EGFR-mAB-P / P with Alexa488-siRNA, B and F. EGFR-mAB-P / P with red fluorescent SM-1 / RF, C and G. EGFR-mAB-P / P with non-fluorescent control siRNA and red fluorescent SM-1 / RF, D and H. EGFR-mAB-P / P with green fluorescent Alexa488-siRNA and red fluorescent SM-1 / RF, 40x magnification, scale bar = 10 μm.

[0059] Figure 44 Formation of rituximab anti-CD20-mAB-protamine / free SMCC-P conjugates with fluorescent Alexa488-siRNA and SM-1 / RF on a chamber slide under cell-free incubation. AC: 40x magnification of green (white dot) and red fluorescent (gray dot) channels; DL: same magnification of details from AC, scale bar = 10 μm. In D, G, and L: gray rings depict Alexa488-siRNA fluorescence (arrows). In E, H, and K: gray circles depict the red fluorescence of SM-1 / RF (arrows). In F, I, and L, the green fluorescent (gray) edge (Alexa488-siRNA, arrow) and the red inner fluorescence (SM-1 / RF) can be distinguished.

[0060] Figure 45Formation of cetuximab anti-EGFR-mAB-protamine / free SMCC-P conjugates with green fluorescent Alexa488-siRNA and red fluorescent SM-1 / RF on a chamber slide under cell-free incubation. AC: 40x magnification of green (white and rings in A and C) and red fluorescent channels (gray circles in B and C). D: Magnification of details in AC, scale bar = 10 μm.

[0061] Figure 46 Under an optical microscope, large micelle structures (B and C) formed by anti-CD20-mAB / P / free SMCC- / P (gray ring in A), SM-1 / RF (gray circle in B), and Alexa488-siRNA are visible in phase contrast. Scale bar = 5 μm.

[0062] Figure 47 LSM images of a confocal optical section and a Z-stack of antibody complexes. A: Formation of anti-EGFR-mAB (cetuximab)-protamine / free SMCC-P conjugates with fluorescent Alexa488-siRNA (white dots) and SM-1 / RF in cell-free incubation on a chamber slide. a: A level across the vesicle. B and C: Z-stacks reconstructing the 3D structure of the vesicles on both axes. B: Formation of anti-CD20-mAB (rituximab)-protamine / P conjugates with fluorescent Alexa488-siRNA (white rings and dots) and SM-1 / RF (gray shadows) on a chamber slide in cell-free incubation. d: A level across the vesicle. e and f: Z-stacks reconstructing the 3D structure of the vesicles on both axes.

[0063] Figure 48 This study describes the synthesis of a polyanionic ibrutinib derivative for electrostatic transport via monoclonal antibodies. Ibrutinib is conjugated to the Cy3.5 chromophore to form a low molecular weight (1.44 kDa) polyanion. The anionic ibrutinib-Cy3.5 (Cy3.5-RMA561) forms a stable vesicle chemical structure by electrostatic interaction with mAB linked to cationic protamine.

[0064] Figure 49 High-resolution mass spectrometry (HRMS) using Cy3.5-RMA561. The sample is ionized and fragmented in the mass spectrometer using an electron beam, and the fragments are analyzed based on their mass-to-charge ratio (m / z) according to their specific deflections. HRMS (ESI, CH3CN / H2O):

[0065] m / z calc. for C 64 H 62 N9 O 15 S4 3-[MH](z=3):441.44216; Discovery: 441.44160;

[0066] m / z calc. for C 64 H 62 N9 O 15 S4H 2- [MH](z=2):662.66687; Discovery: 662.66630;

[0067] m / z calc. for (C 64 H 62 N9 O 15 S4H)2 4- [MH](z=4):662.66687; Discovery:662.66630.

[0068] Figure 50 αCD20-mAB rituximab-protamine / free protamine-SMCC conjugate and αEGFR-mAB cetuximab-protamine / free protamine-SMCC conjugate bound to ibrutinib-Cy3.5. A. Band transfer analysis using different ratios of ibrutinib-Cy3.5 up to 1:32, with αCD20-mAB-protamine / P and αEGFR-mAB-protamine / P. B. Band transfer analysis using different molecular weight excesses of ibrutinib-Cy3.5 up to 1:200, with αCD20-mAB-protamine / free protamine-SMCC and αEGFR-mAB-protamine / free protamine-SMCC. The antibody-protamine conjugate complex can bind at least 100 mol of ibrutinib-Cy3.5. α, anti.

[0069] Figure 51 αCD20-mAB rituximab-protamine / free protamine-SMCC / ibrutinib-Cy3.5 conjugate and αEGFR-mAB cetuximab-protamine / free protamine-SMCC conjugate internalized with ibrutinib-Cy3.5. A. CD20-positive HBL-1 DLBCL cells internalized with the αCD20-mAB-protamine / free protamine-SMCC / ibrutinib-Cy3.5 complex. Left: nuclear staining, right: gray dots = Cy3.5. B. EGFR-positive A549 NSCLC cells internalized with the αEGFR-mAB-protamine / free protamine-SMCC / ibrutinib-Cy3.5 complex. Left: nuclear staining, right: gray dots = Cy3.5. α, anti.

[0070] Figure 52BTK kinase was covalently labeled in vitro using an ibrutinib-Cy3.5 conjugate (αCD20-mAB-P / ibrutinib-Cy3.5) transported via a rituximab-protamine / free protamine-SMCC carrier molecule. 10 5 Cells were treated overnight with the compound at the indicated concentration, lysed in a loading dye, and run on a gel. The gel was exposed to UV light on a SYBR Gold filter (left) for Cy3.5 emission on an INTAS gel imaging system, then blotted and incubated with anti-BTK-mAB for recognition (right). RTX, rituximab. Intracellular BTK binds to free ibrutinib-Cy3.5 and antibody-protamine-complexed ibrutinib-Cy3.5.

[0071] Figure 53 αCD20-mAB (rituximab)-protamine / free protamine conjugate and αEGFR-mAB cetuximab-protamine / free protamine conjugate transport ibrutinib-Cy3.5 and inhibit colony formation more effectively than ibrutinib-Cy3.5 or the antibody alone. A. and B. Colony formation analysis. Compared with cells treated with PBS, unrecombined ibrutinib-Cy3.5, or cells treated with αCD20 mAB-(rituximab) protamine / free protamine-SMCC / ibrutinib-Cy3.5, HBL-1 cells (A) treated with αCD20-mAB-(rituximab) protamine / free protamine-SMCC / ibrutinib-Cy3.5 and A549 cells (B) treated with αEGFR mAB-(cetuximab) protamine / free protamine-SMCC / ibrutinib-Cy3.5 formed significantly fewer colonies in methylcellulose. Mean ± SD of three independent experiments are shown here. Asterisks indicate significant differences (p < 0.05, two-tailed t-test). α, anti.

[0072] Figure 54After depletion of free protamine-SMCC by HPLC, the αCD20-mAB rituximab-protamine conjugate did not effectively bind ibrutinib-Cy3.5. A. Coomassie-stained SDS-PAGE showed the HPLC fractions of αCD20-mAB, αCD20-mAB conjugated with 32x protamine-SMCC, and αCD20-mAB conjugated with 32x protamine-SMCC after depletion of unbound SMCC-protamine (19-25 / 26); HC = heavy chain, LC = light chain, -P = protamine-SMCC. B. Band transfer analysis with protamine-depleted (left) and protamine-containing αCD20-mAB formulation (right). The αCD20-mAB formulation without protamine-SMCC depletion bound >32 mol of ibrutinib-Cy3.5. C. Colony formation analysis. HBL-1 cells treated with αCD20-mAB-protamine / free protamine-SMCC / ibrutinib-Cy3.5 formed significantly fewer colonies in soft agar compared to cells treated alone with unconjugated ibrutinib-Cy3.5 or unconjugated αCD20-mAB. No difference in colony formation was observed when HBL-1 cells were treated with the αCD20-mAB-protamine conjugate without free protamine-SMCC compared to PBS-treated cells (see A+B, grade 25). Mean ± SD from three independent experiments is shown here. *P < 0.0003, two-tailed T-test. α, anti.

[0073] Figure 55 The αCD20-mAB rituximab-protamine / free protamine-SMCC conjugate effectively coordinates and transports ibrutinib-Cy3.5 to the tumor site in vivo, significantly reducing tumor growth. A. Tumor growth and treatment regimen in an NSG-HBL1 xenograft model. Post-transplantation, the tumor grew to 200 mm. 3 Before treatment began, intraperitoneal injections were administered twice weekly. B. Treatment with the rituximab-protamine / free protamine / ibrutinib-Cy3.5 1:20 complex (4 mg / kg mouse body weight, or 0.625 nmol of rituximab-protamine and / or 12.5 nmol of ibrutinib derivative per single dose) (Figure = rituximab-ibrutinib-Cy3.5 (C) or rituximab-P / ibrutinib-Cy3.5 (B)) significantly reduced tumor volume and growth. Tumor volume was assessed by caliper measurement twice weekly on each treatment day. In the rituximab-protamine / free protamine / ibrutinib-Cy3.5 1:20 complex treatment group, tumor volume was limited to well below 1,000 mm. 3 And after three treatments, it began to shrink to 600mm. 3All other groups exhibited rapid tumor growth and had to be euthanized prematurely under predefined criteria. C. Survival curves of treatment and control groups. Ten mice in each group were treated with PBS, rituximab, ibrutinib standard, ibrutinib-Cy3.5, and rituximab-protamine / free protamine / ibrutinib-Cy3.5 1:20 complex. Eight days after the start of treatment, ibrutinib-Cy3.5 failed to reduce tumor growth, and all mice had to be euthanized due to predefined criteria. Mice treated with PBS and rituximab did not show a significant increase in lifespan to day 16, and the last of the ten mice treated with ibrutinib had to be euthanized on day 20. Five of the ten mice treated with ibrutinib-protamine / free protamine / ibrutinib-Cy3.5 1:20 complex survived until day 16 after the start of treatment, and four of them survived until day 20. The difference between the rituximab-protamine / free protamine / ibrutinib-Cy3.5 treatment group and the control group was assessed as p≤0.03 (ANOVA). α, anti, RTX, rituximab.

[0074] Figure 56 Tumors of HBL-1 cells xenografted from NSG mice showed significant enrichment of Cy3.5 fluorescence signal in mice treated with rituximab-protamine / free protamine-SMCC / ibrutinib-Cy3.5. After reaching intolerable tumor size, the cells were then... Figure 55 In the experiments shown, xenograft mice were sacrificed, and organs and tumors were prepared and exposed to ex vivo fluorescence detection of Cy3.5 signals under excitation at 530 nm and emission at 600 nm. Compared to untargeted ibrutinib-Cy3.5 and standard ibrutinib, all portions of tumor tissue from the rituximab-P / free P / ibrutinib (=Rtx / ibrutinib-Cy3.5 in the figure) treatment group (bottom row) showed significant enrichment of Cy3.5-dependent fluorescence signals, while in the control organs, only necrotic lesions showing autofluorescence were detected. The diameter of the tumor preparations shown was similar in all cases, but the fluorescent regions differed. The scale bar represents arbitrary units of fluorescence. The dashed line represents the outer boundary of each tumor. The numbers indicate the identifier of a single mouse.

[0075] Figure 57 An overview of Cy3.5 fluorescence analysis of different mouse organs from NSG mice xenografted from HBL1 mice. After reaching intolerable tumor size, [the following was observed]: Figure 55 and 56In the experiments shown, xenograft mice were sacrificed, and organs and tumors were prepared and exposed to ex vivo fluorescence detection of Cy3.5 signals under 530 nm excitation and 600 nm emission. Tumors from the rituximab-P / free P / ibrutinib (in the figure = Rtx / ibrutinib-Cy3.5) treatment group (bottom row) showed a significant enrichment of Cy3.5-dependent fluorescence signal compared to untargeted ibrutinib-Cy3.5. The scale bar represents arbitrary units of fluorescence. (As shown in the schematic diagram on the right) Organs are always aligned in the same orientation in both bright field (top inset) and red (Cy3.5) fluorescence (bottom inset).

[0076] Figure 58 Formation of rituximab αCD20-mAB-protamine / free SMCC-protamine nanovesicles with green fluorescent Alexa488-siRNA and / or red fluorescent ibrutinib-Cy3.5 on a chamber slide after overnight cell-free incubation (o / n). A.-C. Green fluorescent channels, D.-F. Red fluorescent channels. A. and D. αCD20-mAB-P / free P with green Alexa488-siRNA, B. and E. αCD20-mAB-P / free P with red fluorescent ibrutinib-Cy3.5, C. and F. αCD20-mAB-P / free P with both green Alexa488-siRNA and red ibrutinib-Cy3.5, 40x magnification, scale bar = 10 μm. All rituximab-protamine formulations contain unbound protamine-SMCC. α, anti.

[0077] Figure 59 Formation of cetuximab αEGFR-mAB-protamine / free protamine-SMCC conjugates with green fluorescence Alexa488-siRNA and / or red fluorescence ibrutinib-Cy3.5 on a chamber slide after overnight cell-free incubation (o / n). A.-D. Green fluorescence channels, EH. Red fluorescence channels. A. and E. cetuximab αEGFR-mAB-P / free protamine-SMCC with green fluorescent Alexa488-siRNA; B. and F. cetuximab αEGFR-mAB-P / free protamine-SMCC with red fluorescent ibrutinib-Cy3.5; C. and G. αEGFR-mAB-P with non-fluorescent control siRNA (scr, mixed) and red fluorescent ibrutinib-Cy3.5; D. and H. αEGFR-mAB-P with non-fluorescent Alexa488-siRNA and red fluorescent ibrutinib-Cy3.5, 40x magnification, scale bar = 10 μm. All cetuximab protamine formulations contain unbound protamine-SMCC. α, anti.

[0078] Figure 60 Formation of cetuximab αEGFR-mAB-protamine / free protamine-SMCC (AB) and rituximab anti-CD20-mAB-protamine / free protamine-SMCC (CD) conjugates with green fluorescent Alexa488-siRNA and red fluorescent ibrutinib-Cy3.5 on a chamber slide after overnight cell-free incubation (o / n). 40x magnification of the green and red fluorescent channels. In A and C, the green fluorescent edge (Alexa488-siRNA) is visible, while in B and D, red internal fluorescence (ibrutinib-Cy3.5) is visible. All antibody-protamine formulations contain unbound protamine-SMCC.

[0079] Figure 61 Determination of particle size in different complex forms of αCD20-mAB rituximab-protamine / free protamine-SMCC with siRNA and ibrutinib-Cy 3.5. Illustration of the mean diameter (nm) shown in AB-E. Zetaview measurements of the complexes shown were performed at 1 hour and 2 hours after the start of incubation. The mean vesicle size (nm) shown here is determined by the mean diameter of each particle depicted by the histogram in BE. All rituximab-protamine formulations contain unbound protamine-SMCC. α, anti.

[0080] Figure 62A: Ibrutinib-Alexa488 conjugate with αCD20-mAB rituximab-protamine / free protamine-SMCC (αCD20-mAB-P / P). Band transfer analysis was performed using different ratios of ibrutinib-Alexa488 up to 1:2 with αCD20-mAB-protamine / P. B: Due to the limited anionic charge of -2 (arrow) of the Alexa488 molecule, the interaction between the polycationic protamine fusion and Alexa488 was found to be less strong than its interaction with Cy 3.5 (which has a net charge of -4). A conjugation ratio of only 2:1 was achieved using the Alexa488-conjugated ibrutinib and protamine conjugate. However, the conjugation of ibrutinib-Alexa488 with αCD20-mAB rituximab-protamine / free protamine-SMCC (αCD20-mAB-P / P) was still successful. CH: Stability of αCD20-mAb-protamine, free protamine, and ibrutinib-Cy 3.5 at a 1:20 ratio for 1 h after self-assembly, followed by incubation for 24 h under challenging conditions such as RPMI / 10% FCS (E,F) and PBS / 50% FCS (G,H). C, E, G: Cy3.5 fluorescence; D, F, H: phase contrast. α, anti.

[0081] Figure 63 Charged ibrutinib-Cy 3.5, rather than uncharged ibrutinib (trade name: imbruvica), forms stable nanoparticles with various protamine-conjugated mAbs. Compared to uncharged ibrutinib, charged ibrutinib-Cy 3.5 was loaded onto corresponding antibody carriers containing free SMCC-protamine via SMCC-protamine conjugation. Only those ibrutinib samples conjugated with Cy 3.5 showed dense nanoparticle formation, while uncharged ibrutinib did not. Anti-EGFR antibody (AD), anti-CD33 antibody (EH), and anti-IGF1R antibody (IL) were tested in Cy 3.5-dependent fluorescence micrographs (top) and phase contrast (bottom). α, anti.

[0082] Figure 64 : A cross-sectional illustration of an ideal example of a nanoparticle-like structure that satisfies the conditions for an effective antibody-protamine-siRNA or ibrutinib-Cy 3.5 carrier complex derived from our experiments. The illustration is not drawn to scale. An electrostatic binding bridge is formed between mAB (some of which contains protamine conjugated to the targeting antibody) and the corresponding anionic cargo, which includes siRNA (A) and ibrutinib-Cy 3.5 (B) or both (C).

[0083] Figure 65 Electrostatic nanoparticles were formed using αCD20-mAB-protamine / free protamine-ibrutinib-Cy 3.5. Anionic ibrutinib-Cy 3.5 was loaded onto a carrier antibody-protamine conjugate at a 1:20 ratio and applied to cell culture-treated slides for fluorescence microscopy (A, B) or to a copper grid for phosphorus-Wolfram negative staining electron microscopy (C). Here, electrostatic loading resulted in the formation of numerous aggregates, with larger aggregates exhibiting strong Cy3.5 fluorescence (A) and visible in optical microscopy using an embossed dynamic filter to illustrate the 3D structure through contrast enhancement (B). In transmission electron microscopy (C), negative staining resulted in approximately the same particle size range but revealed the presence of numerous smaller vesicles undetectable in optical microscopy (C). α, anti.

[0084] Figure 66 : Ibrutinib-Cy3.5 conjugate with αCD20-mAB-P / P-targeting targets Bruton's kinase BTK cellularly. AF: Fluorescence microscopy of HBL1 DLBCL cells treated with the targeting conjugate and control showed significant intracellular enrichment of Cy 3.5 signal. G: Lysates from cells treated with the targeting conjugate and control for 72 hours were subjected to SDS-PAGE and irradiated with Cy 3.5 signal. Here, a clear 70 kDa band identified as BTK by parallel immunoblotting was covalently labeled with ibrutinib-Cy3.5, indicating the binding and functionality of the resulting ibrutinib-Cy3.5 derivative. HP: Fluorescence microscopy of HBL1 DLBCL cells pretreated with ibrutinib-fluoroboropyrrole (green, N, and P) showed no intracellular enrichment of Cy 3.5 signal after treatment with αCD20-mAB-P / P-ibrutinib-Cy 3.5 (M, compared to L). α, anti.

[0085] Figure 67Physiological and functional results of BTK inactivation in DLBCL cell lines treated with αCD20-mAB-protamine / free protamine-ibrutinib-Cy 3.5. A: HBL1 cells were treated with the corresponding conjugates shown for 72 h, lysed, and subjected to SDS-PAGE and Western blotting for phosphate-BTK (pBTK), total phosphate-BTK (tBTK), phosphate-ERK (p-ERK), total phosphate-ERK (t-ERK), and actin as a loading control. Here, the non-targeted ibrutinib-Cy 3.5 inhibited BTK phosphorylation to a slightly lesser extent than αCD20-mAB-protamine-ibrutinib-Cy 3.5, and the difference in downstream phosphorylation targets (such as ERK) was expected to be more significant: here, only αCD20-mAB-P / P-mediated ibrutinib-Cy 3.5 treatment reduced ERK phosphorylation. B: In colony formation analysis, untargeted ibrutinib-Cy 3.5 moderately reduced HBL1 cell colony growth, while specific targeting of ibrutinib-Cy 3.5 by αCD20-mAB-P / P resulted in a colony growth reduction of less than 30%. To demonstrate the importance of free protamine in the conjugate construct, we depleted free protamine from the conjugate mixture. Application of this combination, compared to ibrutinib-Cy 3.5 alone, revealed no further reduction in colony formation, indicating that the antibody conjugate lost its targeting ability (B, rightmost column). α, anti.

[0086] Figure 68 BTK-targeted apoptosis was induced in the DLBCL cell line HBL1 by treatment with ibrutinib-Cy 3.5 conjugates of αCD20-mAB-P / P. HBL1 cells were treated with the corresponding conjugates shown for 72 h and stained with Annexin V. Apoptotic cells were detected by flow cytometry by Annexin V expression (top inset, X-axis), and increased fluorescence of internalized ibrutinib-Cy 3.5 was observed on the Y-axis (top inset), particularly in cells treated with ibrutinib-Cy 3.5 conjugates of αCD20-mAB-P / P. Counts were made from gating values ​​at the top right and bottom right. Bottom inset: Summary of Annexin V positive cells from three independent experiments. P < 0.05, two-sided T-test. α, anti.

[0087] Figure 69Ewing sarcoma xenograft tumor growth was inhibited after systemic treatment with αIGF1R-mAB-protamine / free protamine-siRNA-protamine nanocarriers to knock out the oncogenic EWS-FLI1 translocation product. A. Treatment regimen in vivo. Nanoparticles were administered intraperitoneally as shown. B. Results of systemic in vivo application of the targeted nanocarriers to SK-N-MC xenograft tumors. B. Tumor growth curves of SK-N-MC treated with αIGF1R-mAB tetromumab (“Tepro”)-protamine / PsiRNA nanoparticles (mean ± SEM; two-sided t-test, *p < 0.05). C. Weight statistics of tumors resected at the end of the experiment (mean ± SD; two-sided t-test, *p < 0.05). α, anti.

[0088] Figure 70 Nanoparticles formed from carrier antibody-protamine / free protamine and siRNA exhibit a near-neutral surface charge. The nanoparticles were formed for 2 hours as described elsewhere in this document, followed by dynamic light scattering (DLS) analysis (Malvern Zeta-sizer). Depending on the antibody conjugate formulation, the particle size ranged from 350 to 750 nm with an indicated bias. More importantly, the zeta potential of the particle surface was only slightly negative to neutral.

[0089] Figure 71 Deciphering the prerequisites for effective nanoparticle formation between the anti-EGFR-mAB-SMCC-protamine conjugate, free SMCC-protamine, and siRNA. AG. Vesicle formation with 60 nM αEGFR-mAB-P in the presence of 32x SMCC-protamine and Alexa488-control-siRNA at a molar ratio increased to antibody concentration (1:0.6–1:40). Vesicle formation (DE) was observed with 5–10x molar excess siRNA. Top inset: Fluorescence microscopy of Alexa488-siRNA-positive vesicles. Bottom inset: Phase difference of the same formulation as the top inset. α, anti.

[0090] Figure 72 Nanoparticles formed from αEGFR-mAB-protamine / free protamine-Alexa488-siRNA are stable under serum-containing conditions. Stability was assessed by incubation in PBS (A) and PBS / 50% FCS (B) for 24 hours after self-assembly of αEGFR-mAB-protamine, free protamine, and Alexa488-siRNA at a 1:10 ratio for 2 hours.

[0091] Figure 73Serum stability of αCD20-mAB-protamine / free p-ibrutinib-Cy 3.5 nanocarrier. AF. Stability of αCD20-mAB-protamine, free protamine, and ibrutinib-Cy 3.5 at a 1:20 ratio after 2 h of self-assembly in PBS (A,D) and challenging conditions such as RPMI / 10% FCS (B,E) and PBS / 50% FCS (C,F) for 24 h (AC) or 72 h (DF). AF: Cy 3.5 fluorescence microscopy, α, anti-.

[0092] Figure 74 pH stability of siRNA nanocarriers constructed using three different targeting antibodies. Under standard conditions, nanocarriers consisting of αEGFR-mAB-protamine / free protamine (top inset), αIGF1R-mAB-protamine / free protamine (middle inset), and αCD33-mAB-protamine / free protamine (bottom inset) were formed at room temperature for 2 hours. Each nanocarrier contained a 10-fold molar excess of siRNA. The nanocarriers were then diluted 30-fold in their respective buffer solutions for pH stability testing on chamber slides for 24 hours. The slides were then washed, mounted, and examined under a fluorescence microscope. The nanocarriers were stable at pH values ​​between 5.2 and 8.0, exhibiting a tendency to aggregate at lower pH values.

[0093] Figure 75 pH stability of nanocarriers constructed using αCD20-mAB-protamine / free protamine and ibrutinib-Cy3.5. Nanocarriers formed from αCD20-mAB-protamine / free protamine with a 20-fold molar excess of ibrutinib-Cy3.5 were formed at room temperature under standard conditions for 2 hours. The nanocarriers were then diluted 30-fold in the corresponding buffer solution for pH stability testing on chamber slides for 24 hours. The slides were then washed, mounted, and examined under a fluorescence microscope. The nanocarriers were stable at pH values ​​between 5.8 and 8.0, showing a tendency to disintegrate at lower pH values.

[0094] Figure 76Immunolabeling of targeting IgG antibodies in αEGFR-mAB-P / free protamine-siRNA nanocarriers. Nanocarriers were formed by self-assembly (αEGFR-P / free protamine + Alexa488-siRNA (green in A and D)) for 2 hours, fixed on treated glass surfaces (A, E), stained with αhIgG-Alexa 647 (AC), washed with PBS, mounted with DAKOFluo mounting medium, and examined by fluorescence microscopy. The nanocarrier structures showed significant staining of Alexa 647 targeting αEGFR antibodies only on the surface areas (BC). F. Schematic overview of the staining procedure. α, anti.

[0095] Figure 77 Immunolabeling of targeting IgG antibodies in αIGF1R-mAB-P / free protamine siRNA nanocarriers. Nanocarriers were formed via self-assembly (tetramumab-protamine + Alexa488-siRNA (green)) for 2 hours, fixed on treated glass surfaces (A, D), stained with αhIgG-Alexa 647 (AC), washed with PBS, mounted with DAKO Fluo mounting medium, and examined under a fluorescence microscope. The nanocarrier structures showed significant staining of Alexa 647 targeting tetramumab antibodies only on the surface areas (BC). F. Schematic overview of the staining procedure. α, anti.

[0096] Figure 78 Visualization of free protamine in the nanocarrier complex. Here, an αEGFR-mAB-protamine formulation, in which free protamine was depleted by size exclusion chromatography and the formulation was reconstituted with free protamine, was labeled with a Cy3 chromophore. A: Protamine was conjugated with Cy3-NHS ester according to the manufacturer's recommendations and purified by spin column. The resulting protamine-Cy3 exhibited strong Cy3-dependent fluorescence and was concentrated in a manner comparable to the unconjugated material, thus it was reconstituted into antibody-protamine with a typical 32-fold molar excess (B). The siRNA nanocarrier formed from this reconstituted material with unlabeled siRNA showed a strong Cy3-dependent fluorescence signal of protamine in the cavity of the nanostructure (C). In contrast, the same nanostructure stained with αhIgG-Alexa 647 antibody for α-human IgG signal revealed edge structures stained to antibody site positive (D). E: The highlighted portions in C and D are combined and magnified at higher magnification. F: Higher magnification of the highlighted portion in E. α, anti.

[0097] Figure 79 Synthesis of gefitinib, gemcitabine and venetoclax, inhibitors of anthocyanin dyes.

[0098] Figure 80 Extend this concept to the more readily available and cheaper polyanionic molecular components. Detailed Implementation

[0099] The inventors of this application have surprisingly discovered that... The improved conjugation scheme of the antibody-protamine conjugate described in N. et al., 2016, Nat. Protoc. 11, 22-36, resulted in the formation of nanoparticles containing the antibody-protamine conjugate and negatively charged cargo molecules to be delivered to the target.

[0100] The formation of composite nanoparticles containing a targeting moiety chemically conjugated with protamine, free protamine, and negatively charged cargo molecules (such as siRNA) can be used for cell-type-specific therapeutic delivery of siRNA and other effector drugs that can selectively block oncogenic pathways.

[0101] In the conjugation scheme of this invention, two steps are improved. First, an antibody-protamine conjugation step is performed using an antibody and an SMCC-protamine conjugate that is substantially free of free sulfonyl-SMCC. As described above... In the scheme described by N. et al., 2016 Nat. Protoc. 11, 22-36, free sulfonyl-SMCC is present in the conjugation step and is removed only after the conjugation step. Secondly, for the step of loading siRNA onto the antibody-protamine conjugate, the antibody-SMCC conjugate and siRNA are brought into contact with each other in the presence of a certain amount of free protamine. Surprisingly, this improved method forms large particles containing the antibody-protamine conjugate, free protamine, and siRNA.

[0102] The inventors of this application also surprisingly discovered that, compared with using the aforementioned solution ( Compared to conjugates produced by N. et al. (2016 Nat. Protoc. 11, 22-36), these nanoparticles provide more efficient binding and transport of siRNA.

[0103] The nanostructures produced by the method of this invention are significantly larger than linear single antibody-protamine-siRNA complexes and can be detected as vesicle structures by optical microscopy. The inventors of this application have discovered that a certain amount of unbound protamine is required to form these nanoparticles and effectively target the corresponding cells. Then, the intended target (oncogene) is specifically knocked down. As shown in Examples 6, 15, and 18-21, positively charged nanostructures (micelles) can also serve as carriers for other negatively charged small molecules, which are also transported to the corresponding cells in a targeted and efficient manner. Using this method, therapeutic molecules such as siRNA can not only be effectively formed into electrostatic nanostructures but can also be encapsulated within the nanostructures.

[0104] Since most advanced and metastatic cancers were incurable at the time of this invention, there was a strong need for new, more effective, and better-tolerated treatment options. Nanoparticles containing a targeting component (such as a cancer cell-specific antibody with chemically bound SMCC-protamine) and free protamine can transport negatively charged molecules (such as siRNA) and other small molecules that are not taken up by eukaryotic cells. Because siRNA can be specifically defined for any gene, this system is potentially applicable to a wide range of diseases, including cancer, neurodegeneration, and viral infections.

[0105] Therefore, this application relates to a method for generating nanoparticles, the method comprising (c) contacting an antibody with a composition comprising a first conjugate (A), the first conjugate comprising a positively charged polypeptide conjugated to a bifunctional linker, characterized in that the composition is substantially free of unconjugated bifunctional linkers, thereby obtaining a second conjugate (B), the second conjugate comprising the positively charged polypeptide, the bifunctional linker and the antibody; and (d) contacting the second conjugate (B), the positively charged polypeptide and a negatively charged molecule to form nanoparticles.

[0106] As used herein, “first conjugate” refers to a conjugate comprising or preferably composed of a positively charged polypeptide conjugated to a bifunctional linker.

[0107] In the method of this disclosure, (c) is the conjugation step, wherein the antibody is conjugated with the first conjugate. (The last sentence appears to be incomplete and possibly refers to a different method.) Unlike the method previously described in N. et al., 2016 Nat. Protoc. 11, 22-36, the composition containing the first conjugate used in this step is substantially free of unconjugated bifunctional linkers. Consistent with this, the conjugation in step (c) is preferably carried out in a composition substantially free of unconjugated bifunctional linkers.

[0108] In step (c), preferably, the first conjugate is in molar excess compared to the antibody, meaning that there are preferably more first conjugate molecules than antibody molecules. In some embodiments, the molar ratio between the first conjugate and the antibody in step (c) is at least about 10:1, preferably at least about 15:1, and more preferably at least about 20:1. In some embodiments, the molar ratio between the first conjugate and the antibody is up to about 50:1, preferably up to about 45:1, and more preferably up to about 40:1. In some embodiments, the molar ratio between the first conjugate and the antibody in step (c) is in the range of about 10:1 to 50:1, preferably from about 15:1 to about 45:1, and more preferably from about 20:1 to about 40:1. In a preferred embodiment, the molar ratio between the first conjugate and the antibody is approximately 20:1, approximately 21:1, approximately 22:1, approximately 23:1, approximately 24:1, approximately 25:1, approximately 26:1, approximately 27:1, approximately 28:1, approximately 29:1, approximately 30:1, approximately 31:1, approximately 32:1, approximately 33:1, approximately 34:1, approximately 35:1, approximately 36:1, approximately 37:1, approximately 38:1, approximately 39:1, or approximately 40:1.

[0109] In the method of this disclosure, in step (d), the second conjugate, the positively charged polypeptide, and the negatively charged molecule are brought into contact with each other. It is not intended to be theoretically correct to assume that the three components self-assemble to form nanoparticles. In this document, the second conjugate is the one formed in step (c).

[0110] When referring to a positively charged polypeptide in the context of step (d), the expression encompasses both a free positively charged polypeptide and a conjugate of a positively charged polypeptide (such as a positively charged polypeptide conjugated with a linker). The positively charged polypeptide in step (d) can be the first conjugate as in step (c), or it can be another molecule different from the first conjugate in step (c). For example, in the context of step (d), the term "positively charged polypeptide" can encompass both (free) protamine and SMCC-protamine. In the context of step (d), the term also encompasses mixtures of different positively charged polypeptides, including mixtures of positively charged polypeptides and conjugates of positively charged polypeptides.

[0111] In some embodiments, the positively charged polypeptide of step (d) is the first conjugate of step (c). As an illustrative example, the positively charged polypeptide of step (d) is SMCC-protamine, and the first conjugate of step (c) is also SMCC-protamine. If the positively charged polypeptide of step (d) is the first conjugate of step (c), the composition formed in step (c) can be used in step (d) without the need for the step of separating the second conjugate formed in step (c) from the "residual" positively charged polypeptide (which includes the "residual" first conjugate in this context).

[0112] In some embodiments, the positively charged polypeptide in step (d) is different from the first conjugate in step (c). As an illustrative example, the positively charged polypeptide in step (d) is (free) protamine, while the first conjugate in step (c) is SMCC-protamine. In this case, the method may include a step after step (c) and / or before step (d) to separate the second conjugate from the first conjugate. The method may also include the addition of the positively charged polypeptide in and / or before step (d).

[0113] In the context of step (d), preferred positively charged polypeptides include, but are not limited to, protamine, SMCC-protamine, histone subunits, histone subunits conjugated to SMCC, or mixtures thereof with protamine, preferably SMCC-protamine or mixtures thereof, more preferably protamine or SMCC-protamine.

[0114] In step (d), preferably, the positively charged polypeptide is in molar excess compared to the second conjugate, meaning that there are preferably more positively charged polypeptide molecules than the second conjugate molecules. In some embodiments, the molar ratio between the positively charged polypeptide and the second conjugate in step (d) is at least about 10:1, preferably at least about 15:1, and more preferably at least about 20:1. In some embodiments, the molar ratio between the positively charged polypeptide and the second conjugate is up to about 50:1, preferably up to about 45:1, and more preferably up to about 40:1. In some embodiments, the molar ratio between the positively charged polypeptide and the second conjugate in step (d) is in the range of about 10:1 to 50:1, preferably from about 15:1 to about 45:1, and more preferably from about 20:1 to about 40:1. In a preferred embodiment, the molar ratio between the positively charged polypeptide and the second conjugate is about 20:1, about 21:1, about 22:1, about 23:1, about 24:1, about 25:1, about 26:1, about 27:1, about 28:1, about 29:1, about 30:1, about 31:1, about 32:1, about 33:1, about 34:1, about 35:1, about 36:1, about 37:1, about 38:1, about 39:1, or about 40:1.

[0115] In step (d), preferably, the negatively charged molecules are in molar excess compared to the second conjugate, meaning that there are preferably more negatively charged molecules than the second conjugate molecules. In some embodiments, the molar ratio between the positively charged polypeptide and the second conjugate in step (d) is at least about 10:1, at least about 15:1, at least about 20:1, at least about 25:1, at least about 30:1, at least about 40:1, at least about 50:1, at least about 70:1, at least about 100:1, at least about 150:1, at least about 200:1, at least about 250:1, at least about 300:1, at least about 400:1, or at least about 500:1.

[0116] In step (d), preferably, the negatively charged molecules are equimolar or in excess of the positively charged polypeptide, meaning that there are preferably approximately the same number or more of negatively charged molecules as the positively charged polypeptide molecules. In some embodiments, the molar ratio between the negatively charged molecules and the positively charged polypeptide in step (d) is at least about 1:1, at least about 2:1, at least about 3:1, at least about 4:1, at least about 5:1, at least about 6:1, at least about 7:1, at least about 8:1, at least about 9:1, at least about 100:1, at least about 20:1, at least about 30:1, at least about 40:1, at least about 50:1, at least about 60:1, at least about 70:1, at least about 80:1, at least about 90:1, or at least about 100:1.

[0117] The methods disclosed herein can be carried out over a wide temperature range. Embodiments of this application show that nanoparticles can be formed at approximately 4°C, room temperature, and 37°C. Therefore, it is contemplated that the methods of this disclosure (including, for example, steps (c) and / or (d)) can be carried out at temperatures ranging from approximately 1°C to approximately 60°C, preferably from approximately 2°C to approximately 50°C, preferably from approximately 3°C to approximately 40°C, and more preferably from approximately 4°C to approximately 37°C. Thus, step (d) can be carried out at temperatures ranging from approximately 1°C to approximately 60°C, preferably from approximately 2°C to approximately 50°C, preferably from approximately 3°C to approximately 40°C, and more preferably from approximately 4°C to approximately 37°C.

[0118] It is conceivable that step (d) preferably includes an incubation step that allows for the formation of nanoparticles. Preferably, the incubation step is performed for at least about 1 hour, preferably at least about 1.5 hours, and preferably at least about 2 hours. Preferably, the incubation step is performed for up to about 48 hours, preferably up to about 24 hours, preferably up to about 18 hours, preferably up to about 12 hours, preferably up to about 10 hours, preferably up to about 9 hours, preferably up to about 8 hours, preferably up to about 7 hours, and preferably up to about 6 hours. Preferably, the incubation step is performed for about 1 hour to about 48 hours, preferably about 1 hour to about 24 hours, preferably about 1 hour to about 18 hours, preferably about 1 hour to about 12 hours, preferably about 1 hour to about 10 hours, preferably about 1 hour to about 9 hours, preferably about 1.5 hours to about 8 hours, preferably about 1.5 hours to about 7 hours, and preferably about 2 hours to about 6 hours. It is not desirable to be bound by theory, but it is believed that incubation within about 2 hours to about 6 hours can achieve optimal results. Therefore, in the preferred embodiment, the steps include approximately 2 hours to approximately 6 hours, including approximately 2 hours, approximately 2.1 hours, approximately 2.2 hours, approximately 2.3 hours, approximately 2.4 hours, approximately 2.5 hours, approximately 2.6 hours, approximately 2.7 hours, approximately 2.8 hours, approximately 2.9 hours, approximately 3 hours, approximately 3 hours, approximately 3.1 hours, approximately 3.2 hours, approximately 3.3 hours, approximately 3.4 hours, approximately 3.5 hours, approximately 3.6 hours, approximately 3.7 hours, and approximately 3.8 hours. Incubation steps at approximately 3.9h, 4h, 4.1h, 4.2h, 4.3h, 4.4h, 4.5h, 4.6h, 4.7h, 4.8h, 4.9h, 5h, 5.1h, 5.2h, 5.3h, 5.4h, 5.5h, 5.6h, 5.7h, 5.8h, 5.9h, and 6h.

[0119] Prior to step (c), the method of this disclosure may further include steps (a) conjugating a positively charged polypeptide to a bifunctional linker and (b) removing unconjugated linkers.

[0120] As used herein, the term "removal of unconjugated linkers" refers to any step suitable for separating a conjugate of a positively charged polypeptide and a bifunctional linker (i.e., the first conjugate) from an unconjugated linker. Such methods are well known to those skilled in the art and include, but are not limited to, filtration, dialysis, gel filtration, chromatography, or electrophoresis.

[0121] As used herein, the term "conjugation" (or "conjugate") refers to the linking of two or more molecules together by all forms of covalent connection, including but not limited to chemical conjugation. Therefore, conjugation can include the conjugation of at least a portion of a linker to a polypeptide. Such connection can be achieved through different reactive groups or through the same reactive group.

[0122] Functional groups on peptides that can be targeted for cross-linking include primary amines, thiol groups, carbonyl groups, hydroxyl groups, carbohydrates, carboxylic acids, etc., preferably targeted for cross-linking via amines and / or thiol groups and / or carboxyl groups. In some embodiments, the linker is conjugated to the peptide via the NH2- group of the peptide. In some embodiments, the linker is conjugated to the peptide via the thiol group of the peptide. In some embodiments, the linker is conjugated to the peptide via the carboxyl group of the peptide. Methods for chemically conjugating linkers (or cross-linking agents) to peptides are well known to those skilled in the art.

[0123] Prior to step (c), the method of this disclosure may further include a step of purifying the antibody. Such a purification step may be a desalting step. Such desalting methods are well known to those skilled in the art and include, but are not limited to, gel filtration or dialysis.

[0124] The method disclosed herein may further include the step of separating and / or recovering the nanoparticles obtained in step (c) from components of its production environment. Preferably, after separation and / or recovery, the nanoparticles do not associate with, or substantially do not associate with, any other components from its production environment. Contaminant components of its production environment are materials that typically interfere with the use of the nanoparticles, particularly their therapeutic use, and these contaminant components may include free second conjugates (i.e., second conjugates not contained in the nanoparticles), free positively charged peptides (i.e., not contained in the nanoparticles), or free negatively charged molecules (i.e., not contained in the nanoparticles). By weight, the nanoparticles may, for example, constitute at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, or at least about 45% of the total protein in a given sample. In a preferred embodiment, the nanoparticles, by weight, constitute at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, and at least about 85% of the total protein in a given sample. In a preferred embodiment, the nanoparticles, by weight, constitute at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the total protein in a given sample. It should be understood that, depending on the circumstances, the separated nanoparticles may constitute from about 5% to about 99.9% or about 100% of the total protein content.

[0125] The method disclosed herein may include the following steps:

[0126] Optionally: (a) conjugate a positively charged polypeptide to a bifunctional linker;

[0127] Optionally: (b) Remove unconnected bifunctional connectors;

[0128] Optional: Purify antibodies;

[0129] (c) Contacting an antibody with a composition comprising a first conjugate (A), the first conjugate comprising a positively charged polypeptide conjugated to a bifunctional linker, characterized in that the composition is substantially free of unconjugated bifunctional linkers, thereby obtaining a second conjugate (B) comprising the positively charged polypeptide, the bifunctional linker and the antibody;

[0130] Optional: Determine protein content;

[0131] Optionally; preferably, antibody functionality is assessed by flow cytometry;

[0132] (d) Contacting the second conjugate (B), the positively charged polypeptide, and the negatively charged molecule to form nanoparticles; and / or

[0133] Optionally: recover and / or separate the nanoparticles.

[0134] As used herein, the term "peptide" refers to a compound consisting of a single chain of amino acid residues linked by peptide bonds. The term "protein" as used herein is synonymous with the term "peptide," or may refer to a complex of two or more peptides. A peptide as used herein may contain at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 600, at least about 700, or even more amino acids.

[0135] The polypeptides used herein are preferably composed of naturally occurring and / or proteogenic amino acids. However, peptide mimics in which amino acids and / or peptide bonds have been replaced by functional analogs are also included in this invention. The term polypeptide also refers to, and does not exclude, modifications of polypeptides, such as glycosylation, acetylation, phosphorylation, etc. These modifications are described in detail in basic textbooks and more detailed monographs and research literature.

[0136] The term "positively charged polypeptide" refers to a polypeptide that has a net positive charge at or near physiological pH (e.g., in solutions with pH 4 to 10, 5 to 9, or 6 to 8) and is preferably capable of binding nucleic acids or negatively charged small molecules via electrostatic interactions. Such carriers include, but are not limited to, protamine, histones, or histone subunits. Preferably, such positively charged polypeptides have a net charge of at least 2+, preferably at least 3+, preferably at least 4+, preferably at least 5+, preferably at least 6+, preferably at least 7+, preferably at least 8+, preferably at least 9+, preferably at least 10+, preferably at least 11+, preferably at least 12+, preferably at least 13+, preferably at least 14+, preferably at least 15+, preferably at least 16+, preferably at least 17+, preferably at least 18+, preferably at least 19+, preferably at least 20+. The term "positively charged polypeptide" can include free (i.e., unconjugated) polypeptides as well as conjugated polypeptides, such as polypeptides conjugated to linkers.

[0137] Preferred positively charged polypeptides according to this disclosure comprise protamine. Protamines are small, strongly basic proteins whose positively charged amino acid groups (especially arginine) are typically grouped together and neutralize the negative charge of nucleic acids due to their polycationic nature. As used herein, the term "protamine" refers to any protamine amino acid sequence obtained or derived from a natural or biological source, said biological source comprising fragments thereof and multimeric forms of said amino acid sequence or fragments thereof. Protamines can be of natural origin or produced by recombinant methods. Recombinant methods allow for the production of multiple copies of protamine, or modifications can be made to the molecular size and amino acid sequence of protamine. Responsive compounds can also be chemically synthesized. When synthesizing artificial protamines, the methods used may include, for example, replacing amino acid residues in natural protamines that do not have a transport function (e.g., DNA condensation) with other suitable amino acids. Generally, protamines according to this disclosure can be of any species or derived from any species. The protamines of this disclosure can be derived from mammals, birds, amphibians, reptiles, or fish. The protamine of this disclosure may be selected from or derived from any of the following species: human, dog, cat, mouse, rat, horse, cattle, pig, goat, chicken, sheep, donkey, rabbit, alpaca, llama, goose, ox, turkey, salmon, etc., preferably human or salmon. The protamine of this disclosure may also be a mixture of different protamines. Preferred protamines include salmon protamine. Preferred protamines include human protamine. Preferred protamines comprise a sequence having at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95% sequence identity with the salmon protamine shown in SEQ ID NO:53, or preferably composed of therefrom. Preferred protamines comprise or preferably composed of the salmon protamine shown in SEQ ID NO:53. Preferred protamines comprise a sequence having at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95% sequence identity with the human protamine 1 shown in SEQ ID NO:55, or preferably composed of therefrom. Preferred protamines comprise or preferably consist of human protamine 1 as shown in SEQ ID NO:55.

[0138] As mentioned above, protamine is a strong positively charged protein that also interacts immediately with negatively charged nucleic acids (such as siRNA). To avoid being bound by theory, it is proposed that the uptake of the complex into the cell is mediated by receptor-mediated endocytosis. Further, it is suggested that the antibody binds to the receptor, and the nanoparticles are internalized into cage-like pits via endocytosis. It is also believed that vesicles are transported into the cell, where siRNA is released from the nanoparticles and can enter the RNAi pathway.

[0139] Further preferred positively charged polypeptides according to this disclosure comprise histones or histone subunits. Histones are small DNA-binding proteins present in chromatin that have a high proportion of plateau portions of positively charged amino acids (lysine and arginine), enabling them to bind DNA and fold it into nucleosomes independently of the nucleotide sequence. As used herein, the term "histone" means any histone amino acid sequence derived from or obtained from a natural or biological source, including histone subunits, fragments thereof, and multimeric forms of said amino acid sequence or fragments thereof. Histones H2, H3, and H4 are particularly suitable. Generally, the histones according to this disclosure can be from or derived from any species. The histones of this disclosure can be from mammals, birds, amphibians, reptiles, or fish. The histones of this disclosure can be from or derived from any species selected from: humans, dogs, cats, mice, rats, horses, cattle, pigs, goats, chickens, sheep, donkeys, rabbits, alpacas, llamas, geese, cattle, turkeys, salmon, etc., preferably humans. The histones disclosed herein may also be mixtures of different histones or histone subunits. Preferred histones include human histones. Preferred histones comprise or preferably consist of a sequence having at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity with the human histone H2 shown in SEQ ID NO: 56. Preferred histones comprise or preferably consist of the human histone H2 shown in SEQ ID NO: 56. Preferred histones comprise or preferably consist of a sequence having at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95% sequence identity with the human histone H2-derived peptide shown in SEQ ID NO: 57. Preferred histones comprise or preferably consist of the human histone H2-derived peptide shown in SEQ ID NO: 57. Preferred histones comprise or preferably consist of a sequence having at least about 80%, preferably at least about 85%, preferably at least about 90%, and most preferably at least about 95% sequence identity with the human histone H2-derived peptide shown in SEQ ID NO: 58.

[0140] As used herein, "linker" can refer to a crosslinking agent or crosslinking reagent containing at least two free (i.e., unattached) functional groups. In one embodiment, the method of the present invention comprises a homo- or hetero-bifunctional crosslinking agent having functional groups, including but not limited to carbodiimide, carbonyl, imine ester, isocyanate, maleimide, N-hydroxysuccinimide (NHS)-ester, sulfonyl-NHS-ester, PFP-ester, hydroxymethylphosphine, aryl azide, pyridyl disulfide, and vinyl sulfone. The bonds they form include, but are not limited to, amide bonds, disulfide bonds, hydrazine bonds, thioether bonds, and ester bonds. Functional groups that can be targeted by the linker or crosslinking agent for crosslinking include primary amines, thiol groups, carbonyl groups, hydroxyl groups, carbohydrates, carboxyl groups, etc., preferably amines and thiol groups, most preferably thiol groups. Preferably, the linker does not contain a cleavable disulfide bond (SS). In one embodiment, the linker contains a pH-dependent cleavable side. Linkers can be water-soluble, cell membrane-permeable, have various spacer arm lengths, be spontaneously reactive, or contain photoreactive groups. Furthermore, linkers can be labeled or traced.

[0141] In one implementation, the linker can be directly conjugated to antibodies and positively charged peptides; an example of such a linker is the sulfonyl-SMCC linker. Examples of crosslinking agents include, but are not limited to, N-hydroxysulfosuccinimide (sulfon-NHS), sulfosuccinimide-(perfluoro-azidobenzoamide)ethyl-1,3'-dithiopropionate (sulfon-SFAD), succinimide-4-formylbenzoate (SFB), succinimide-4-hydrazine nicotinate acetone hydrazone (SANH), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), N-succinimide-3-(2-pyridyldithio)propionate (SPDP), 2-iminothione (Traut's reagent), N-succinimide-(acetylthio)acetate (SATA), and 3-[2-pyridyldithio]propionylhydrazine (PDPH), or any other linker available to those skilled in the art and known to them.

[0142] "Heterofunctional" linkers refer to linkers in which the target functional groups are different from each other. In one embodiment, the linker comprises an amine and a thiol, or an amine and a hydroxyl group, as the functional groups targeted for crosslinking, preferably an amine and a thiol. In another embodiment, the method of the present invention includes linkers containing an amine and a thiol as the functional groups targeted for crosslinking. In yet another embodiment, the method of the present invention includes heterobifunctional linkers that do not contain cleavage sites, for example, do not have cleavable disulfide bonds (SS). Preferred heterofunctional linkers are, for example, α-maleimide acetoxy-succinimide ester (AMAS), N(4-[p-azidosalicylamido]butyl)-3'-(2'-pyridyldithio)propionamide (APDP*), (β-maleimide propionic acid) hydrazide·TFA (BMPH), (β-maleimide propoxy)succinimide ester (BMPS), ε-maleimide hexanoic acid (EMCA), (ε-maleimide hexanoyloxy)succinimide ester (EMCS), and (γ-maleimide butyryloxy)succinimide ester (GMBS). κ-maleimide undecanoic acid (KMUA), succinimide-4-(N-maleimide-methyl)cyclohexane-1-carboxy-(6-amidohexanoate) (LC-SMCC), succinimide-6-(3'-[2-pyridyl-dithio]propionamido)hexanoate (LC-SPDP), m-maleimide-benzoyl-N-hydroxysuccinimide (MBS), succinimide-3-(bromoacetamido)propionate (SBAP), succinimide-(4-iodoacetyl)aminobenzoate (SIAB), succinimide-iodo Acetate (SIA), succinimide-4-(ρ-maleimide-phenyl)butyrate (SMPB), NHS-PEG24-maleimide SM(PEG24), NHS-PEG12-maleimide (SM[PEG]12), NHS-PEG8-maleimide (SM[PEG]8), NHS-PEG6-maleimide (SM(PEG)6), NHS-PEG4-maleimide (SM[PEG]4), NHS-PEG2-maleimide (SM[PEG]2), succinimide-4-(N- Maleimide-methyl)cyclohexane-carboxylic acid ester (SMCC), succinimide-iodoacetate (SIA), succinimide-(4-iodoacetyl)aminobenzoate (SIAB), (ε-maleimide-hexanoyloxy)sulfosuccinimide ester (sulfon-EMCS), succinimide-3-(2-pyridyldithio)propionate (SPDP), succinimide-6-(β-maleimide-propamido)hexanoate (SMPH), N-(γ-maleimide-butyryloxy)sulfosuccinimide ester (sulfon-GMBS)-(κ-maleiminoundecyloxy)sulfosuccinimide (sulfon-KMUS), sulfosuccinimide-6-(α-methyl-[2-pyridyldithio]-toluidine)hexanoate (sulfon-LC-SMPT), sulfosuccinimide-6-(3'-[2-pyridyldithio]propamido)hexanoate (sulfon-LC-SPDP), maleimide benzoyl-hydroxysulfosuccinimide (sulfon-MBS), sulfosuccinimide-(4-iodoacetyl)aminobenzoate (sulfon-SIA) B) sulfosuccinimide-4-(N-maleimide-methyl)cyclohexane-carboxylic acid ester (sulfon-SMCC), sulfosuccinimide-4-(p-maleimide-phenyl)butyrate ester (sulfon-SMPB), N,N-dicyclohexylcarbodiimide (DCC), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), sulfon-NHS-(2-6-[biotinamido]-2-(p-azidobenzoylamine))(sulfon-SBED). In the method of the present invention, heterobifunctional linkers are preferred.

[0143] In some embodiments, the method of the present invention includes a heterobifunctional linker for sulfonyl-SMCC.

[0144] As used herein, "unconjugated bifunctional linker" refers to a bifunctional linker in which both functional groups are unconjugated. In some embodiments, the unconjugated bifunctional linker is not conjugated to a positively charged peptide. In some embodiments, the unconjugated bifunctional linker is not conjugated to an antibody.

[0145] As used herein, the term "substantially free of unconjugated bifunctional linkers" means that, although unconjugated bifunctional linkers are preferably absent in the composition, a very small amount of unconjugated bifunctional linkers may be present in the composition according to this disclosure, preferably in amounts that do not substantially affect the advantageous use of such compositions. In some embodiments, a composition comprising a first conjugate substantially free of unconjugated linkers comprises at least about 10 times more first conjugate molecules than unconjugated linker molecules. Thus, the first conjugate substantially free of unconjugated linkers preferably has a molar ratio of first conjugate to unconjugated linkers of about 10:1 or greater, preferably about 20:1 or greater, preferably about 50:1 or greater, preferably about 100:1 or greater, preferably about 200:1 or greater, preferably about 500:1 or greater, preferably about 1000:1 or greater, preferably about 2000:1 or greater, preferably about 5000:1 or greater, preferably about 10000:1 or greater. In some embodiments, a composition that initially contains a first conjugate and an unconjugated bifunctional linker and has undergone a purification step (e.g., a desalting step) capable of completely or partially removing the unconjugated bifunctional linker is considered to be a composition substantially free of the unconjugated bifunctional linker.

[0146] The definition of the term "antibody" includes, for example, implementations of monoclonal antibodies, chimeric antibodies, single-chain antibodies, humanized antibodies, and human antibodies. In addition to full-length antibodies, the definition also includes antibody derivatives and antibody fragments, particularly Fab fragments. Antibody fragments or derivatives also contain F(ab')2, Fv, scFv fragments, or single-domain antibodies, such as domain antibodies or nanobodies, single variable domain antibodies, or immunoglobulin single variable domains containing only one variable domain, which can be VHH, VH, or VL, and which binds to antigens or epitopes independently of other V regions or domains. The term also includes bispecific antibodies or biparental heavy-targeting (DART) antibodies. Further envisioned are (bispecific) single-chain bispecific antibodies, tandem bispecific antibodies (Tandab), and example structures of "microantibodies" such as (VH-VL-CH3)2, (scFv-CH3)2, or (scFv-CH3-scFv)2, FcDART "and IgG DART" polymorphs (e.g., trimorphs). Immunoglobulin monovariable domains encompass not only isolated antibody monovariable domain peptides, but also larger peptides containing one or more monomers of antibody monovariable domain peptide sequences.

[0147] Furthermore, the term "antibody" as used herein also refers to derivatives or variants of the antibodies described herein that exhibit the same specificity as the antibodies described herein. Examples of "antibody variants" include humanized variants of nonhuman antibodies, "affinity-matured" antibodies, and antibody mutants with altered effector functions (see, for example, U.S. Patent 5,648,260).

[0148] The term "antibody" also includes different classes (i.e., IgA, IgG, IgM, IgD, and IgE) and subclasses (e.g., IgG1, IgG2, etc.) of immunoglobulins. Antibody derivatives that also fall within the definition of the term "antibody" in the sense of this invention include modifications of these molecules, such as glycosylation, acetylation, phosphorylation, disulfide bond formation, farnesylation, hydroxylation, methylation, or esterification.

[0149] Functional fragments of antibodies include F(ab')2 fragments, Fab fragments, scFv domains, or constructs containing monoimmunoglobulin variable domains or single-domain antibody peptides (such as single heavy chain variable domains or single light chain variable domains), as well as other antibody fragments as described above. F(ab')2 or Fab can be engineered to minimize or completely remove intermolecular disulfide interactions between the CH1 and CL domains.

[0150] As used herein, the term "human" antibody should be understood to mean an antibody or functional fragment thereof that contains an amino acid sequence found in a human germline antibody library. For the purposes of this definition, an antibody or fragment thereof is considered human if it consists of such a human germline amino acid sequence, i.e., if the amino acid sequence of the antibody or functional fragment under discussion is identical to the expressed human germline amino acid sequence. An antibody or functional fragment thereof may also be considered human if it consists of a sequence that deviates from the sequence expected due to somatic high mutation imprinting of its closest human germline sequence. Additionally, antibodies from many non-human mammals, such as rodents (e.g., mice and rats), contain the VH CDR3 amino acid sequence, which is also expected to be present in expressed human antibody libraries. For the purposes of this invention, any such sequence of human or non-human origin present in expressed human libraries is also considered "human". Therefore, the term "human antibody" includes antibodies having variable and constant regions that substantially correspond to sequences of human immunoglobulins known in the art, including, for example, those described in Kabat et al. (Kabat et al., (1991) 'Sequences of Proteins of Immunological Interest, 5th Ed.', National Institutes of Health).

[0151] The human antibodies disclosed herein may, for example, include amino acid residues not encoded by human immunoglobulin sequences in the CDR, particularly in CDR3 (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutations in vivo). The human antibodies may have at least one, two, three, four, five, or more positions replaced with amino acid residues not encoded by human immunoglobulin sequences.

[0152] Preferably, the non-human and human antibodies or their functional fragments are monoclonal. The preparation of monoclonal human antibodies is particularly difficult. The fusion of human B cells with immortalized cell lines is not feasible compared to the fusion of mouse B cells with immortalized cell lines. Therefore, human monoclonal antibodies represent a significant technological hurdle that is widely recognized in the field of antibody technology. The monoclonal nature of antibodies makes them particularly suitable for use as therapeutic agents because such antibodies will exist as a single, homogeneous molecular species that can be well characterized and reproducibly prepared and purified. These factors result in the ability to predict the biological activity of the product with high precision, which is crucial for obtaining regulatory approval for therapeutic use in humans. As used herein, the term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous group of antibodies, meaning that the individual antibodies constituting the group are identical except for possible naturally occurring mutations and / or post-translational modifications (e.g., isomerization, amidation) that may be present in trace amounts. Monoclonal antibodies are highly specific, targeting a single antigenic site. Furthermore, unlike conventional (polyclonal) antibody formulations which typically consist of different antibodies targeting different determinants (epitopes), each monoclonal antibody targets a single determinant on the antigen. In addition to their specificity, monoclonal antibodies have the advantage of being synthesized via hybridoma culture, free from contamination by other immunoglobulins. The modifier “monoclonal” indicates that the antibody is derived from a substantially homogeneous group of antibodies and should not be interpreted as requiring the antibody to be produced by any particular method. For example, the monoclonal antibody used according to the invention can be prepared by a hybridoma method first described by Kohler et al., Nature, 256:495 (1975), or by a recombinant DNA method (see, for example, U.S. Patent No. 4,816,567). “Monoclonal antibodies” can also be isolated from a phage antibody library, for example, using techniques described in Clackson et al., Nature, 352:624-628 (1991) and Marks et al., J. Mol. Biol., 222:581-597 (1991).

[0153] Particularly preferred are monoclonal antibodies or corresponding functional fragments that are human antibodies or corresponding functional fragments. When considering antibody agents for therapeutic administration to humans, it is highly advantageous for the antibody to be of human origin. Upon administration to a human patient, the human antibody or its functional fragment will very likely not elicit a strong immunogenic response in the patient's immune system; that is, it will not be recognized as a foreign substance of non-human protein. This means that no host (i.e., patient) antibodies against the therapeutic antibody will be generated, which would otherwise block the activity of the therapeutic antibody and / or accelerate its elimination from the patient, thereby preventing the therapeutic antibody from exerting its desired therapeutic effect.

[0154] According to another embodiment of the invention, the antibody may be an immunoglobulin. According to yet another embodiment of the invention, the antibody may be an IgG antibody. IgG isotypes not only contain variable antibody regions of the heavy and light chains responsible for the recognition and binding of highly distinctive antigens, but also constant regions of the heavy and light chain antibody polypeptide chains typically present in “naturally” produced antibodies, and in some cases, even modifications with carbohydrates at one or more sites. This glycosylation is generally a hallmark of the IgG form and is located in the constant region, which contains the Fc region of the complete antibody known to elicit various effector functions in vivo. Furthermore, for example, the Fc region mediates the binding of IgG to Fc receptors and promotes the homing of IgG to sites with increased Fc receptor presence—inflammatory tissue. Advantageously, the IgG antibody is an IgG1 antibody or an IgG4 antibody, as these two forms are preferred because their mechanisms of action in vivo are well understood and characterized. This is especially true for IgG1 antibodies.

[0155] According to another embodiment of the invention, the functional fragment of the antibody is preferably scFv, a single-domain antibody, Fv, VHH antibody, a biantibody, a tandem biantibody, Fab, Fab', or F(ab)2. These forms can generally be divided into two subclasses: those consisting of a single polypeptide chain and those containing at least two polypeptide chains. Members of the former subclass include scFv (containing a VH region and a VL region linked together to form a single polypeptide chain by a polypeptide linker); single-domain antibodies (containing a single antibody variable region), such as VHH antibodies (containing a single VH region). Members of the latter subclass include Fv (containing a VH region and a VL region as separate polypeptide chains non-covalently linked to each other); biantibodies (containing two non-covalently linked polypeptide chains, each containing two antibody variable regions—each polypeptide chain typically has one VH and one VL—the two polypeptide chains are arranged in a head-to-tail conformation to produce a bivalent antibody molecule); and tandem biantibodies (bispecific single-chain Fv antibodies that contain four covalently linked immunoglobulin variable-VH and VL regions with two different specificities, forming a molecule twice the size of the aforementioned biantibodies). Homodimers; Fab (comprising a complete antibody light chain as one polypeptide chain, containing a VL region and a complete light chain constant region, and part of an antibody heavy chain as another polypeptide chain, containing a complete VH region and a partial heavy chain constant region, the two polypeptide chains being linked intermolecularly via interchain disulfide bonds); Fab' (Fab as described above, except for additional reduced disulfide bonds contained on the antibody heavy chain); and F(ab)2 (comprising two Fab' molecules, each Fab' molecule linked to its respective other Fab' molecule via interchain disulfide bonds). Generally, functional antibody fragments of the types described above allow for considerable flexibility in customizing the pharmacokinetic properties of antibodies for therapeutic administration, for example, for a specific emergency at hand. For example, when treating tissues known to be poorly vascularized (e.g., joints), it may be necessary to reduce the size of the administered antibody to increase tissue penetration. In some cases, it may also be necessary to increase the rate of elimination of the therapeutic antibody from the body, which can typically be accelerated by reducing the size of the administered antibody. In the context of this invention, an antibody fragment is defined as a functional antibody fragment, or an antibody fragment is defined as an antibody that targets other cell surface structures and has the ability to be internalized upon antibody binding, provided that the fragment retains the specific binding characteristics of the epitope / target of the parent antibody, for example, as long as the fragment specifically binds to CD33, EGFR, IGF1R or CD20.

[0156] According to another embodiment of the present invention, the antibody may include a CL domain. According to yet another embodiment of the present invention, the antibody may include a CH1 domain. According to still another embodiment of the present invention, the antibody may include a CH2 domain. According to another embodiment of the present invention, the antibody may include a CH3 domain. According to yet another embodiment of the present invention, the antibody may include a complete light chain. According to yet another embodiment of the present invention, the antibody may include a complete heavy chain.

[0157] According to another embodiment of the invention, the antibody or its functional fragment may exist in a monovalent monospecific form; a multivalent monospecific form, particularly a bivalent monospecific form; or a multivalent multispecific form, particularly a bivalent bispecific form. Typically, multivalent monospecific, particularly bivalent monospecific antibodies, such as the intact human IgG described above, can provide therapeutic advantages by enhancing neutralization achieved by such antibodies through affinity effects, i.e., by binding the same antibody to multiple molecules of the same antigen, such as CD33, EGFR, IGF1R, or CD20. Some monovalent monospecific antibody fragments (e.g., scFv, Fv, VHH, or single-domain antibodies) have been described above.

[0158] Antibodies or their functional fragments can be derivatized, for example, with organic polymers, such as one or more polyethylene glycol (“PEG”) and / or polyvinylpyrrolidone (“PVP”) molecules. As is known in the art, such derivatization can be advantageous in modulating the pharmacodynamic properties of antibodies or their functional fragments. Particularly preferred are PEG molecules derived as PEG-maleimides, which can be conjugated to antibodies or their functional fragments in a site-specific manner via the thiol groups of cysteine ​​amino acids. Particularly preferred are PEG-maleimides in branched or linear forms of 20 kDa and / or 40 kDa. It is particularly advantageous to increase the effective molecular weight of smaller human antibody fragments (such as scFv fragments) by coupling them to one or more PEG molecules (especially PEG-maleimides).

[0159] The antibodies disclosed herein also include “chimeric” antibodies (immunoglobulins) wherein a portion of the heavy and / or light chains is identical or homologous to the corresponding sequence in an antibody from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chains is identical or homologous to the corresponding sequence in an antibody from another species or belonging to another antibody class or subclass, and fragments comprising such antibodies, provided they exhibit the desired biological activity (US Patent No. 4,816,567; Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 (1984)). Chimeric antibodies of interest herein include “primitized” antibodies that comprise a variable domain antigen-binding sequence derived from non-human primates (e.g., Old World monkeys, apes, etc.) and a human constant region sequence.

[0160] The “humanized” form of a non-human (e.g., mouse) antibody is a chimeric immunoglobulin, immunoglobulin chain, or fragment thereof (such as Fv, Fab', F(ab')2, or other antigen-binding sequence of the antibody) that is primarily a human sequence, containing a minimal sequence derived from a non-human immunoglobulin. The majority of a humanized antibody is a human immunoglobulin (recipient antibody) in which residues from the hypervariable region (also known as the CDR) of the receptor are replaced by residues from the hypervariable region of a non-human species (donor antibody, such as a mouse, rat, or rabbit) with the desired specificity, affinity, and ability. In some cases, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, as used herein, a “humanized antibody” may also contain residues not present in either the recipient antibody or the donor antibody. These modifications are made to further improve and optimize antibody performance. Humanized antibodies preferably also contain at least a portion of the immunoglobulin constant region (Fc), typically the constant region of a human immunoglobulin. For further details, see Jones et al., Nature, 321:522-525 (1986); Reichmann et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992).

[0161] Preferred antibodies are those that bind to cell surface molecules, preferably to cell surface domains, and preferably internalize in a receptor-dependent manner, such as anti-CD33 antibodies, anti-EGFR antibodies, anti-IGF1R antibodies, or anti-CD20 antibodies. Preferred antibodies are selected from cetuximab, gemtuximab, cetuximab, teltuximab, GR11L, and rituximab. Other antibodies that bind to cell surface domains and internalize in a receptor-dependent manner are disclosed in LU 92353A, which is incorporated herein by reference.

[0162] Preferred antibodies comprise a VH domain containing the following three heavy chain CDRs and a VL domain containing the following three light chain CDRs: CDR-H1 having the sequence GFSLTNYG (SEQ ID NO:1), CDR-H2 having the sequence IWSGGNT (SEQ ID NO:2), CDR-H3 having the sequence ARALTYYDYEFAY (SEQ ID NO:3), CDR-L1 having the sequence QSIGTN (SEQ ID NO:4), CDR-L2 having the sequence YAS, and CDR-L3 having the sequence QQNNNWPTT (SEQ ID NO:5). Preferred antibodies comprise a VH domain having the sequence shown in SEQ ID NO:6 and a VL domain having the sequence shown in SEQ ID NO:7. Preferred antibodies comprise a heavy chain having the sequence shown in SEQ ID NO:8 and a light chain having the sequence shown in SEQ ID NO:9.

[0163] Preferred antibodies comprise a VH domain containing the following three heavy chain CDRs and a VL domain containing the following three light chain CDRs: CDR-H1 with the sequence GYTITDSN (SEQ ID NO: 10), CDR-H2 with the sequence IYPYNGGT (SEQ ID NO: 11), CDR-H3 with the sequence VNGNPWLAY (SEQ ID NO: 12), CDR-L1 with the sequence ESLDNYGIRF (SEQ ID NO: 13), CDR-L2 with the sequence AAS, and CDR-L3 with the sequence QQTKEVPWS (SEQ ID NO: 14). Preferred antibodies comprise a VH domain having the sequence shown in SEQ ID NO: 15 and a VL domain having the sequence shown in SEQ ID NO: 16. Preferred antibodies comprise a heavy chain having the sequence shown in SEQ ID NO: 17 and a light chain having the sequence shown in SEQ ID NO: 18. The preferred antibody comprises a heavy chain having the sequence shown in SEQ ID NO:65 and a light chain having the sequence shown in SEQ ID NO:18.

[0164] Preferred antibodies comprise a VH domain containing the following three heavy chain CDRs and a VL domain containing the following three light chain CDRs: CDR-H1 with the sequence GGTFSSYAIS (SEQ ID NO:19), CDR-H2 with the sequence GIIPIFGTANYAQKFQ (SEQ ID NO:20), CDR-H3 with the sequence APLRFLEWSTQDHYYYYYMDV (SEQ ID NO:21), CDR-L1 with the sequence QGDSLRSYYAT (SEQ ID NO:22), CDR-L2 with the sequence GENKRPS (SEQ ID NO:23), and CDR-L3 with the sequence KSRDGSGQHLV (SEQ ID NO:24). Preferred antibodies comprise a VH domain having the sequence shown in SEQ ID NO:25 and a VL domain having the sequence shown in SEQ ID NO:26. The preferred antibody comprises a heavy chain having the sequence shown in SEQ ID NO:27 and a light chain having the sequence shown in SEQ ID NO:28.

[0165] Preferred antibodies comprise a VH domain containing three heavy chain CDRs and a VL domain containing three light chain CDRs: CDR-H1 with the sequence GFTFSSYG (SEQ ID NO:29), CDR-H2 with the sequence IWFDGSST (SEQ ID NO:30), CDR-H3 with the sequence ARELGRRYFDL (SEQ ID NO:31), CDR-L1 with the sequence QSVSSY (SEQ ID NO:32), CDR-L2 with the sequence IWFDGSST (SEQ ID NO:33), and CDR-L3 with the sequence QQRSKWPPWT (SEQ ID NO:34). Preferred antibodies comprise a VH domain with the sequence shown in SEQ ID NO:35 and a VL domain with the sequence shown in SEQ ID NO:36. Preferred antibodies comprise a heavy chain with the sequence shown in SEQ ID NO:37 and a light chain with the sequence shown in SEQ ID NO:38.

[0166] Preferred antibodies comprise a VH domain containing three heavy chain CDRs and a VL domain containing three light chain CDRs: CDR-H1 with the sequence GYTFTSYN (SEQ ID NO: 39), CDR-H2 with the sequence IYPGNGDT (SEQ ID NO: 40), CDR-H3 with the sequence CARSTYYGGDWYFNV (SEQ ID NO: 41), CDR-L1 with the sequence SSSVSYI (SEQ ID NO: 42), CDR-L2 with the sequence ATS, and CDR-L3 with the sequence QQWTSNPPT (SEQ ID NO: 43). Preferred antibodies comprise a VH domain having the sequence shown in SEQ ID NO: 44 and a VL domain having the sequence shown in SEQ ID NO: 45. Preferred antibodies comprise a heavy chain having the sequence shown in SEQ ID NO: 46 and a light chain having the sequence shown in SEQ ID NO: 47.

[0167] As used herein, “cell surface domain” means any protein on the cell surface. Cell surface domains also include cell surface antigens. It also includes any epitopes that can be recognized on the cell surface. Preferably, the epitope or protein is cell type specific because it is present only in certain cell types. In one embodiment, the cell surface domain is present on cancer cells. Potential cell surface targets include CD19, CD20, CD22, CD25, CD30, CD33, CD40, CD56, CD64, CD70, CD74, CD79, CD105, CD138, CD174, CD205, CD227, CD326, CD340, MUC16, GPNMB, PSMA, Cripto, ED-B, TMEFF2, EphB2, EphA2, FAP Av, integrin, mesothelin, EGFR, TAG-72, GD2, CAIX, and / or 5T4. Other potential cell surface domains include CD52, CD3, CD117, CD99, CD34, CD44, CD117, CA15-3, CA-125, CA27-29, EpCAM, carcinoembryonic antigen, melanoma antigen recognized by T cell 1 (MART1), and trophoblast glycoprotein (TPBG). The cell surface molecule according to the invention is a molecule preferably expressed on cells susceptible to treatment with negatively charged molecules.

[0168] Preferably, such cell surface domains are CD33, EGFR, IGF1R, and CD20. The cell surface domains may also provide epitopes that the antibodies according to the present invention can bind to.

[0169] Consistent with the above, the term "epitope" defines an antigenic determinant that is specifically bound to / recognized by an antibody as defined herein. Antibodies can specifically bind to or interact with conformations or successive epitopes that are unique to the target structure.

[0170] In a preferred embodiment, the antibody of this disclosure is specific to cancer-associated antigens. As used herein, the terms "cancer-associated antigen" or "tumor-associated antigen," which may be used interchangeably herein, generally refer to any antigen associated with cancer or tumor cells, i.e., present to the same or greater extent than normal cells. These antigens may be relatively tumor-specific, and their expression on the surface of malignant cells may be limited, but they may also be found in non-malignant cells. In one embodiment, the antibody of this disclosure binds to a cancer-associated antigen.

[0171] The term "internalization" as used in this invention refers to endocytosis, in which molecules such as proteins are engulfed by the cell membrane and absorbed into the cell. Specifically, cell surface domains that bind to binding domains are internalized. Methods for measuring this internalization are disclosed in embodiments of this application. Alternatively, for example, this process can be observed using time-lapse microscopy, where the target receptor and cell membrane are double-stained. Preferably, nanoparticles containing antibodies capable of binding cell surface molecules are internalized after binding to the cell surface molecules.

[0172] As used herein, "second conjugate (B)" refers to a conjugate comprising the antibody disclosed herein, the positively charged polypeptide disclosed herein, and preferably the bifunctional linker disclosed herein, or preferably a conjugate consisting of the like. Preferably, the positively charged polypeptide and antibody are interconnected via a bifunctional linker herein.

[0173] The term "negatively charged molecule" refers to a molecule that has a net positive charge at or near physiological pH (e.g., in solutions with pH 4 to 10, 5 to 9, or 6 to 8), and preferably is capable of binding positively charged polypeptides (e.g., protamine or histones) through electrostatic interactions. Preferred negatively charged molecules are nucleic acids and negatively charged small molecules. Preferably, such negatively charged molecules have a net charge of at least 2-, preferably at least 3-, preferably at least 4-, preferably at least 5-, preferably at least 6-, preferably at least 7-, preferably at least 8-, preferably at least 9-, or preferably at least 10-.

[0174] When the terms “nucleotide sequence,” “polynucleotide,” “nucleic acid,” and “nucleic acid molecule” are used herein, they are used interchangeably and refer to a polymeric, unbranched nucleotide of any length, which may be a ribonucleotide, a deoxyribonucleotide, or a combination of both. As will be readily understood by those skilled in the art, nucleic acid sequences include DNA, cDNA, genomic DNA, RNA (such as mRNA, siRNA), synthetic forms and mixed polymers, sense strands and antisense strands, or may contain non-natural or derived nucleotide bases. Furthermore, non-limiting examples of these nucleic acids include, but are not limited to, any type of RNA interference (RNAi), which may be single-stranded or double-stranded and involve gene termination and / or gene knockdown, including gene knockdown of mRNA by degradation or translationally stalled messenger (mRNA), inhibition of tRNA and rRNA function or epigenetic effects; short (or small) interfering RNA (siRNA), short hairpin RNA (shRNA), siRNA prepared by ribonuclease (esiRNA), antisense oligonucleotides, microRNAs and non-coding RNAs, short RNA activity on DNA, and Dicer-substrate siRNA. Preferred nucleic acids are siRNA, esiRNA antisense oligonucleotides, or miRNA, with siRNA being the most preferred. In some embodiments, if the nucleic acid is double-stranded, it preferably has a length of about 18 to about 25 bp. In some embodiments, if the nucleic acid is single-stranded, it preferably has a length of about 18 to about 25 nt.

[0175] The nucleic acids used in this invention act on target cells. For example, by providing nucleic acid molecules, the expression of specific molecules or proteins in target cells is reduced or increased. Preferably, the expression of specific molecular proteins is reduced by utilizing nucleic acid molecules.

[0176] Nucleic acids according to this disclosure include siRNA molecules, which are designed to target and inhibit or block the expression of genes or proteins that are associated with cancer or involved in the development and / or progression of cancer.

[0177] Preferred nucleic acid molecules are selected from siRNA, esiRNA, antisense oligonucleotides, or miRNA, preferably specific to KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, or FLT3. Even more preferred are siRNAs specific to KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, or FLT3. Such siRNAs are known to those skilled in the art, and illustrative examples of such siRNAs are shown in the table below.

[0178] target siRNA sequence KRAS UUC UGC UUG UGA CAU UAA AAA(SEQ ID NO:59) PIK3CA AAA CUU GGC UGA AGU UUA AAA(SEQ ID NO:60) PAX3-FKHR UGA AUU CUG AGG UGA GAG GCTT(SEQ ID NO:61) EWS-FLI1 GGC AGC AGA ACC CUU CUU AUU(SEQ ID NO:62) c-MYC ACA CAA ACU UGA ACA GCU ATT(SEQ ID NO:63) TP53 GAA AUG UUC UUG CAG UUA ATT(SEQ ID NO:64)

[0179] The preferred nucleic acids of this disclosure also include a mixture of different siRNAs targeting one or more targets, preferably targeting one target. For example, the nucleic acids of this disclosure may comprise a mixture of siRNAs specific to targets selected from: KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, and FLT3.

[0180] The negatively charged molecule according to the invention can also be a non-nucleic acid molecule. Such molecules can be small molecules, or preferably small organic molecules. The negatively charged molecule can have a molecular weight of about 20 kDa or less, preferably about 15 kDa or less, or about 10 kDa or less. The negatively charged molecule can also have a molecular weight of about 9 kDa or less, about 8 kDa or less, about 7 kDa or less, about 6 kDa or less, about 5 kDa or less, about 4 kDa or less, about 3 kDa or less, or about 2 kDa or less. As an illustrative example, the negatively charged molecule can be a drug and / or a prodrug. The drug and / or prodrug can be conjugated to a negatively charged moiety. For example, the drug can be ibrutinib conjugated to a negatively charged moiety (such as Cy 3.5 or Alexa488). However, the drug can also be conjugated to another negatively charged moiety. Suitable negatively charged moies for conjugation are known to those skilled in the art. Illustrative examples of suitable negatively charged moieties include (poly)sulfonated aryl groups (e.g., as coligands of transition metals), (poly)sulfonated dyes (e.g., dicycanine dyes), mono / di / triphosphates, (poly)sulfates of monosaccharides or branched oligosaccharides, and oligopeptides derived from glutamic acid or aspartic acid. Drugs and / or prodrugs may have a negative net charge without being conjugated to any additional moieties. As an illustrative example, a drug with a negative net charge is remdesivir triphosphate. Those skilled in the art will understand that the above embodiments are for illustrative purposes only, and many other negatively charged molecules may be used in the context of this invention.

[0181] As used herein, “ibrutinib” (IUPAC name: 1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)pyrazolo[3,4-d]pyrimidin-1-yl]piperidin-1-yl]prop-2-en-1-one, CAS No.: 936563-96-1) refers to a molecule having the following structure (in its free form).

[0182]

[0183] The “remdesivir triphosphate” used in this article (IUPAC name [[(2R,3S,4R,5R)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazine-7-yl)-5-cyano-3,4-dihydroxytetrahydrofuran-2-yl]methoxy-hydroxyphosphoryl]phosphonophosphate, CAS No.: 1355149-45-9) refers to a molecule having the following structure.

[0184]

[0185] This application also relates to nanoparticles. Preferably, such nanoparticles can be obtained by the methods described herein. The nanoparticles of the present invention may comprise (a) a positively charged polypeptide, preferably a positively charged polypeptide as disclosed herein; (b) a second conjugate (B), the second conjugate comprising an antibody preferably conjugated to the positively charged polypeptide via a bifunctional linker; and (c) one or more negatively charged molecules, preferably negatively charged molecules as disclosed herein.

[0186] It is not desired to be bound by theory, but rather that the positively charged peptides, the second conjugate, and one or more negatively charged molecules are unevenly distributed within the particles. Additionally, in some embodiments, the second conjugate is enriched in the outer portion of the nanoparticle. In some embodiments, the one or more negatively charged molecules are enriched in the inner portion of the nanoparticle. In some embodiments, the positively charged peptide is enriched in the outer portion of the nanoparticle. In some embodiments, the positively charged peptide is enriched in the inner portion of the nanoparticle. Therefore, the nanoparticles of the present invention can form vesicle-like structures, wherein the second conjugate is primarily present in the outer portion, while the negatively charged molecules are enriched or encapsulated in the inner portion of the nanoparticle. It is not desired to be bound by theory, but rather that this structure protects the negatively charged molecules, thereby increasing their stability. It is also believed that at least some or even all of the nanoparticles can be internalized upon binding to cells via the second conjugate.

[0187] In some embodiments, the nanoparticles of this disclosure have an average diameter of at least about 0.05 μm. In some embodiments, the nanoparticles of this disclosure have an average diameter of at least about 0.1 μm. In some embodiments, the average diameter of the nanoparticles is at least about 0.2 μm. In some embodiments, the nanoparticles of this disclosure have an average diameter of about 0.05 μm to about 10 μm, preferably about 0.1 μm to about 10 μm, and more preferably about 0.2 μm to about 5 μm. The average diameter of the nanoparticles of this disclosure may also be in the range of about 0.3 μm to about 4 μm, about 0.4 μm to about 3 μm, or about 0.5 μm to about 2 μm. The average diameter of the nanoparticles can be determined by any method suitable for determining particle size, including dynamic light scattering and microscopic analysis. A preferred method for determining particle size is microscopic analysis, preferably by transmission optical microscopy.

[0188] The present invention also relates to compositions comprising the nanoparticles of the present invention and / or nanoparticles obtainable by the methods of the present invention.

[0189] The present invention further relates to pharmaceutical compositions comprising the nanoparticles of the present invention and / or nanoparticles obtainable by the methods of the present invention.

[0190] In the compositions disclosed herein (including the pharmaceutical compositions disclosed herein), at least about 10% of the second conjugate contained in the composition may be contained in the nanoparticles. In a preferred embodiment, at least 20%, preferably at least 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%, preferably at least 95%, preferably at least 98%, preferably at least 99% of the second conjugate contained in the composition are contained in the nanoparticles. In a preferred embodiment, the composition is substantially free of the second conjugate not contained in the nanoparticles.

[0191] In the compositions disclosed herein (including the pharmaceutical compositions disclosed herein), at least about 10% of the positively charged polypeptide contained in the composition may be contained in the nanoparticles. In a preferred embodiment, at least 20%, preferably at least 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%, preferably at least 95%, preferably at least 98%, and preferably at least 99% of the positively charged polypeptide contained in the composition are contained in the nanoparticles. In a preferred embodiment, the composition is substantially free of positively charged polypeptides not contained in the nanoparticles.

[0192] In the compositions of this disclosure (including the pharmaceutical compositions of this disclosure), at least about 10% of the negatively charged molecules contained in the composition may be contained in the nanoparticles. In a preferred embodiment, at least 20%, preferably at least 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%, preferably at least 95%, preferably at least 98%, and preferably at least 99% of the negatively charged molecules contained in the composition are contained in the nanoparticles. In a preferred embodiment, the composition is substantially free of negatively charged molecules not contained in the nanoparticles.

[0193] The term "pharmaceutical composition" refers to a composition intended for administration to a patient, preferably a human patient. Pharmaceutical compositions or formulations are typically in a form that allows the biological activity of the active ingredient to be effective and, therefore, can be administered to a subject for therapeutic purposes, as described herein. Generally, a pharmaceutical composition comprises a suitable (i.e., pharmaceutically acceptable) formulation of a carrier, stabilizer, and / or excipient. Examples of suitable pharmaceutical carriers are described by EW Martin in "Remington's Pharmaceutical Sciences." Such compositions contain a therapeutically effective amount of the aforementioned molecule (preferably in a purified form) and an appropriate amount of carrier to provide a form suitable for appropriate administration to a patient. The formulation should be appropriate for the manner of administration.

[0194] In one embodiment, the pharmaceutical composition is for parenteral, transdermal, intracavitary, intra-arterial, intrathecal, and / or intranasal administration, or for direct injection into tissues. Particularly contemplated is the administration of the composition to a patient via infusion or injection. The administration of suitable compositions can be achieved through various methods, such as intravenous, intraperitoneal, subcutaneous, intramuscular, local, or intradermal administration. The compositions of the present invention may further comprise a pharmaceutically acceptable carrier. Examples of suitable pharmaceutical carriers are well known in the art, including buffered saline solutions, water, emulsions such as oil / water emulsions, various types of wetting agents, sterile solutions, liposomes, etc. Compositions comprising these carriers can be formulated using well-known conventional methods.

[0195] According to embodiments of the invention, the term "therapeuticly effective amount" refers to the amount of molecules of the invention and / or molecules obtainable by the methods of the invention that are effective in treating cancer-related diseases. Preferred dosage and preferred method of administration are that, after administration, the molecules of the invention and / or molecules obtainable by the methods of the invention are present in the blood at an effective dose. The administration regimen can be adjusted by observing the disease condition and analyzing serum levels of molecules that reduce the expression of the target molecule in laboratory tests, and then extending the administration interval (e.g., from twice a week or once a week to once every two weeks, once every three weeks, once every four weeks, etc.), or optionally shortening the administration interval accordingly. In the case of cancer, the therapeutically effective amount of the molecules or compositions disclosed herein can reduce the number of cancer cells; reduce tumor size; inhibit (i.e., slow and / or stop) the invasion of cancer cells into peripheral organs; inhibit (i.e., slow and / or stop) tumor metastasis; inhibit tumor growth; and / or alleviate one or more cancer-related symptoms.

[0196] In another embodiment, the pharmaceutical composition is adapted to be administered in combination with another drug, i.e., as part of a co-combination therapy. In said combination therapy, optionally, the active agent may be included in the same pharmaceutical composition as the molecule of the present invention, or may be included in a separate pharmaceutical composition. In the latter case, the separate pharmaceutical composition is adapted to be administered before, simultaneously with, or after administration of the pharmaceutical composition containing the molecule of the present invention. The other drug or pharmaceutical composition may be a non-protein compound or a protein compound. In the case where the other drug is a protein compound, it is advantageous that the protein compound is capable of providing an activation signal to immune effector cells. Preferably, the protein compound or non-protein compound may be administered simultaneously or not simultaneously with the molecule (or formulation) of the present invention as defined above, the carrier as defined above, or the host as defined above.

[0197] The pharmaceutical composition can be administered to the subject at an appropriate dose. The dosage regimen will be determined by the attending physician and clinical factors. As is well known in the medical field, the dose for any patient depends on many factors, including the patient's body size, body surface area, age, the specific compound to be administered, sex, time and route of administration, general health condition, and other medications administered concurrently.

[0198] Formulations intended for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate). Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, including saline and buffer media. Parenteral carriers include sodium chloride solutions, Ringer's glucose, glucose and sodium chloride, lactated Ringer's solution, or non-volatile oils. Intravenous carriers include fluids and nutritional supplements, electrolyte supplements (such as those based on Ringer's glucose), etc. Preservatives and other additives may also be present, such as antimicrobial agents, antioxidants, chelating agents, inert gases, etc. Furthermore, pharmaceutical compositions according to the invention may contain protein carriers, such as serum albumin or immunoglobulins, preferably human-derived carriers. Depending on the intended use of the pharmaceutical composition, it is contemplated that pharmaceutical compositions according to the invention may contain additional bioactive agents besides the molecules described above. These agents can be drugs that act on the gastrointestinal system, drugs that act as cell inhibitors, drugs that prevent hyperuricemia, drugs that suppress immune responses (e.g., corticosteroids), drugs that regulate inflammatory responses, drugs that act on the circulatory system, and / or agents known in the art such as cytokines.

[0199] To analyze the effects of the nanoparticles of the present invention and / or nanoparticles obtainable by the methods of the present invention, for example, in cancer treatment, outcome measures can be selected from, for example, pharmacokinetics, immunogenicity and the potential to reduce cancer size by, for example, MRI imaging, and patient-reported results.

[0200] Another major challenge in the development of pharmaceutical compositions such as those of the present invention is the predictable modulation of pharmacokinetic properties. To this end, pharmacokinetic profiles of candidate drugs have been established, i.e., profiles of pharmacokinetic parameters that affect the ability of a particular drug to treat a given disease. Pharmacokinetic parameters affecting the ability of a drug to treat a disease entity include, but are not limited to, half-life, volume of distribution, hepatic first-pass metabolism, and serum binding. The efficacy of a given drug can be affected by these parameters. "Half-life" refers to the time required for 50% of the administered drug to be eliminated through biological processes such as metabolism and excretion. "Hepatic first-pass metabolism" refers to the tendency of a drug to be metabolized during its first contact with the liver, i.e., during its first passage through the liver. "Volume of distribution" refers to the degree of retention of the drug in various compartments of the body, such as intracellular and extracellular spaces, tissues, and organs, and the distribution of the drug in these compartments.

[0201] "Serium binding degree" refers to the tendency of a drug to interact with and bind to serum proteins such as albumin, resulting in a decrease or loss of the drug's biological activity.

[0202] Pharmacokinetic parameters also include bioavailability, lag time (Tlag), Tmax, absorption rate, and / or Cmax for a given amount of drug administered. "Bioavailability" refers to the amount of drug in the blood compartment. "Llag time" refers to the time delay between drug administration and its detection and measurability in blood or plasma. "Tmax" is the time required for the drug to reach its maximum blood concentration, defining absorption as the movement of the drug from the site of administration into the systemic circulation, while "Cmax" is the maximum blood concentration achievable with a given drug. The time required for a drug to reach its biological effect in blood or tissue is influenced by all these parameters.

[0203] As used in this article, the term "toxicity" refers to the toxic effects of a drug that manifest as adverse events or serious adverse events. These adverse events may refer to a lack of overall tolerability to the drug and / or a lack of local tolerance after administration. Toxicity may also include teratogenic or carcinogenic effects caused by the drug.

[0204] As used herein, the terms “safety,” “in vivo safety,” or “tolerability” are defined as the absence of serious adverse events following direct administration (local tolerance) and over a prolonged period after administration. “Safety,” “in vivo safety,” or “tolerability” can be evaluated periodically, such as during treatment and follow-up. Measurements include clinical evaluations, such as organ manifestations, and screening for laboratory abnormalities. Clinical evaluations can be performed, and results deviating from normal values ​​can be recorded / coded according to NCI-CTC and / or MedDRA standards. Organ manifestations may include criteria such as allergy / immunology, blood / bone marrow, arrhythmias, coagulation function, etc., as described in the Common Terminology Standard for Adverse Events, version 3.0 (CTCAE). Laboratory parameters that can be tested include hematology, clinical chemistry, coagulation function, and urinalysis, as well as examination of other body fluids such as serum, plasma, lymph, or cerebrospinal fluid, etc. Therefore, safety assessments can be conducted, for example, through physical examinations, imaging techniques (i.e., ultrasound, X-ray, CT scans, magnetic resonance imaging (MRI), measurements using other technical equipment (i.e., electrocardiograms), vital signs, and by measuring and recording adverse events through laboratory parameters. The term "effective and non-toxic dose" as used herein refers to the tolerated dose of the molecules of the present invention and / or molecules obtainable by the methods of the present invention, preferably antibodies as defined herein, which should be sufficiently high to cure or stabilize the target disease without having or substantially no significant toxic effects. This effective and non-toxic dose can be determined through dose escalation studies as described in the art, and this dose should be below the dose that induces serious adverse side effects (dose-limiting toxicity, DLT).

[0205] The pharmaceutical compositions of the present invention can be in different formulations. Preferably, the formulation (sometimes referred to herein as a "composition of substances"; "composition" or "solution") can be in various physical states, such as liquid, frozen, lyophilized, freeze-dried, spray-dried, and reconstituted formulations, wherein liquid and frozen formulations are preferred.

[0206] As used herein, "liquid formulation" refers to compositions of substances found to be liquids, characterized by the free movement of constituent molecules within them without a tendency to separate at room temperature. Liquid formulations include aqueous and non-aqueous liquids, with aqueous formulations being preferred. An aqueous formulation is one in which water, preferably water for injection (WFI), is the solvent or primary solvent. The dissolution of the molecules of the present invention and / or molecules obtainable by the methods of the present invention in the formulation can be homogeneous or heterogeneous, with homogeneity as described above being preferred.

[0207] Any suitable non-aqueous liquid can be used, provided that it provides stability to the formulations of the present invention. Preferably, the non-aqueous liquid is a hydrophilic liquid. Exemplary examples of suitable non-aqueous liquids include: glycerol; dimethyl sulfoxide (DMSO); polydimethylsiloxane (PMS); ethylene glycols, such as ethylene glycol, diethylene glycol, triethylene glycol, polyethylene glycol (“PEG”) 200, PEG 300, and PEG 400; and propylene glycols, such as dipropylene glycol, tripropylene glycol, polypropylene glycol (“PPG”) 425, and PPG 725.

[0208] As used herein, “mixed aqueous / non-aqueous liquid formulation” refers to a liquid formulation comprising a mixture of water (preferably WFI) and another liquid composition.

[0209] When used herein, "formulation" or "composition" is a mixture of molecules of the present invention and / or molecules obtainable by the methods of the present invention (i.e., active pharmaceutical ingredients / substances) and other chemical substances and / or additives required in pharmaceutical products, preferably in a liquid state. Formulations of the present invention include pharmaceutical formulations.

[0210] The preparation of formulations involves a process in which different chemical substances (including active pharmaceutical ingredients) are combined to produce a final pharmaceutical product, such as a pharmaceutical composition. The active pharmaceutical ingredient in the formulations of this invention is the nanoparticles of this invention and / or nanoparticles obtainable by the methods of this invention.

[0211] In some embodiments, the nanoparticles of the present invention to be formulated and / or the nanoparticles obtainable by the methods of the present invention are substantially pure and / or substantially homogeneous (i.e., substantially free of contaminating substances, such as proteins, which may be product-related and / or process-related impurities). The term "substantially pure" means a composition comprising at least about 80%, preferably about 90%, preferably at least about 95%, more preferably at least about 97%, or most preferably at least about 98% by weight of the compound. The term "substantially homogeneous" means a composition comprising at least about 99% by weight of the compound, preferably in a monomeric state, excluding the mass of various stabilizers and water in the solution.

[0212] A “stable” formulation is one in which the molecules of the present invention and / or molecules obtainable by the methods of the present invention substantially maintain their physical and / or chemical stability and / or biological activity after storage and / or show no substantial signs of aggregation, precipitation, cleavage, degradation and / or denaturation compared to a control sample, preferably after visual inspection of color and / or clarity, or as measured by UV light scattering or by size exclusion chromatography. Various other analytical techniques for measuring protein stability are available in the art and are reviewed, for example, in: Peptide and Protein Drug Delivery, 247-301, Vincent Lee Ed., Marcel Dekker, Inc., New York, NY, Pubs. (1991) and Jones, A. Adv. Drug Delivery Rev. 10:29-90 (1993).

[0213] As used herein, "during storage" means once the formulation is prepared, it is not used immediately; or, after its preparation, it is packaged for storage, whether in liquid form, frozen state, or subsequently reconstituted into a liquid or other dry form.

[0214] According to the present invention, the “subject” is a vertebrate, preferably a mammal, and more preferably a human subject.

[0215] "Vertebrates" include vertebrates such as fish, birds, amphibians, reptiles, and mammals.

[0216] "Mammals" include dogs, cats, horses, rats, mice, apes, rabbits, cattle, pigs, sheep, and preferably humans. For humans, the term "patient" can also be used to refer to them.

[0217] The present invention also relates to nanoparticles obtainable by the methods of the present invention, or the nanoparticles of the present invention and / or the pharmaceutical compositions of the present invention, for use in treatment. Use in treatment is preferably in a method for treating cancer in a subject.

[0218] As used in this invention, the terms “cancer” and “carcinogenic” refer to a disease in vertebrates, preferably mammals, and more preferably humans, characterized generally by unregulated cell growth.

[0219] Cancers are classified based on similar cell types of tumor cells, thus suggesting that cancer is the origin of tumors. These types include carcinoma, sarcoma, leukemia, germ cell tumors, and germ cell tumors.

[0220] When used in this article, “carcinoma” can include cancers that originate from epithelial cells.

[0221] When used in this article, "sarcoma" can include cancers arising from cells derived from mesenchymal (connective tissue).

[0222] When used herein, "blood cancer" can include a type of cancer arising from hematopoietic (blood-forming) cells that leave the bone marrow and tend to mature in the lymph nodes and blood, respectively. When used herein, leukemia can include bone marrow-derived cells that mature normally in the bloodstream. When used herein, lymphoma can include bone marrow-derived cells that mature normally in the lymphatic system.

[0223] When used in this article, "germ cell tumors" can include cancers derived from pluripotent cells, which are commonly found in the testes or ovaries.

[0224] When used in this article, "germ cell tumor" can include cancers derived from immature "precursor" cells or embryonic tissue.

[0225] Molecules obtainable by the method of the present invention, or molecules of the present invention and / or molecules obtainable by the method of the present invention, may be used in methods for treating cancer, wherein the cancer may be selected from lung cancer (such as non-small cell lung cancer), sarcoma (such as rhabdomyosarcoma or Ewing sarcoma), colorectal cancer, blood cancer (such as leukemia or lymphoma, such as acute myeloid leukemia (AML) or diffuse large B-cell lymphoma (DLBLC)).

[0226] As used in this article, the term "treatment" means to alleviate, reduce, stabilize, or inhibit the progression of a disease or condition (such as cancer).

[0227] The present invention also relates to nanoparticles obtainable by the methods of the present invention, or nanoparticles of the present invention, or pharmaceutical compositions of the present invention, used in methods for inhibiting and / or controlling tumor growth in subjects.

[0228] A "tumor" or "growth" is an abnormal mass of tissue resulting from abnormal cell growth or division. Tumor cells grow beyond the reach of the surrounding normal tissue and do not grow in harmony with it. However, in the context of this invention, tumors also include leukemia and carcinoma in situ. Tumors can be benign, pre-malignant, or malignant. In a preferred embodiment, the tumor is pre-malignant or malignant. Most preferably, the tumor is malignant.

[0229] The present invention also relates to nanoparticles obtainable by the methods of the present invention, or nanoparticles of the present invention, or (pharmaceutical) compositions of the present invention, for delivering nucleic acid molecules to tumor sites in subjects.

[0230] In one embodiment of the invention, the nanoparticles obtainable by the method of the invention, or the nanoparticles or pharmaceutical compositions of the invention used in the application of the invention, comprise siRNAs selected from the following: KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, and FLT3 siRNAs. The siRNAs of the invention can target KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, or FLT3. Preferably, the siRNAs reduce the expression of KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, or FLT3 in cells. Preferably, the expression of these targets is reduced.

[0231] "siRNA target" refers to a target that is recognized by a specific siRNA. siRNAs can be constructed in different ways. For example, siRNA can target mRNA.

[0232] Generally, the design of siRNAs is known to those skilled in the art. See, for example, Reynolds et al. (Reynolds et al., (2004) "Rational siRNA design for RNA interference" Nature Biotechnology 22, 326-330) or Judge et al. (Judge et al., 2006) "Design of Noninflammatory Synthetic siRNA Mediating Potent Gene Silencing in Vivo" Molecular Therapy (2006) 13, 494–505) or Sioud and Leirdal (Sioud and Leirdal (2004) "Potential design rules and enzymatic synthesis of siRNAs" Methods Mol Biol. 2004; 252: 457-69).

[0233] The term "expression" or "gene expression" refers to the transcription of one or more specific genes or gene constructs. Specifically, it refers to the transcription of one or more genes or gene constructs into structural RNA (rRNA, tRNA) or mRNA, followed by translation of the latter, or not, into proteins. This process involves the transcription of DNA and the processing of the resulting mRNA product. The mRNA is then translated into peptide / polypeptide chains, which are ultimately folded into the final peptide / polypeptide / protein. Proteomics researchers commonly use protein expression to measure the presence and abundance of one or more proteins in a specific cell or tissue. Cellular protein expression can be determined using various methods, such as immunohistochemistry or Western blotting analysis. In this paper, the results should be evaluated by comparison with healthy cells or control standards. Compared to control cells, low-expression cells show reduced staining intensity, for example. Compared to control cells in the same environment, high-expression cells show increased staining intensity, for example. Additionally, mRNA expression can be determined by, for example, RT-PCR. In this study, compared to control cells in the same environment, cells with low expression showed, for example, a higher number of amplification cycles to reveal a detectable signal. Various techniques for determining the protein and mRNA expression of cells are known to those skilled in the art.

[0234] For example, the cells may be present in the subject's blood, liver, stomach, mouth, skin, lungs, lymphatic system, spleen, bladder, pancreas, bone marrow, brain, kidneys, intestines, gallbladder, larynx, or pharynx.

[0235] In one embodiment, the present invention uses nanoparticles obtainable by the method of the present invention, or nanoparticles of the present invention, or pharmaceutical compositions of the present invention, wherein the subject is a mammal, preferably a human.

[0236] The present invention also relates to a kit comprising one or more coupling buffers / reagents and procedures suitable for carrying out the methods of the present invention.

[0237] In one embodiment, the kit includes one or more coupling buffers / reagents and procedures suitable for carrying out the methods of the present invention.

[0238] This invention relates to a kit comprising a buffer / reagent and a procedure suitable for carrying out the methods of the invention, and optionally including means for purifying or enriching, for example, the molecules of the invention or molecules obtained by the methods of the invention, and / or means for washing said molecules and / or means for storing said molecules. Therefore, it is preferred that said molecules and other means are packaged together in a sealed package or kit.

[0239] The present invention also relates to a kit comprising the nanoparticles of the present invention and / or nanoparticles obtainable by the methods of the present invention.

[0240] This invention relates to a kit comprising the nanoparticles of the present invention and / or nanoparticles obtainable by the methods of the present invention and / or means of optionally purifying or enriching the molecules and / or means of washing the molecules and / or means of storing the molecules. Therefore, it is preferred that the molecules and other means are packaged together in a sealed package or kit.

[0241] The various components of the kit of the present invention (or "the kit of various components") may be individually packaged in vials or bottles, or combined in containers or multi-container units. The kit is preferably prepared according to standard methods known to those skilled in the art.

[0242] The kit of the present invention may include one or more containers, optionally labeled. Suitable containers include, for example, bottles, vials, and test tubes. Containers may be made of various materials, such as glass or plastic, and preferably are sterilized. Containers contain compositions having an active ingredient or containing a buffer effective for the methods of the present invention. Additional containers may contain suitable buffer solutions (e.g., reaction buffers) that allow specific reactions to occur. Containers containing various buffer solutions are also envisioned, such as reaction buffers and / or buffers for purifying molecules of the present invention and / or molecules obtainable by the methods of the present invention. Preferably, the active agent in the composition is a molecule obtainable by the methods of the present invention, or a molecule of the present invention, or a pharmaceutical composition of the present invention.

[0243] The kit may also include written instructions for using the methods according to the invention and for applying the methods of implementing the invention. The kit may further include labels or markings indicating that the contents can be used with nanoparticles according to the invention and / or for augmentation of said nanoparticles according to the invention.

[0244] It is also envisioned that the kit of the present invention may further include, for example, buffer solutions, vials, controls, stabilizers, and written instructions to help technicians prepare or use the nanoparticles of the present invention.

[0245] Furthermore, the present invention relates to the use of the nanoparticles of the present invention, or nanoparticles obtainable by the methods of the present invention, or pharmaceutical compositions of the present invention, in treatment, preferably in the treatment of cancer in a subject.

[0246] The present invention also relates to a method for treating cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of nanoparticles of the present invention or nanoparticles obtainable by the method of the present invention or pharmaceutical compositions of the present invention.

[0247] The term "application" refers to the administration of a therapeutic or diagnostically effective dose of the above-described nanoparticles of the present invention to a subject. Different routes of application are possible, as described above.

[0248] This invention also relates to the use of the nanoparticles of this invention, or nanoparticles obtainable by the methods of this invention, or pharmaceutical compositions of this invention, in the preparation of pharmaceuticals. For example, pharmaceuticals effective in cancer treatment.

[0249] Unless otherwise stated, the following terms as used herein (including the specification and claims) have the definitions given below.

[0250] Those skilled in the art can recognize or determine many equivalents to the specific embodiments of the invention described herein using no more than conventional experimentation. This invention is intended to cover these equivalents.

[0251] It should be noted that, unless otherwise expressly stated herein, the singular forms “a,” “an,” and “the” used herein include plural references. Thus, for example, reference to “a reagent” includes one or more of such different reagents, and reference to “the method” includes equivalent steps and methods known to those skilled in the art that can modify or replace the method described herein.

[0252] Unless otherwise stated, the term "at least" preceding a series of elements should be understood to mean each element in the series.

[0253] The term “and / or” as used herein includes the meaning of “and,” “or,” and “all or any other combination of the elements connected by the term.”

[0254] The terms “about” or “close” as used herein mean within ±20%, preferably within ±10%, and more preferably within ±5%, of the given value or range. However, they also include specific numerical values, such as about 20 including 20.

[0255] Throughout this specification and the following claims, unless the context otherwise requires, the word "comprise" and its variations such as "comprises" and "comprising" shall be understood to mean including the said integer or step or group of integers or steps, but not excluding any other integer or step or group of integers or steps. When used herein, the term "comprise" may also be replaced by the terms "containing" or "comprising," or sometimes by the term "having."

[0256] When used herein, "consisting of..." excludes any element, step, or component not specifically mentioned in the claimed elements. When used herein, "consisting substantially of..." does not exclude materials or steps that do not materially affect the essential and novel features of the claims.

[0257] In each instance herein, the terms “comprising,” “substantially consisting of,” and “composed of” may be replaced by any of the other two words. Any such replacement is contemplated in this disclosure.

[0258] It should be understood that this invention is not limited to the specific methodologies, schemes, materials, reagents, and substances described herein, and these can vary. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the invention, which is defined only by the claims.

[0259] All references cited in this specification (including all patents, patent applications, scientific publications, manufacturers' instructions, user manuals, etc.) are incorporated herein by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to any prior art based on such disclosures. To the extent that the material incorporated by reference contradicts or is inconsistent with this specification, this specification supersedes any such material.

[0260] The invention will be further illustrated by the following items:

[0261] Project 1. A method for generating nanoparticles, the method comprising c) contacting an antibody with a composition comprising a first conjugate (A), the first conjugate comprising a positively charged polypeptide conjugated to a bifunctional linker, characterized in that the composition is substantially free of unconjugated bifunctional linkers, thereby obtaining a second conjugate (B), the second conjugate comprising the positively charged polypeptide, the bifunctional linker, and the antibody; and d) contacting the second conjugate (B), the positively charged polypeptide, and a negatively charged molecule to form nanoparticles.

[0262] Project 2. The method according to Project 1, wherein prior to step c), the method comprises:

[0263] a) Conjugate a positively charged polypeptide to a bifunctional linker; b) Remove unconjugated bifunctional linkers.

[0264] Project 3. The method according to Project 1 or 2, wherein the antibody is purified prior to step c).

[0265] Project 4. The method according to any one of the preceding projects, wherein the method further comprises the recovery of the nanoparticles.

[0266] Project 5. The method according to any one of the preceding projects, wherein in step c), the first conjugate is in molar excess compared to the antibody.

[0267] Project 6. The method according to any one of the preceding projects, wherein in step d), the positively charged polypeptide is in molar excess compared to the second conjugate (B).

[0268] Item 7. The method according to any one of the preceding items, wherein in step d), the negatively charged molecule is in molar excess compared to the second conjugate (B).

[0269] Project 8. The method according to any one of the preceding projects, wherein in step d), the negatively charged molecule is in molar excess compared to the positively charged polypeptide.

[0270] Project 9. The method according to any one of the preceding projects, wherein in step c), the molar ratio between the first conjugate (A) and the antibody is at least about 10:1.

[0271] Item 10. The method according to any one of the preceding items, wherein in step c), the molar ratio between the first conjugate (A) and the antibody is about 10:1 to about 50:1.

[0272] Item 11. The method according to any one of the preceding items, wherein in step d), the molar ratio between the positively charged polypeptide and the second conjugate (B) is at least about 10:1.

[0273] Project 12. The method according to any one of the preceding projects, wherein in step d), the molar ratio between the positively charged polypeptide and the second conjugate (B) is about 10:1 to about 50:1.

[0274] Item 13. The method according to any one of the preceding items, wherein in step d), the molar ratio between the negatively charged molecule and the second conjugate is at least about 1:1.

[0275] Project 14. The method according to any one of the preceding projects, wherein in step d), the nanoparticles are formed by self-assembly.

[0276] Item 15. The method according to any one of the preceding items, wherein step d) includes incubation at about 4-37°C.

[0277] Item 16. The method according to any one of the preceding items, wherein step d) includes incubation for at least about 1 hour.

[0278] Item 17. The method according to any one of the preceding items, wherein in the second conjugate, the positively charged polypeptide and the antibody are interconnected via a bifunctional linker.

[0279] Item 18. The method according to any one of the preceding items, wherein the antibody comprises a heavy chain and a light chain.

[0280] Item 19. The method according to any one of the preceding items, wherein the antibody is specific to cell surface molecules.

[0281] Item 20. The method according to Item 19, wherein cell surface molecules are internalized upon binding of the antibody.

[0282] Item 21. The method according to Item 19 or 20, wherein the cell surface molecule is expressed on cells susceptible to therapeutic treatment of the negatively charged molecule.

[0283] Project 22. The method according to any one of the preceding projects, wherein the antibody is specific to cancer-associated antigens.

[0284] Item 23. The method according to any one of the preceding items, wherein the antibody is specific for CD33, EGFR, IGF1R or CD20.

[0285] Item 24. The method according to any one of the preceding items, wherein the antibody is gemtuzumab, cetuximab, cetuximab, tetuximab, GR11L, or rituximab.

[0286] Item 25. The method according to any one of the preceding items, wherein the antibody has a CDR sequence selected from the following: a. CDR-H1: GFSLTNYG (SEQ ID NO:1), CDR-H2: IWSGGNT (SEQ ID NO:2), CDR-H3: ARALTYYDYEFAY (SEQ ID NO:3), CDR-L1: QSIGTN (SEQ ID NO:4), CDR-L2: YAS, and CDR-L3: QQNNNWPTT (SEQ ID NO:5); b. CDR-H1: GYTITDSN (SEQ ID NO:10), CDR-H2: IYPYNGGT (SEQ ID NO:11), CDR-H3: VNGNPWLAY (SEQ ID NO:12), CDR-L1: ESLDNYGIRF (SEQ ID NO:13), CDR-L2: AAS, and CDR-L3: QQTKEVPWS (SEQ ID NO:10). NO:14); c.CDR-H1:GGTFSSYAIS(SEQ ID NO:19),CDR-H2:GIIPIFGTANYAQKFQ(SEQ ID NO:20),CDR-H3:APLRFLEWSTQDHYYYYYMDV(SEQ ID NO:21),CDR-L1:QGDSLRSYYAT(SEQ ID NO: 22), CDR-L2: GENKRPS (SEQ ID NO: 23), and CDR-L3: KSRDGSGQHLV (SEQ ID NO: 24); d. CDR-H1: GTFFSSYG (SEQ ID NO: 29), CDR-H2: IWFDGSST (SEQ ID NO: 30), CDR-H3: ARELGRRYFDL (SEQ ID NO:31),CDR-L1:QSVSSY(SEQ ID NO:32),CDR-L2:IWFDGSST(SEQ ID NO:33), and CDR-L3:QQRSKWPPWT (SEQ ID NO:34); and e.CDR-H1:GYTFTSYN (SEQ ID NO:39), CDR-H2:IYPGNGDT (SEQ ID NO:40), CDR-H3:CARSTYYGGDWYFNV (SEQ ID NO:41), CDR-L1:SSVSYI (SEQ ID NO:42), CDR-L2:ATS, and CDR-L3:QQWTSNPPT (SEQID NO:43).

[0287] Item 26. The method according to any one of the preceding items, wherein the antibody has a VH and VL sequence selected from the following: a. SEQ ID NO: 6 and 7; b. SEQ ID NO: 15 and 16; c. SEQ ID NO: 25 and 26; d. SEQ ID NO: 35 and 36; and e. SEQ ID NO: 44 and 45.

[0288] Item 27. The method according to any one of the preceding items, wherein the antibody has a heavy chain and light chain sequence selected from: a. SEQ ID NO: 8 and 9; b. SEQ ID NO: 17 and 18; c. SEQ ID NO: 27 and 28; d. SEQ ID NO: 37 and 38; e. SEQ ID NO: 46 and 47; and f. SEQ ID NO: 65 and 18.

[0289] Item 28. The method according to any one of the preceding items, wherein the negatively charged molecule is a nucleic acid.

[0290] Item 29. The method according to Item 28, wherein the nucleic acid is a double-stranded nucleic acid.

[0291] Item 30. The method according to Item 28, wherein the nucleic acid is a single-stranded nucleic acid.

[0292] Item 31. The method according to any one of Items 28-30, wherein the nucleic acid has about 18 to about 25 bp.

[0293] Item 32. The method according to any one of Items 28-30, wherein the nucleic acid has about 18 to about 25 nt.

[0294] Item 33. The method according to any one of the preceding items, wherein the negatively charged molecule is DNA or RNA.

[0295] Item 34. The method according to any one of the preceding items, wherein the negatively charged molecule is siRNA, esiRNA, shRNA, antisense oligonucleotide, or miRNA.

[0296] Item 35. The method according to any one of the preceding items, wherein the negatively charged molecule is a siRNA specific to KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, or FLT3.

[0297] Item 36. The method according to any one of the preceding items, wherein the negatively charged molecule is a mixture of siRNAs specifically selected from one or more targets, preferably KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, and FLT3.

[0298] Item 37. The method according to any one of the preceding items, wherein the negatively charged molecule has a molecular weight of about 20 kDa or less.

[0299] Item 38. The method according to any one of the preceding items, wherein the negatively charged molecule has a charge of at least 2-.

[0300] Item 39. The method according to any one of the preceding items, wherein the positively charged polypeptide is protamine or histone.

[0301] Item 40. The method according to any one of the preceding items, wherein the bifunctional connector is a heterofunctional connector.

[0302] Project 41. The method according to any one of the preceding projects, wherein the bifunctional linker is sulfonyl-SMCC.

[0303] Item 42. A nanoparticle that can be obtained by any one of the preceding items.

[0304] Item 43. A nanoparticle comprising: a) a positively charged polypeptide; b) a second conjugate (B) comprising an antibody conjugated to the positively charged polypeptide; and c) one or more negatively charged molecules.

[0305] Item 44. The nanoparticles according to Item 42 or 43, wherein the positively charged polypeptides are enriched in the outer and / or inner portions of the nanoparticles.

[0306] Item 45. The nanoparticles according to any one of items 42-44, wherein the second conjugate is enriched in the outer portion of the nanoparticles.

[0307] Item 46. The nanoparticles according to any one of items 42-45, wherein one or more negatively charged molecules are enriched in the internal portion of the nanoparticles.

[0308] Item 47. The nanoparticles according to any one of items 42-46, wherein the nanoparticles have an average diameter of about 0.05 μm to about 10 μm.

[0309] Item 48. The nanoparticles according to any one of items 42-47, wherein in the second conjugate, the positively charged polypeptide and the antibody are interconnected via a bifunctional linker.

[0310] Item 49. The nanoparticles according to any one of items 42-48, wherein the antibody comprises a heavy chain and a light chain.

[0311] Item 50. The nanoparticles according to any one of items 42-49, wherein the antibody is specific for cell surface molecules.

[0312] Item 51. The method according to Item 50, wherein cell surface molecules are internalized upon binding of the antibody.

[0313] Item 52. The nanoparticles according to Item 50 or 51, wherein the cell surface molecules are expressed on cells susceptible to therapeutic treatment of the negatively charged molecules.

[0314] Item 53. The nanoparticles according to any one of items 42-52, wherein the antibody is specific for cancer-associated antigens.

[0315] Item 54. The nanoparticles according to any one of Items 42-53, wherein the antibody is specific for CD33, EGFR, IGF1R or CD20.

[0316] Item 55. Nanoparticles according to any one of Items 42 to 54, wherein the antibody is gemtuzumab, cetuximab, cetuximab, tetuximab, GR11L, or rituximab.

[0317] Item 56. The nanoparticles according to any one of items 42-55, wherein the antibody has a CDR sequence selected from the following: a. CDR-H1: GFSLTNYG (SEQ ID NO:1), CDR-H2: IWSGGNT (SEQ ID NO:2), CDR-H3: ARALTYYDYEFAY (SEQ ID NO:3), CDR-L1: QSIGTN (SEQ ID NO:4), CDR-L2: YAS, and CDR-L3: QQNNNWPTT (SEQ ID NO:5); b. CDR-H1: GYTITDSN (SEQ ID NO:10), CDR-H2: IYPYNGGT (SEQ ID NO:11), CDR-H3: VNGNPWLAY (SEQ ID NO:12), CDR-L1: ESLDNYGIRF (SEQ ID NO:13), CDR-L2: AAS, and CDR-L3: QQTKEVPWS (SEQ ID NO:10). NO:14); c.CDR-H1:GGTFSSYAIS(SEQ ID NO:19),CDR-H2:GIIPIFGTANYAQKFQ(SEQ ID NO:20),CDR-H3:APLRFLEWSTQDHYYYYYMDV(SEQ ID NO:21),CDR-L1:QGDSLRSYYAT(SEQ ID NO: 22), CDR-L2: GENKRPS (SEQ ID NO: 23), and CDR-L3: KSRDGSGQHLV (SEQ ID NO: 24); d. CDR-H1: GTFFSSYG (SEQ ID NO: 29), CDR-H2: IWFDGSST (SEQ ID NO: 30), CDR-H3: ARELGRRYFDL (SEQ ID NO:31),CDR-L1:QSVSSY(SEQ ID NO:32),CDR-L2:IWFDGSST(SEQ ID NO: 33), and CDR-L3: QQRSKWPPWT (SEQ ID NO: 34); and e. CDR-H1: GYTFTSYN (SEQ ID NO: 39), CDR-H2: IYPGNGDT (SEQ ID NO: 40), CDR-H3: CARSTYYGGDWYFNV (SEQ ID NO: 41), CDR-L1: SSVSYI (SEQ ID NO:42), CDR-L2:ATS, and CDR-L3:QQWTSNPPT (SEQID NO:43).

[0318] Item 57. The nanoparticles according to any one of items 42-56, wherein the antibody has a VH and VL sequence selected from the following: a. SEQ ID NO: 6 and 7; b. SEQ ID NO: 15 and 16; c. SEQ ID NO: 25 and 26; d. SEQ ID NO: 35 and 36; and e. SEQ ID NO: 44 and 45.

[0319] Item 58. The nanoparticles according to any one of items 42-57, wherein the antibody has a heavy chain and light chain sequence selected from: a. SEQ ID NO: 8 and 9; b. SEQ ID NO: 17 and 18; c. SEQ ID NO: 27 and 28; d. SEQ ID NO: 37 and 38; e. SEQ ID NO: 46 and 47; and f. SEQ ID NO: 65 and 18.

[0320] Project 59. Nanoparticles according to any one of Projects 42-58, wherein the negatively charged molecules are nucleic acids.

[0321] Item 60. The nanoparticles according to any one of Items 42-59, wherein the nucleic acid is a double-stranded nucleic acid.

[0322] Item 61. The nanoparticles according to any one of Items 42-60, wherein the nucleic acid is a single-stranded nucleic acid.

[0323] Item 62. The nanoparticles according to any one of Items 42-61, wherein the nucleic acid has a density of about 18 to about 25 bp.

[0324] Item 63. The nanoparticles according to any one of items 42-62, wherein the single-stranded nucleic acid has about 18 to about 25 nt.

[0325] Item 64. The nanoparticles according to any one of items 42-63, wherein the negatively charged molecule is DNA or RNA.

[0326] Item 65. The nanoparticles according to any one of Items 42-64, wherein the negatively charged molecule is siRNA, esiRNA, shRNA, antisense oligonucleotide, or miRNA.

[0327] Item 66. The nanoparticles according to any one of Items 42-65, wherein the negatively charged molecule is a siRNA specific to KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, or FLT3.

[0328] Item 67. The nanoparticles according to any one of Items 42-66, wherein the negatively charged molecule is a mixture of one or more target-specific siRNAs preferably selected from KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1 and FLT3.

[0329] Item 68. The nanoparticles according to any one of items 42-67, wherein the negatively charged molecule has a molecular weight of about 20 kDa or less.

[0330] Item 69. The nanoparticles according to any one of items 42-68, wherein the negatively charged molecules have a charge of at least 2.

[0331] Item 70. The nanoparticles according to any one of items 42-69, wherein the positively charged polypeptide is protamine or histone.

[0332] Item 71. The nanoparticles according to any one of Items 42-70, wherein the bifunctional linker is a heterofunctional linker.

[0333] Item 72. The nanoparticles according to any one of Items 42-71, wherein the bifunctional linker is sulfonyl-SMCC.

[0334] Item 73. A composition comprising any one of items 42-72.

[0335] Item 74. The composition according to Item 73, wherein the composition is a pharmaceutical composition.

[0336] Item 75. Nanoparticles according to any one of items 42-72 or compositions according to items 73 or 74, used in treatment.

[0337] Item 76. Nanoparticles or compositions for use according to Item 75, wherein the use is in the treatment of cancer.

[0338] Item 77. Nanoparticles or compositions used according to Item 75, wherein the use is in the treatment of solid tumors.

[0339] Item 78. The nanoparticles or composition used according to Item 75, wherein the use is in the treatment of cancers selected from: lung cancer, sarcoma, colorectal cancer, and leukemia.

[0340] Item 79. A kit comprising nanoparticles as described in any one of items 42-72 or the composition described in items 73 or 74.

[0341] Item 80. The method according to any one of Items 1-41 or the nanoparticles according to any one of Items 42-72, wherein the negatively charged molecule is a drug and / or prodrug, such as remdesivir triphosphate.

[0342] Item 81. The method of any one of Items 1-41 or the nanoparticles of any one of Items 42-72, wherein the negatively charged molecule is a drug and / or prodrug (e.g., ibrutinib) conjugated to a portion having a negative net charge (e.g., Cy 3.5 or Alexa488).

[0343] Example

[0344] The following embodiments illustrate the present invention. These embodiments should not be construed as limiting the scope of the invention. These embodiments are included herein for illustrative purposes only, and the invention is limited only by the claims.

[0345] Example 1: Improvement of the joining scheme

[0346] When we follow N. et al., 2016; N. et al., 2018; In implementing the chemical conjugation between the selected vector antibody sulfonyl-SMCC and protamine, as disclosed in S. et al., 2015, we were puzzled by the resulting conjugates, which exhibited unexpected properties in SDS-PAGE electrophoresis: for example, we frequently observed the phenomenon of IgG conjugates no longer being reduced by reducing agents such as DTT, DTE, β-mercaptoethanol, or TCEP. Figure 1 (See gel a for illustration, A and B). Next, we observed conjugates exhibiting much higher molecular weights than expected, representing dimers or polymers of cross-linked IgG, some containing additional protamine, and some not. Figure 1 (See Figure C for illustration; also refer to gel B). In extreme cases, the complexity of all these side reactions leads to a cloud-like appearance in the resulting conjugate, which may be due to... Figure 1 This is caused by the mixture of all these conjugates ad in B.

[0347] Conversely, the expected conjugate is Figure 1 The formulation labeled C is a protamine that retains the natural disulfide bonds of HC and LC within and outside the peptide, without any additional internal cross-linking, but has various protamine cross-links with light chain (LC) and heavy chain (HC).

[0348] Therefore, we improved the conjugation scheme by introducing an additional purification step after activating the amino terminus of the protamine peptide using sulfonyl-SMCC. The resulting product was purified by gel chromatography, separating the activated SMCC-protamine from the still-active excess sulfonyl-SMCC precipitate. From this step onwards, antibody conjugation was performed using a homogeneous solution of pure SMCC-protamine without any contamination from residual cross-linking agents. Figure 2 ).

[0349] Therefore, all experiments shown in the following examples were performed according to the “new” SMCC-depletion protocol. The resulting complexes showed significant improvements in electrophoretic homogeneity, targeting performance, and functional effectiveness.

[0350] Therefore, all findings presented in this paper were made using therapeutic agents synthesized through novel production methods, rather than those produced using conventional methods. N. et al., 2016; N. et al., 2018; The formulation disclosed in S. et al., 2015, was carried out.

[0351] Example 2: Inactivation of oncogenes in non-small cell lung cancer using an undisclosed improved conjugation scheme

[0352] Next, we targeted a non-small cell lung cancer (NSCLC) cell line expressing EGFR using cetuximab-protamine. Here, cetuximab-protamine was able to bind 8 mol siRNA / mol cetuximab-protamine (…). Figure 3 A, B), and deliver siRNA to early endosomes in a receptor-dependent manner ( Figure 3 C). Treatment with anti-EGFR-mAB-protamine complexed with anti-KRAS and siRNA effectively silenced KRAS in in vitro-treated NSCLC cell lines. Figure 3 D). In cetuximab-sensitive A549 cells, cetuximab conjugated with control siRNA had a small effect on cell growth, colony formation, tumor growth, and tumor weight in CD1 nude mice, consistent with randomized clinical trials of cetuximab in NSCLC patients. However, this effect was significantly amplified by using KRAS siRNA; see [link to relevant documentation]. Figure 3 E and F (insets on the right). Cetuximab-resistant SK-LU1 cells tolerated cetuximab-control siRNA better, but here, KRAS siRNA significantly inhibited colony and tumor growth. Figure 3 E and F (smaller images on the left).

[0353] Next, we investigated the effect of systemic anti-EGFR-mAB-siRNA treatment on the expression of the proliferation marker Ki67 in NSCLC xenograft tumors on immunofluorescence in frozen sections (A549 tumors) and paraffin sections (SK-LU-1 tumors). A549 tumors treated with either PBS or anti-EGFR-mAB-control-siRNA... Figure 4 AD) and SK-LU-1 tumors ( Figure 4 In GJ, Ki67 staining was widely distributed in the Hoechst-stained nuclei of various tumor cells. In contrast, tumors treated with anti-EGFR-mAB-KRAS-siRNA showed a much lower number of proliferative cells displaying Ki67 staining. Figure 4 EF and 2K-L).

[0354] Systemic anti-EGFR-mAB-siRNA application of tumor growth arrest can be induced not only by reducing tumor tissue proliferation but also by increasing apoptosis. Furthermore, the induction of apoptosis is, of course, the desired effect of potential cancer therapeutics capable of actively reducing tumor size. We aimed to investigate the abundance of apoptotic cells in isolated tumor tissues by TUNEL (terminal deoxynucleotidyl transferase dUTP nick-end marker) staining, which reveals DNA breaks in the cell nucleus as a marker of apoptosis. After peroxidase staining, control-treated tumor sections showed a significantly higher abundance compared to PBS-treated sections. Figure 5 Compared to AB), treatment with anti-EGFR-mAB- control siRNA ( Figure 5 In A549 tumors of CD, TUNEL-positive nuclei doubled, and this doubled further when the vector contained KRAS siRNA. Figure 5 EF is used for illustration. Figure 5 M is used for statistics). Apoptosis signals were detected using PBS ( Figure 5 GH) and anti-EGFR-mAB- control siRNA ( Figure 5 SK-LU1 tumors treated with IJ were indistinguishable, but when KRAS-siRNA was conjugated with an antibody vector and applied to xenograft tumors, the number of TUNEL-positive cell nuclei increased fourfold. Figure 5 KL and Figure 5 N).

[0355] In summary, the significant and substantial reduction in tumor size resulting from treatment with anti-EGFR-mAB-KRAS siRNA can be explained by a combination of decreased proliferation and increased apoptosis in each tumor.

[0356] Furthermore, we utilized the fact that EGFR is also expressed on the surface in sarcomas (see (Herrmann et al., 2010) and the next chapter). The observation that cetuximab was ineffective as a single agent in the first clinical trial of sarcoma (Ha et al., 2013) is irrelevant to our objectives because our system relies on an antibody that does not act as an active anticancer agent but rather as a component of a shuttle system carrying oncogene-specific effector siRNA.

[0357] Example 3: Targeting oncogenes in rhabdomyosarcoma

[0358] Rhabdomyosarcoma (RMS) is an aggressive soft tissue sarcoma originating from immature myoblasts, primarily occurring in children and young adults. Pediatric RMS is divided into two main categories based on its histological appearance: approximately two-thirds represent embryonic RMS (ERMS), which has a better prognosis, and one-third represent the more invasive alveolar RMS (ARMS) (Stevens, 2005). To date, apart from the accumulation of 11p15 heterozygous loss, no common genetic lesions with diagnostic value have been identified in ERMS (Chen et al., 2013). Targeting key drivers of ARMS is more likely to have therapeutic effects. The genetic lesion characteristic of alveolar rhabdomyosarcoma (ARMS) is the PAX3-FKHR or PAX7-FKHR fusion via chromosomal translocations of t(1;13) or t(2;13). Therefore, targeting the PAX-FKHR fusion gene and its transcripts may be a specific and effective means of inhibiting the malignant growth of ARMS cells and inducing their apoptosis. Discovering inhibitors of oncogenic fusion proteins or mutant proteins is challenging. Either the protein is “drug-free,” or drug treatment leads to the selection of a resistant form of the protein and results in a more severe relapse (Verdine and Walensky, 2007).

[0359] Downregulating fusion proteins via RNAi aims to overcome these problems because it suppresses expression at the mRNA level. Specifically, downregulating the expression of the PAX3-FKHR fusion protein via RNAi in RMS cells has a direct impact on the malignant phenotype. Silencing the PAX3-FKHR fusion with siRNA targeting PAX3 or PAX3-FKHR reduces the proliferation, migration, and colony formation of RMS cell lines (Kikuchi et al., 2008; Liu, L. et al., 2012). Therefore, we hope to achieve therapeutic effects by using our established antibody-protamine vector system to effectively downregulate ARMS-specific fusion proteins via RNAi delivered to tumor cells in a stable and specific manner.

[0360] In RMS, IGF1R and epidermal growth factor receptor (EGFR) are candidate targets for our modular vector. Our technology allows tumor cells to be distinguished from other cells by two independent features, thus providing a double layer of specificity: a) cell surface receptor decoration and b) cellular oncogenic devices. We and others (Herrmann et al., 2010) have identified high-density surface expression of EGFR and IGF1R in different alveolar (and embryonic) RMS cell lines. Both cell surface receptors can serve as target components of our system.

[0361] To examine the targeting efficiency of our antibody construct in RMS cell lines, we treated ERMS EGFR cells with an anti-EGFR antibody (cetuximab)-siRNA complex. + The cell line RD was used to treat ARMS IGF1R with an anti-IGF1R-siRNA complex. + Cell line RH-30 ( Figure 6 Both cell lines expressed IGF1R and EGFR at variable levels. Figure 6 A), and based on their highest expression, RD cells preferentially internalize anti-EGFR-Alexa488-siRNA ( Figure 6 B and C (smaller images above), while RH-30 cells preferentially internalize the anti-IGF1R-Alexa488 siRNA complex ( Figure 6 B (small image below). Alexa488-siRNA can be internalized by cetuximab-protamine into up to 90% of all EGFR cells. + RD cells ( Figure 6 C, the small middle image, shows the anti-IGF1R antibody in IGF1R. + The effect was poor in RH-30 cells. Figure 6 B, small image below).

[0362] To conduct a proof-of-concept experiment on RMS-typical PAX3-forkhead fusion oncogene-specific targeting, we designed a breakpoint region spanning PAX3-FKHR ( Figure 7 Various siRNAs of D) were used to treat ARMS RH-30 cells in colony formation analysis, specifically those siRNAs conjugated to cetuximab-protamine that crossed breakpoints. Compared to the control, breakpoint siRNAs significantly reduced colony formation in RH-30 cells. Figure 7 E), while RD colony formation in ERMS-type cells is impaired by the transport of NRAS combined with cMyc siRNA. Figure 7(A and B) are two target genes representing well-known oncogenes in ERMS. Therefore, treatment of RD cells with anti-EGFR / NRAS siRNA resulted in decreased expression of the NRAS oncogene in Western blotting (intermediate row). Figure 7 C).

[0363] These results demonstrate that we can target RMS cell lines using our modular antibody-siRNA system with at least two different monoclonal antibodies, depending on our selection of specific transport nucleic acids to induce receptor decoration in RMS tumors that inactivate oncogenes.

[0364] Example 4: Targeting oncogenes in Ewing sarcoma

[0365] Ewing sarcoma is a bone tumor in children and young adults. In the metastatic stage, long-term complete remission is less than 35%, highlighting the urgent need for better treatment options (Paulussen et al., 1998; Paulussen et al., 2008). The central genetic event is the occurrence of the chromosomal translocation t(11;22), which leads to the formation of the fusion protein EWS-FLI1 in these tumor cells (Arvand and Denny, 2001). Ewing sarcoma cells express a high level of IGF1R on their surface. Therefore, we aimed to apply our modular therapy using anti-IGF1R antibodies such as clone ImcA12 (cetumumab) or tetumumab as SMCC-protamine conjugates to deliver EWS-FLI1 breakpoint-specific siRNA. As a validation of principle, we used the commercially available anti-IGF1R mouse antibody GR11L (Merck) and showed it to target Ewing cells. These results were presented in (…). Published in N. et al., 2016) and Figure 8 Described in the text.

[0366] To enable the use of this treatment option, we cloned and expressed two distinct IGF1R antibodies in CHO-S cells and purified them using HPLC. These were cetuximab (hereinafter referred to as "A12") and tetromumab (hereinafter referred to as "Tepro"). Both were produced in sufficient quantities and conjugated with SMCC-protamine (…). Figure 9 A), both bind to siRNA ( Figure 9 B) and transported siRNA to IGF1R-positive cells SKNM-C ( Figure 9 C).

[0367] When cells were incubated with IGF1R-mAB-protamine conjugates combined with siRNA targeting EWS-FLI1 and then seeded on semi-solid soft agar, colony formation was significantly reduced. Figure 10 (A and B).

[0368] Therefore, we infer that our modular system can also be applied to the use of anti-IGF1R antibodies and sarcoma cells, especially for the knockdown of fusion protein-specific siRNAs, such as EWS-FLI1-siRNA.

[0369] Example 5: Oncogene Targeting in a Lymphoma Model

[0370] Diffuse large B-cell lymphoma (DLBCL) represents a common subtype of lymphoma. DLBCL cells express CD20 on their surface. The standard first-line treatment for affected patients is a combination of chemotherapy and the anti-CD20 antibody rituximab. Rituximab binds to and blocks the CD20 molecule, leading to antibody-dependent cytotoxicity (ADCC). This approach can cure approximately 65% ​​of patients. Patients who are refractory to first-line therapy or relapse after an initial response are characterized by extremely low survival, highlighting the urgent need for new treatment methods. Therefore, our aim is to combine rituximab, a first-line cell-targeting antibody, with siRNAs that target different oncogenes recognized in genetically distinct lymphoma cells. Figure 15 ).

[0371] We first chemically conjugated the CD20 antibody rituximab with different ratios of SMCC-protamine to compare the binding efficacy of each complex to siRNA. Figure 13 Interestingly, even with a high excess of 80 or 120 mol of unbound SMCC-protamine, the binding of siRNA was almost identical to that of 1 mol of antibody conjugated with 40 mol of SMCC-protamine. Figure 13 Therefore, we infer that a minimum amount of SMCC-protamine is sufficient, and return to the usual antibody:SMCC-protamine ratio of 1:32. Figure 14 We first tested the binding affinity of rituximab-protamine to siRNA as described above, and observed coordination between siRNA and the vector system similar to that of other vector antibodies (approximately 8 mol / mol). Figure 14 B).

[0372] Subsequently, tests showed that different DLBCL cell lines exhibited positive surface expression of CD20 and CD33. Figure 15 (See the small image above). Therefore, internalization studies were conducted using anti-CD20 mAB rituximab and anti-CD33-mAB gemutumab.

[0373] The DLBCL cell line was screened for B-cell receptor axis molecules by antibody-mediated siRNA knockdown in order to generate target molecules other than BTK. Figure 15 This resulted in significant inhibition of colony growth, which was particularly evident in HBL1 cells targeted with anti-CD33-antibody-siRNA. Figure 15 (See the small image below).

[0374] Example 6: A complex formed by a carrier antibody-protamine and a small molecular weight poly-anionic drug with a chemical structure different from siRNA.

[0375] In another research project, we hypothesize that therapeutic monoclonal antibodies such as rituximab or gemutumab could be used as carrier molecules for low molecular weight (1mW) drugs. This strategy is important in clinical practice because the pharmacodynamics and safety of many 1mW drugs, such as kinase inhibitors, can be improved by targeted carriers compared to untargeted forms. Therefore, we hypothesize the use of such antibody-inhibitor conjugates, i.e., these conjugates can be applied at lower doses because the antibody helps enrich the inhibitor in the intended target cells, and ii) the antibody inhibits the uptake of the inhibitor by unintended cells, where the inhibitor may induce unintended toxic reactions.

[0376] In the first set of experiments, we synthesized a negatively charged small molecule with a 4- charge, which is a derivative of a known proliferation inhibitor, referred to herein as small molecule 1 (SM-1). Therefore, we converted the uncharged small molecule inhibitor into a strongly anionic compound (referred to herein as "SM-1 / RF") by adding a negative charge and emitting red fluorescence. This allowed it to bind electrostatically to our protamine-based carrier system to form an antibody-inhibitor conjugate.

[0377] In addition to the strong polyanionic charge of the red fluorescent dye, this conjugate also has the advantage of being easily traceable in vitro and in vivo in the form of red fluorescence.

[0378] Subsequently, we performed the same experiments on the binding between SM-1 / RF and two vector systems, rituximab (CD20)-protamine and reliable cetuximab (EGFR)-protamine. Both vectors exhibited strong co-assembly of SM-1 / RF, and due to the low molecular weight of SM-1 / RF (approximately 13 kDa) compared to siRNA, they had extremely high electrostatic saturation mol / mol ratios, exceeding 100 mol SM-1 / RF / mol vector mAb. Figure 17 ).

[0379] Rituximab-protamine and cetuximab-protamine, the corresponding conjugates of SM-1 / RF loaded with a subcritical 20x excess, were incubated in cell lines expressing CD20 and EGFR, and intracellular enrichment of SM-1 / RF was analyzed. In both cases, intracellular enrichment of fluorescence signals under typical red fluorescence excitation / emission wavelength combinations could be recorded. Figure 18 As a result, the modified SM-1 / RF compound was internalized by the cell, thus enabling it to begin functioning.

[0380] Example 7: Surprising characteristics of an effective antibody-protamine-siRNA formulation

[0381] The precise conjugation method used for all the antibodies we employed can be broken down into two steps: First, protamine is conjugated to sulfonated SMCC at the amino terminus, followed by a size exclusion process to remove excess conjugating cross-linking agent. Second, the activated protamine-SMCC is directionally conjugated to the IgG backbone cysteine ​​residues. As observed by SDS-PAGE electrophoresis, the resulting bioconjugates show significant molecular weight shifts in both the heavy and light chains of IgG. Approximately 60-80% of the IgG is converted to contain the protamine tag, and residual excess protamine is always visible.

[0382] Targeting EGFR-mAB cetuximab-protamine conjugate Figure 19 As shown in A, we depleted unbound protamine from the reaction mixture using protein G interaction chromatography. The protamine-conjugated antibody bound to the protein G matrix, while the unbound protamine was eluted earlier, followed by purified IgG-protamine complexes free of protamine (see fractions 29-31). Surprisingly, we found that despite protamine conjugation, this substance did not bind to siRNA in typical band transfer assays (see [reference]). Figure 19 The right half of B, while the unpurified mAB-protamine complex binds to siRNA at the usual 1:16 molar ratio.

[0383] To further test the effectiveness of formulations containing protamine and those depleted by protamine, we treated EGFR- and KRAS-dependent A549 and SK-LU1 NSCLC cell lines with two formulations: one containing KRAS-siRNA and the other a control-siRNA. Only those formulations containing free protamine (see [link to relevant documentation]) were effective. Figure 19 A and B, “anti-EGFR-mAB conjugated with 32x SMCC-protamine”, effectively reduced colony growth in cell lines containing KRAS-siRNA, as expected for their oncogene addiction. Figure 20 (A and B).

[0384] We performed the exact same purification steps on the anti-CD33 mAB gemtuzumab, and we used it for experimental treatment of AML and observed the same effect: the unbound protamine conjugate formulation, depleted by HPLC, could not bind siRNA to the required amount. Figure 21 B, small image below), while unpurified formulations can be completely ( Figure 21 B, small image above).

[0385] Furthermore, compared to unpurified material, in the colony formation assay, the carrier without unbound SMCC-protamine showed no residual anti-DNMT3A-siRNA inhibitory efficacy against OCI-AML2 cells. Figure 21 C). This observation contradicts our previous hypothesis regarding the molecular assembly of the carrier system ( Figure 3 A) It is inconsistent and, in general, challenges our previous assumptions.

[0386] In order to find an explanation for these puzzling and unexpected observations, we conducted numerous experiments.

[0387] Considering Figure 19 Based on the results, we hypothesize that the presence of unbound SMCC-protamine in the CD20-mAB-protamine-SM-1 / RF-protamine adduct may be as important as in the siRNA adduct; therefore, we depleted protamine from the rituximab-CD20 mAB formulation using affinity chromatography as described above. It is hypothesized that the depleted formulation ( Figure 22 A, grade 25) cannot be used with preparations containing SMCC-protamine ( Figure 22 B, right) binds and coordinates with the polyanion SM-1 / RF to the same extent. Figure 22 B, left).

[0388] The same findings were obtained using an anti-IGF1R monoclonal AB IMCA-12 conjugate. Figure 23 SMCC-protamine depleted antibody-protamine conjugates cannot electrostatically bind siRNA.

[0389] exist Figure 24 In this study, we tested A12 vector antibodies depleted of SMCC-protamine. Figure 23 The ability to efficiently deliver oncogene-inactivating siRNAs in SKNM-C Ewing sarcoma cells. Although undepleted A12-SMCC-protamine loaded with effective siRNA reduced colony growth, depleted formulations (see [link to article]) Figure 23 (Grades 19-21) cannot reduce colony growth.

[0390] Example 8: Deciphering the role of free SMCC-protamine in the antibody-SMCC-protamine / free SMCC-protamine complex

[0391] Based on the previous results, we found that our targeting would not function without the presence of free SMCC-protamine. Therefore, we wanted to determine the role of free SMCC-protamine in the complex. Of course, we had to rule out the possibility that the primary function was performed by free SMCC-protamine. Therefore, we conducted a series of experiments using free SMCC-protamine and other negative controls.

[0392] First, we performed colony formation analysis using the IGF1R-positive but EGFR-negative Ewing sarcoma cell line SKNM-C, which is dependent on the EWS-FLI1-translocation product (…). Figure 25 As a positive control, we inhibited the EWS-FLI1 translocation product by treating cells with an anti-IGF1R-mAB-protamine complex conjugated to anti-EWS-FLI1(E / F)-siRNA, which resulted in a significant reduction in SKNM-C cell colony growth. Figure 25 In contrast, compared to the control siRNA, the transport of anti-EGFR-mAB-protamine, using anti-EWS-FLI1-siRNA with and without free SMCC-protamine as a carrier, did not result in a reduction in colony formation. Figure 25 This indicates that the IGF1R-mediated targeting is specific and not due to free SMCC-protamine. Furthermore, the use of SMCC-protamine alone at the same concentration as the anti-EGFR antibody (60 nM) did not induce inhibition of colony formation. Figure 25 ).

[0393] Next, we used a conventional targeting mixture to combat SKNM-C Ewing sarcoma cells, which included an anti-IGF1R antibody conjugated with SMCC-protamine, an amount of free SMCC-protamine equal to that present in the anti-IGF1R-mAB-protamine complex (60 nM of the carrier conjugated with 30 times the excess of SMCC-protamine is equivalent to ≤1800 nM of potential free SMCC-protamine), and potent anti-EWS-FLI1-siRNA ( Figure 26 A). When we omitted the targeting of anti-IGF1R-mAB A12 and treated SKNM-C cells with only the same concentration of free SMCC-protamine plus effective siRNA as in the complete mixture, no reduction in colony growth was observed compared to the control scr-siRNA. Figure 26 A). We also have AML cell line OCI-AML-2 ( Figure 26 B) and A549 NSCLC cells ( Figure 26 This strategy was tested in (C), where the targeted mAbs (anti-CD33 or anti-EGFR, respectively) were omitted, but normal, effective siRNA was provided. As in SKNM-C, free SMCC-protamine loaded with effective siRNA still had no effect, just like the control siRNA.

[0394] This leads us to hypothesize that while the correct antibody is needed to detect the intended target cell surface molecules, two additional prerequisites must be met to effectively bind and complex the siRNA and target it to oncogenic molecules for therapeutic efficacy: a) protamine conjugated with the targeting antibody, and b) a sufficient residual amount of unbound SMCC-protamine in the mixture. Free SMCC-protamine without an antibody-conjugated vector does not meet these requirements.

[0395] The next problem to be solved is which improved assembly structure of our vector system can explain, without contradiction, all the in vitro and in vivo efficacy results observed in our studies.

[0396] Example 9: Detection and visualization of unpredictable electrostatic macroscopic structures forming stable nanoparticles

[0397] If the treated cells express the corresponding cell surface receptors or molecules, the intracellular antibody-protamine-siRNA complex is easily identified in the treated cell culture sample, such as... Figure 27 As shown: Here, cetuximab (anti-EGFR)-SMCC-protamine with bound siRNA is internalized into EGFR-expressing NSCLC cells and internally processed into early endosomes (white dot, left inset), but not into lysosomes (gray dot, middle inset).

[0398] Example 10: Antibody-protamine-siRNA complex without free SMCC-protamine or free SMCC-protamine-siRNA alone not internalized in target cells.

[0399] Interestingly, only when the residual SMCC-protamine from the conjugation scheme remains in the mixture ( Figure 28 Only by using the right hand can the typical internalized vesicle structure be observed, but if protamine-SMCC is depleted by affinity chromatography, the internalized vesicle structure cannot be seen. Figure 28 On the left, the chromatography results are also shown. Figure 19 Therefore, visually, the presence of unbound protamine-SMCC is crucial for the efficacy of the conjugate.

[0400] We also performed this process using other antibody-SMCC-protamine complexes and free SMCC-protamine, and compared them with the counterparts of the complexes whose free SMCC-protamine was depleted by HPLC: no internalization was observed in cell lines using antibody-protamine-siRNA complexes without free SMCC-protamine or with only free SMCC-protamine. Figure 29 , Figure 30 and Figure 31 ).

[0401] Example 11: Formation of vesicle structures in vitro using antibody-protamine-siRNA complex

[0402] Whenever we conducted negative control experiments, i.e., treating cells that did not express the EGF receptor with an effective conjugate targeting the EGF receptor, we observed extremely low cell targeting efficiency. Figure 32 B), but we were drawn to the accumulation of extracellular fluorescent micelle structures. These accumulations of matrix-like structures, which may adhere to the surface of treated culture dishes, can only be observed when no targets for binding and internalization of conjugates are found on the cell. Furthermore, these accumulations are all of similar size, and they must be much larger than approximately 10–20 nm. A size of 10–20 nm is equivalent to one IgG plus several protamines plus eight attached siRNA monomers, because this size is undetectable as particles under a fluorescence microscope, which has approximately half the resolution of the emission wavelength, producing particle sizes larger than 200 nm.

[0403] Therefore, we hypothesize that the three components 1. cetuximab-SMCC-protamine, 2. siRNA, and 3. unbound SMCC-protamine form a stable macrostructure required for activity. To confirm the existence of this macrostructure responsible for the efficacy of IgG-protamine-siRNA, we applied particle size detection via dynamic light scattering (DLS) on a zeta counter (MALVERN), which correlates with light diffusion caused by particles in solution. The results are interesting: as a dynamic process, components with seemingly reasonable sizes (22 nm for IgG-protamine-siRNA monomers) spontaneously assemble into nanostructures larger than 400 nm after several hours, a process undetectable in protamine-depleted formulations. Figure 33 ).

[0404] This process is time-dependent, and larger structures only form after a certain period of incubation. Figure 34 A 2-6 hour time interval is sufficient for those macrostructures to form, which then begin to partially decompose again after 24 hours in an unprotected PBS environment at room temperature.

[0405] Based on these measurements, we hypothesized that antibody-protamine / free SMCC-protamine / siRNA complexes formed extracellularly, independent of the cellular environment. To observe these complexes, we incubated different cell-free complex compositions overnight on coated chambered slides using Alexa488-siRNA and fixed the formed structures the following day. Fluorescence microscopy revealed that vesicle structures formed only when the three components found each other: 1. antibody-SMCC-protamine, 2. free SMCC-protamine, 3. siRNA (see [link to study]). Figure 35 ).

[0406] All antibody-protamine complexes containing free SMCC-protamine formed vesicle nanostructures, while antibody-protamine complexes without free SMCC-protamine or SMCC-protamine alone did not form any nanostructures. Figure 36 ).

[0407] In detail, the nanostructure resembles a micrometer-sized sphere shape formed by three components: mAB-SMCC-protamine, unconjugated SMCC-protamine, and Alexa488-tagged siRNA. Figure 37 The structure was verified by fluorescence microscopy and laser scanning confocal microscopy. It was evident that the spherical structure was completely filled with the Alexa488 signal from the siRNA compound.

[0408] The results are summarized in the table below.

[0409]

[0410]

[0411] Example 12: Vesicle structures appearing in vitro at different temperatures

[0412] We also tested whether vesicle formation depended on a specific temperature. In fact, vesicle structures formed at 4°C, room temperature (~22°C), and 37°C. Figure 38 ).

[0413] Example 13: The formation of functional vesicle structures in vitro by the antibody-protamine-siRNA complex depends on the amount of free SMCC-protamine.

[0414] To further elucidate the function of SMCC-protamine, coupled to the antibody and acting as a free molecule within the complex, we titrated the amount of SMCC-protamine added to the antibody, which was in this context, the anti-EGFR antibody cetuximab. We used a constant amount of cetuximab and added SMCC-protamine at a molar ratio of 1:1 to 1:100 (see details...). Figure 39 A). We then examined the conjugation efficiency on Coomassie-stained SDS-PAGE and found that conjugation of the light chain (LC) and heavy chain (HC) of the antibody was suboptimal when incubated at an antibody:SMCC-protamine ratio of 1:1 to 1:10. Figure 39 B). At an antibody:SMCC-protamine molar ratio of 1:32, the conjugation process appeared to be saturated, with no further enhancement observed at 1:50 and 1:100. Figure 39 B).

[0415] We analyzed the siRNA binding ability of these different conjugates using conventional band transfer assays. Figure 40 AF). siRNA binding can be detected at conjugation ratios ranging from 1:32 to 1:100. Figure 40 DF), at a lower proportion, no effective siRNA binding was detected ( Figure 40 AC).

[0416] We determined the relationship between these conjugated products and Alexa488-control-siRNA ( Figure 40 GL) and EGFR-positive A459 cells ( Figure 40 The ability of cetuximab to form vesicle structures in the absence of cells when incubated together with SMCC-protamine was further analyzed, and the properties of different conjugated products were further examined. When cetuximab was conjugated with SMCC-protamine at ratios of 1:1 to 1:10, no effective cell-free vesicle formation was observed. Figure 40 GI), while at a ratio of 1:32, vesicle formation is very abundant ( Figure 40 J), while at ratios of 1:50 and 1:100, vesicle formation decreased (J). Figure 40 KL). These complexes exhibit the highest internalization ability at a 1:32 conjugation ratio. Figure 40 P), at a 1:10 conjugation ratio, its internalization ability decreases ( Figure 40 O). In 1:1 ( Figure 40 M), 1:3.2 ( Figure 40 N) or 1:50 to 1:100 ( Figure 40 No internalization was observed at the QR ratio. This suggests that the optimal complex formation of cetuximab with SMCC-protamine is 1:32, as this ratio results in the most efficient conjugation, no vesicle formation, and internalization into the cell.

[0417] As a functional assay, we compared the efficiency of different conjugated products in inhibiting A549 cell colony formation after knockdown of the oncogene KRAS. We also compared it with an equivalent amount of unconjugated cetuximab-free SMCC-protamine to elucidate the effect of unbound SMCC-protamine alone. Figure 40 Surprisingly, compared with the contaminated control siRNA, cetuximab conjugated only with KRAS-siRNA:SMCC-protamine 1:32 resulted in a significant reduction in colony formation (SX). Figure 40 V). At any concentration, SMCC-protamine alone cannot induce inhibition of colony formation by KRAS knockdown. Figure 40 SX). We observed only alarming toxicity of SMCC-protamine complexed with Scr-siRNA and KRAS-siRNA at the highest concentrations (SX). Figure 40 WX).

[0418] Example 14: Free SMCC-protamine can be reintroduced into an antibody-protamine conjugate depleted by SMCC-protamine to form vesicle structures in vitro, and the free SMCC-protamine can be replaced by free protamine.

[0419] To further elucidate the function of SMCC-protamine, conjugated to the antibody and acting as a free molecule within the complex, we titrated the amount of SMCC-protamine added to an antibody-protamine conjugate in which free SMCC-protamine was depleted by HPLC. Figure 36 As shown in F, these antibody-protamine conjugates cannot form vesicle structures with fluorescent siRNA. Therefore, we wanted to know if it was possible to reintroduce free SMCC-protamine to achieve this function, and whether SMCC-protamine could be replaced with sulfonyl-SMCC-free protamine. We added different amounts of free SMCC-protamine and protamine alone to anti-EGFR-mAB-P. Figure 41 Adding antibody-associated 1×SMCC-protamine or 10×SMCC-protamine does not effectively form vesicle structures. Figure 41 A and B), while the addition of 32×SMCC-protamine resulted in very efficient vesicle formation (A and B). Figure 41 C). Based on this analysis, protamine sulfate without chemical coupling to sulfonyl-SMCC can be used to replace free SMCC-protamine sulfate. Figure 41 F).

[0420] Example 15: Formation of vesicle structures in vitro via antibody-protamine-siRNA and / or SM-1 / RF complex

[0421] To test this novel and unpredictable nanostructure model, we used the structurally completely different but electrostatically charged molecule SM-1 / RF (see Example 8) and complexed it with an antibody-protamine conjugate. Figures 42-45 ).

[0422] During examination of cell-free assembly results of mAB-protamine-SM-1 / RF-conjugates containing and without additional siRNA, we observed significant differences in the number and size of the corresponding nanostructures: those assembled by siRNA-conjugates of mAB-protamine and SM-1 / RF+ free SMCC-protamine were much larger and more densely packed than those without siRNA. Figure 42 C and F and Figure 43 D and H). We explain this phenomenon by assuming that the nanostructure is composed of mixed particles consisting of all four components that form stable nanostructures. In detailed fluorescence micrographs, the nanostructure of the largest particles can be seen to show the boundaries of siRNA-formed spherical micelles, while SM-1 / RF fills the cavities of these spheres (D and H). Figure 44 and Figure 45 (See enlarged version).

[0423] Using anti-CD20-mAB rituximab ( Figure 44 ) and anti-EGFR-mAB cetuximab ( Figure 45 When used as a carrier antibody, this phenomenon can be observed where the mixed antibody-protamine particles are more frequent and much larger than the particles of SM-1 / RF alone combined with mAB-protamine.

[0424] This means that the negatively charged SM-1 / RF can form small vesicles with the antibody-protamine complex. Figure 42 E and Figure 43 F), but as a linear and highly negatively charged molecule, siRNA can act as an electrostatic "glue" between the antibody-protamine / free SMCC-protamine complex. This can be observed as circular flashes within unusually large vesicles that appear to be filled with red fluorescent SM-1 / RF. Figure 44 and Figure 45 ).

[0425] exist Figure 44 and 37 The large micelle structures observed in [the study] are also visible under phase-contrast conditions in conventional optical microscopy analysis (see [reference]). Figure 46 ).

[0426] We used a laser scanning microscope (LSM) Figure 47This observation was further confirmed. Here, confocal analysis of cell-free vesicles showed that green fluorescent siRNA formed loops (…). Figure 47 Aa-c and Figure 47 B df), for the unusually large vesicles formed with anti-CD20-mAB-P, it can be seen that the inner cavity of the vesicle is filled with red fluorescent SM-1 / RF (B df). Figure 47 B d and f).

[0427] Example 16: The Proposed Model

[0428] In summary, the principle of using a carrier-antibody-protamine plus unbound protamine to bind anionic cargo molecules can also be applied to cargoes other than siRNA-nucleic acid. Here, it is important to modify the cargo molecule to give it polyanionic properties and to retain unbound protamine-SMCC during preparation to allow for strong electrostatic coordination and self-assembly of the reactants.

[0429] This observation strongly supports the idea that novel and unforeseen macromolecular nanostructures are potentially necessary and sufficient for the in vitro and in vivo pharmacodynamic efficacy of our carrier systems.

[0430] Therefore, we hypothesize that the combination of components 1. antibody-protamine, 2. siRNA / anionic small molecule inhibitor and 3. unbound (SMCC-)protamine forms a nanoparticle-like macrostructure responsible for the stability of siRNA and can effectively deliver siRNA and / or anionic small molecule inhibitor to the target cells, which is a completely unexpected observation. Figure 11 Exemplary and idealized models of this type of assembled nanostructure are shown in the figure.

[0431] In summary, experiments using a variety of chemically distinct effector payloads with the minimum commonality requirement of being polyanionic and having no other structural similarities provide experimental evidence for our novel and unpredictable nanostructure model, which forms the basis for the in vitro and in vivo pharmacodynamic characterization of our antibody-SMCC linker-protamine siRNA vector and our antibody-SM-1 / RF system.

[0432] This modular nanostructure system with dual specificity can be used for various disease groups, including cancer. The dual specificity is 1. specificity for siRNA / anion small molecule transport and specific delivery to target cells, and 2. specificity for inactivation of specific intracellular oncogenes.

[0433] Example 17: Conjugation of antisense oligonucleotides to antibody-protamine conjugates

[0434] To test whether antibody-protamine nanoparticles could also be used to transport single-stranded oligonucleotides currently used as alternative tools for gene knockdown, these synthetic antisense single-stranded oligonucleotides (“ASO”) were synthesized. These ASOs were as short as siRNAs and hypothesized to bind αEGFR-mAB-protamine conjugates similarly to siRNAs. Therefore, we performed band transfer analysis using control ASOs and found that 1 mol of αEGFR-mAB-protamine conjugate could bind at least 8 to 32 mol of ASO when incubated at room temperature for 1 hour or at 37°C for 5 minutes. Figure 12 ).

[0435] Example 18: Synthesis of the low molecular weight poly-anionic drug ibrutinib-Cy3.5 (“RMA561”)

[0436] Ibrutinib is a covalently bound agent of Bruton's kinase. Ibrutinib is used in several lymphoma subtypes and blocks downstream signal transduction of the B-cell receptor by covalently adding a cysteine ​​residue to the ATP-binding pouch of soluble Bruton's kinase. Ibrutinib can have serious side effects, such as infection, pneumonia, or arrhythmias (Wilson et al., 2015), because it targets not only lymphoma cells but also BTK in normal cells. In addition to side effects, the latter leads to higher doses and interception by irrelevant cells, which may be partly due to bystander effects on targets other than BTK (Byrd et al., 2013). Furthermore, prolonged doses of ibrutinib can lead to the development of resistance (Lenz 2017). Here, we first attempted to conjugate ibrutinib to a suitable carrier antibody—rituximab—targeting CD20 and part of the standard therapy in DLBCL, using advanced linker chemistry. The conjugation was successful, but it altered the solubility of the conjugate, thus proving unsuitable for further development.

[0437] Therefore, we converted uncharged ibrutinib into a strongly anionic compound, Cy3.5-RMA561, referred to herein as ibrutinib-Cy3.5, thereby allowing it to be bound to our protamine-based carrier system via electrostatic forces to form an antibody-inhibitor complex. The anthocyanin dye Cy3.5 exhibits strong anionic properties by exposing four sulfonic acid groups as potential binders. Figure 48From our perspective, it is preferable to concentrate the anionic charge at one site on the molecule and give it an overall linear shape to form a nanocarrier. Furthermore, the anthocyanin dye allows for the possibility of using fluorescence readout at all stages of evaluation. Based on published data (Kim et al., 2015; Turetsky et al., 2014), we synthesized an amino-functionalized ibrutinib derivative 5 by starting with commercially available pyrazolopyrimidine 1, subsequently iodinizing it, and then replacing it with 4-phenoxyphenylboronic acid via Suzuki coupling to form the main part 2 of the ibrutinib core structure. Importantly for high binding affinity, (S)-N-Boc-3-hydroxypiperidine was installed via a stereocontrolled MITSUNOBU reaction to form compound 3. After deprotection of the piperidine moiety, an α,β-unsaturated linker 4 (MICHAEL receptor) was introduced for irreversible binding to the target. The resulting Boc-protected amine 5 represents a lead structure labeled with different anionic moieties (e.g., the cyanine dye Cy3.5 (Lumiprobe)), which yields the corresponding amide ibrutinib-Cy3.5 (Cy3.5-RMA561) under basic conditions. The final product was purified by C18-SPE column (purity >98% (HPLC)) and validated by high-resolution mass spectrometry.

[0438] The Boc-protected derivative 5 (8.2 mg, 0.014 mmol, 1.05 equivalences) was dissolved in 0.5 mL of dry dichloromethane (dried on a 4A mol sieve), and a 4 M dioxane solution of hydrogen chloride (41 μL, 0.166 mmol, 12 equivalences) was added. The reaction mixture was stirred at room temperature until 5 was completely converted to the free amine (by TLC: silica, solvent: 10% MeOH / EtOAc tracer, detection: UV254 and ninhydrin staining). The reaction mixture was then evaporated under vacuum by heating to 35 °C. The remaining white solid was dissolved in 0.5 mL of anhydrous dimethylformamide. The solution was then added to this solution along with the NHS ester of Cy3.5 (Lumiprobe's "Sulfo-Cy3.5NHS Ester"; 15 mg, 0.014 mmol, 1.0 equivalent) dissolved in 0.5 mL of anhydrous dimethylformamide and N,N-diisopropylethylamine (72 μL, 0.414 mmol, 30 equivalents). The reaction mixture was stirred at room temperature in the dark until complete, and the reaction was controlled by TLC analysis (RP C-18, solvent: MeOH / H2O / AcOH 10 / 0.5 / 0.2 v / v / v, detection: UV-VIS and ninhydrin staining). The reaction mixture was dried under vacuum by heating to 35 °C. The residue was ground with pentane, diethyl ether, and ethyl acetate, and dried under vacuum at room temperature to give a crude product (Cy3.5-RMA561) containing 21 mg of a purple solid.

[0439] Analytical-grade samples were prepared by chromatographic purification of the crude product on a 12 g C18 SPE column. The pretreated column was washed with water (10 mL). The crude product was aliquoted into two fractions, dissolved in 0.5 mL of water, loaded onto the column, and then washed with water (10 mL) followed by acetonitrile (10 mL) to remove impurities and reaction byproducts. The product was then eluted with a 1:1 (v / v) mixture of ACN / H₂O to several fractions containing only pure Cy₃.5-RMA561. After lyophilization, 2 × 8 mg of pure Cy₃.5-RMA561 was obtained as a purple solid.

[0440] In addition to the strong polyanionic properties of Cy3.5 dye, this conjugate has the advantage of being easily traced in vitro and in vivo in the form of red fluorescence.

[0441] Example 19: In vitro analysis of the formation of antibody-protamine / protamine-ibrutinib-Cy3.5 complexes

[0442] First, we conducted experiments to characterize the binding between ibrutinib-Cy3.5 and two vector systems. In band transfer analysis, two antibodies (rituximab and cetuximab) were chemically conjugated to protamine via the bifunctional cross-linking agent sulfonyl-SMCC: rituximab (anti-CD20-mAB)-protamine containing unbound protamine-SMCC and cetuximab (anti-EGFR-mAB)-protamine containing unbound protamine-SMCC. Both vector-conjugates containing unbound protamine-SMCC showed strong co-assembly of the ibrutinib-Cy3.5 derivative and, due to their low molecular weight (approximately 13 kDa) compared to siRNA, exhibited extremely high electrostatic saturation mol / mol ratios, exceeding 100 mol ibrutinib-Cy3.5 / mol vector mAb. Figure 50 In all further experiments, the composition of the chemically conjugated antibody-to-protamine remained unchanged, meaning that the resulting product, in addition to the antibody-protamine conjugate, still contained unbound protamine-SMCC.

[0443] The corresponding conjugates, rituximab-protamine and cetuximab-protamine (both containing unbound protamine-SMCC loaded with a subcritical 20x excess of ibrutinib-Cy3.5), were incubated with cell lines expressing CD20 and EGFR, and intracellular enrichment of ibrutinib-Cy3.5 was analyzed. In both cases, intracellular enrichment of fluorescence signals at typical Cy3.5 excitation / emission wavelength combinations was recorded. Figure 51 Therefore, as long as the modified ibrutinib-Cy3.5 compound still binds to its target BTK, it remains internalized in cells and thus exerts its effect.

[0444] Next, we treated the DLBCL cell line with an ibrutinib-Cy3.5 derivative conjugated to a rituximab vector antibody, lysed the cells, and analyzed the lysates by SDS-PAGE. The gel was then UV irradiated, and the emission of the Cy3.5 chromophore was scanned. A single 70 kDa protein band emitting Cy3.5 fluorescence was observed, which was subsequently identified as Bruton's kinase BTK by Western blotting analysis. Figure 52 ).

[0445] In summary, chemical modification of the ibrutinib core structure into a polyanionic derivative does not alter the efficiency of the conjugate in binding to Bruton's kinase BTK.

[0446] Next, we planned functional analyses to identify the effectiveness of the antibody-inhibitor-complex. DLBCL tumor cells were seeded in methylcellulose to form unanchored colonies as a surrogate marker of tumorigenicity. Each assay was treated with a combination of antibody-inhibitor complexes and compared to a suitable control group. Clearly, compared to the control group without the carrier mAb, HBL-1 cells with high CD20 expression formed only 30% of colonies when treated with rituximab-protamine / protamine containing ibrutinib-Cy3.5. In contrast, unconjugated rituximab had only a mild effect on colony growth. Furthermore, in A549 NSCLC cells with high EGFR expression but low CD20 expression (… Figure 53 B) The cetuximab vector performed significantly better than the rituximab vector, revealing the receptor-specific uptake mechanism as expected.

[0447] As seen from the results of our antibody-protamine / free protamine-SMCC / siRNA conjugation experiments, we hypothesized that the presence of unbound / free protamine-SMCC in the αCD20-mAB-protamine-ibrutinib-Cy3.5-protamine adduct might be as important as its presence in the siRNA adduct. Therefore, we depleted free protamine-SMCC from the rituximab-αCD20mAB formulation by affinity chromatography as previously described. As expected, the depleted formulation ( Figure 54 A, grade 25) cannot be compared with preparations containing protamine-SMCC ( Figure 54 B, right) binds and coordinates to the same extent as the polyanionic ibrutinib-Cy3.5 ( Figure 54 B, left). Comparable to the αCD20-mAB-protamine / free protamine-SMCC complex after depletion of free protamine-SMCC, CD20-mAB-P without free protamine-SMCC failed to inhibit colony formation when complexed with ibrutinib-Cy3.5. Figure 54 C).

[0448] Example 20: Analysis of the formation of a complex between antibody-protamine / free protamine-SMCC and ibrutinib-Cy3.5 in vivo.

[0449] To further characterize the in vivo therapeutic efficacy of rituximab-protamine / free protamine / ibrutinib-Cy3.5 carrier compared to controls of all essential components, we described (see [link to relevant documentation]). Figure 55 A) underwent in vivo therapeutic experiments. For this purpose, we conducted in vivo therapeutic experiments on 10... 7 Subcutaneous transplantation of HBL-1DLBCL- cells into immunodeficient NSG mice resulted in tumor growth reaching 200 mm. 3 Mice were divided into groups of ten based on their average size and treated with a standard concentration of 4 mg / kg body weight, calculated for rituximab, corresponding to 0.625 nmol of rituximab conjugate / single dose. Rituximab-protamine / free protamine-SMCC / ibrutinib-Cy3.5 (1:20) corresponded to 0.625 nmol of rituximab conjugate / single dose plus 18 μg or 12.5 nmol of ibrutinib-Cy3.5, and equal amounts of uncoordinated ibrutinib (12.5 nmol) and ibrutinib-Cy3.5 (12.5 nmol), further controlled by PBS. Treatment with ibrutinib-Cy3.5 showed no therapeutic effect on tumor growth, while administration of equal amounts of ibrutinib-Cy3.5 bound to the rituximab-protamine carrier produced significantly slower tumor growth compared to all other groups. Figure 55 C). This result also applies to animal survival analysis. Figure 55 B).

[0450] Therefore, compared with all suitable component controls, the rituximab-protamine / free protamine / ibrutinib-Cy3.5 1:20 complex demonstrated significantly superior targeting and therapeutic properties in in vivo models. Furthermore, the single dose of ibrutinib administered was in the range of twenty-fold lower (12.5 nmol ibrutinib corresponds to 0.720 mg / kg mice, compared to a standard dose of 12 mg / kg in Nod-SCID mice (Chen et al., 2016; Zhang et al., 2017).

[0451] To demonstrate this hypothesis, we prepared organs from euthanized mice and subjected these organs to in vitro fluorescence detection of the introduced ibrutinib-Cy3.5. Figure 56As a result, tumors from mice treated with rituximab-protamine / ibrutinib-Cy3.5 showed a significant accumulation of Cy3.5-derived fluorescent signals, which increased with increasing treatment cycles. In contrast, few detectable signals were observed in tumors from mice treated with rituximab-uncoordinated ibrutinib-Cy3.5. Figure 56 ), and in this group, there is a trend of diffuse background signals seen in most organs (), Figure 57 ).

[0452] Furthermore, no specific fluorescence was detected in the analyzed organs. Figure 57 We conclude that the rituximab-protamine / free protamine-SMCC / ibrutinib-Cy3.5 conjugate is specifically enriched in CD20-positive tumors.

[0453] Example 21: In vitro formation of vesicle structures via antibody-protamine / free protamine-siRNA and / or ibrutinib-Cy3.5 complex.

[0454] To further characterize the novel nanostructure, we used electrostatically charged green fluorescent siRNA and red fluorescent ibrutinib-Cy3.5, and combined them with an antibody-protamine / free protamine-SMCC conjugate. Figures 58-60 ).

[0455] During examination of cell-free assembly results of mAB-protamine / free protamine / ibrutinib-Cy3.5-conjugates containing and without additional siRNA, we observed significant differences in the number and size of the corresponding nanostructures: those assembled by siRNA-conjugates of mAB-protamine and ibrutinib-Cy3.5+free protamine-SMCC were much larger and more densely packed than those without siRNA. Figure 58 C and F and Figure 59 D and H). We explain this phenomenon by assuming that the particles consist of a mixture of all four components that form stable nanostructures. Detailed fluorescence micrographs show that the nanostructures of the largest particles exhibit siRNA-forming spherical micelle boundaries. Figure 60 (A and C), while ibrutinib-Cy3.5 fills more of the cavities in this nanostructure ( Figure 60 (B and D).

[0456] Using αCD20-mAB rituximab ( Figure 60 CD) and anti-EGFR-mAB cetuximab ( Figure 60When both A and B are used as carrier antibodies, this phenomenon of mixed antibody-protamine particles being more frequent and much larger than those of ibrutinib-Cy3.5 alone combined with mAb-protamine / protamine carrier is observed.

[0457] This means that the negatively charged ibrutinib-Cy3.5 can form small vesicles with the antibody-protamine complex. Figure 58 E and Figure 59 F), but as a linear and highly negatively charged molecular siRNA, it can act as an electrostatic "glue" between the antibody-protamine / free protamine-SMCC complex. This can be observed as a circular flash within unusually large vesicles that appear to be filled with red fluorescent ibrutinib-Cy3.5. Figure 60 ).

[0458] To further characterize this structure, we use Nanoparticle tracking video microscopy was used to measure particle size. Here, particles ranging from 1 to 1000 nm were detected and their size and quantity were analyzed. Figure 61 We assessed stability and maximum particle size 1 hour after the onset of complex formation by adding control (scr)-siRNA, ibrutinib-Cy3.5, or both, respectively. Figure 61 A, B, C, D). Using equal amounts of antibody-free protamine-SMCC (=1800nM=30x molar ratio as used for conjugation of 60nM anti-CD20-mAB) to form consistently smaller particles ( Figure 61 A, the small image below and Figure 61 E). Interestingly, due to technological limitations, such as Figure 60 As shown, no very large mixed particles were observed in the Zetaview data.

[0459] Example 22: Combination of anionic small molecule drugs with carrier-antibody-protamine fusions or antibody-protamine conjugates

[0460] Regarding the complexation of anionic small molecules, we found that in band transfer analysis, using different ratios of αCD20-mAB-protamine and ibrutinib-Alexa488 up to 1:2, the αCD20-mAB rituximab-protamine / free protamine-SMCC (αCD20-mAB-P / P) conjugate bound to ibrutinib-Alexa488. α, anti. Figure 62 A): Due to the finite anionic charge of -2 in the Alexa488 molecule ( Figure 62(B) It was found that the interaction between the polycationic protamine fusion and Alexa488 was not as strong as the interaction with Cy 3.5 (in the next example) which has a net charge of -4. Therefore, using an Alexa488-conjugated ibrutinib and protamine conjugate, a conjugation ratio of only 2:1 was achieved. However, the ibrutinib-Alexa488 complex with αCD20-mAB rituximab-protamine / free protamine-SMCC (αCD20-mAB-P / P) was still successful.

[0461] The construction of stable antibody-inhibitor complexes in nanoparticle form can be detected by fluorescence microscopy. Figure 62 CH), these nanoparticles are stable in serum under the conditions disclosed for other nanoparticles. Figure 62 E, G, F, H). Importantly, since ibrutinib-Cy 3.5 can be detected by fluorescence, this brings excellent tracer capabilities to all downstream applications.

[0462] When incubated in vitro, αCD20-mAB-P / P loaded with ibrutinib-Cy 3.5 resulted in the assembly of electrostatically stable nanoparticles, exposing red Cy 3.5 fluorescence. Figure 65 During fluorescence microscopy, regularly shaped vesicle structures were first detected. Figure 62 C, D), subsequently, irregularly shaped aggregates larger than 2 μm and smaller particles were detected. This process was not observed if unmodified αCD20-mAB was used to conjugate ibrutinib-Cy 3.5, or if modified αCD20-mAB-P / free protamine was used to conjugate hydrophobic ibrutinib (trade name: Imbruvica) (not shown). Under an electron microscope (… Figure 65 C) also verified the electrostatic particles observed in an optical microscope. Figure 65 A and B), in which a large number of smaller particles <100-200 nm were detected ( Figure 65 C), which led us to choose the term "nano" carrier.

[0463] Regarding the comparison of anionic charged and uncharged small molecules with protamine conjugates, we found that charged ibrutinib-Cy 3.5, rather than uncharged ibrutinib (trade name: Imbruvica), formed stable nanoparticles with protamine-conjugated mAbs. The corresponding antibody carriers conjugated with protamine loaded with both charged and uncharged ibrutinib-Cy 3.5. Notably, only those ibrutinib samples conjugated with Cy 3.5 showed dense nanoparticle formation, while uncharged ibrutinib failed to form nanoparticles. Figure 63This indicates that the net charge of the polyanion and certain structures of the polyanion are important for proper electrostatic interaction with protamine.

[0464] Example 23: The Proposed Model

[0465] In summary, the principle of binding anionic cargo molecules via a carrier composed of antibody-protamine plus unbound protamine can also be applied to cargoes other than siRNA-nucleic acid, such as small molecules like the kinase inhibitor ibrutinib. Here, the cargo molecule is modified to have polyanionic properties, and unbound protamine-SMCC is retained during the preparation process to enable the components to strongly electrostatically self-assemble into a nanostructure.

[0466] These observations strongly support the conclusion that novel and unexpected macromolecular nanostructures are responsible for the in vitro and in vivo pharmacodynamic efficacy of our carrier systems.

[0467] Therefore, we anticipate that the combination of components 1. antibody-protamine, 2. siRNA / anionic small molecule, and 3. unbound protamine (-SMCC) will form a nanoparticle-like macrostructure responsible for the stability of the siRNA and effectively delivering siRNA and / or anionic small molecule inhibitors to the target cells—a completely unexpected observation. An idealized model of this assembled nanostructure is shown in… Figure 64 middle.

[0468] In summary, experiments using a variety of chemically distinct effector payloads with the minimum commonality requirement of being polyanionic and without other structural similarities provide experimental evidence for our novel and unpredictable nanostructure model, which forms the basis for the in vitro and in vivo pharmacodynamic characterization of our nanocarrier-siRNA carrier and our nanocarrier-ibrutinib-Cy 3.5 system.

[0469] This modular nanostructure system with dual specificity can be used for various disease groups, including cancer. The dual specificity is 1. specificity for siRNA / anion small molecule transport and specific delivery to target cells, and 2. specificity for inactivation or pharmacological activity of specific intracellular oncogenes.

[0470] Example 24: In vitro functional analysis of αCD20-mAB-P / P-ibrutinib-Cy 3.5 nanocarrier

[0471] Next, the efficacy of the αCD20-mAB-P / P-ibrutinib-Cy 3.5 nanocarrier in different cell model systems was investigated.

[0472] First, internalization into CD20-positive DLBCL cells was detected by Cy 3.5 fluorescence. Overnight treatment of HBL1 and TMD-8 lymphoma cells with unconjugated ibrutinib-Cy 3.5 showed good red fluorescent labeling of the cells. Figure 66 The white part in E), when combined with αCD20-mAB-P / P and transported with ibrutinib-Cy 3.5, this labeling is enhanced ( Figure 66 F). This demonstrates a beneficial process via CD20 receptor internalization, compared to the non-targeted uptake mechanism of ibrutinib-Cy 3.5 anion without carrier antibody implementation. Figure 66 E). Next, cells were treated with the conjugate for 72 hours, and a single band of covalently labeled 70 kDa protein was observed in SDS-PAGE electrophoresis, indicating the binding and functionality of the modified ibrutinib-Cy 3.5 compound. Figure 66 G). For fluorescence detection of BTK, the gel must be severely overloaded to show equal lane loading and BTK recognition; therefore, we followed up with a post-fluorescence gel blot for immunoassay of BTK. Indeed, the band representing BTK appeared at the same location as seen in the Cy 3.5 fluorescence, indicating that, as expected, ibrutinib-Cy 3.5 only covalently binds to BTK. Figure 66 G).

[0473] In addition, HBL1 cells were incubated with ibrutinib-fluborpyrrole for 2 hours, washed, and treated with αCD20-mAB-P / P-ibrutinib-Cy 3.5. Cells were then incorporated with ibrutinib-fluborpyrrole (… Figure 66 N and P), but Cy 3.5 fluorescence only appeared in untreated cells (N and P), but Cy 3.5 fluorescence was only observed in untreated cells. Figure 66 L), but not observed in cells pretreated with ibrutinib-fluborpyrrole ( Figure 66 P). Some subcellular erythrovesicles indicate CD20-mediated internalization of ibrutinib-Cy 3.5 (P). Figure 66 P), but no pattern suggesting BTK binding was observed (ibrutinib-Cy 3.5 see P). Figure 66 L, ibrutinib-fluoroboropyrrole (see also) Figure 66 The same procedure was followed after treatment with αCD20-mAB-P / P-ibrutinib-Cy 3.5 for 24 hours, followed by pre-incubation with non-fluorescent ibrutinib and washing.

[0474] The functional role of ibrutinib in covalently targeting BTK is the inhibition of BTK autophosphorylation. Therefore, the phosphorylation status of BTK in DLBCL cells treated with and without ibrutinib-Cy3.5 in the αCD20-mAB / P / P nanocarrier was analyzed. Figure 67A). Cells were treated with PBS, unconjugated ibrutinib-Cy 3.5, and αCD20-mAB-P / P / ibrutinib-Cy 3.5 complex for 72 hours, followed by cell lysis and Western blot analysis. We found that, regardless of whether the complex was used, treatment with ibrutinib-Cy 3.5 resulted in increased HBL1 ( Figure 67 In cells A (left inset) and TMD8 cells (data not shown), BTK phosphorylation at tyrosine 223 was significantly reduced, as detected by a specific phosphate-BTK antibody. This is consistent with... Figure 66 The binding of G to BTK is consistent. Total BTK expression is slightly affected. Figure 67 A). We infer that the synthesized ibrutinib-Cy 3.5 conjugate retains full functionality in binding to the target molecule BTK and inactivating BTK autophosphorylation.

[0475] Interestingly, in all lymphoma cell lines tested, the lymphoma-specific αCD20-mAB-P / P / ibru-Cy3.5 nanocarrier system significantly inhibited colony growth in soft agar cultures. This was observed to a much lesser extent with ibrutinib or ibrutinib-Cy 3.5 as single agents, and was not observed with unmodified rituximab (αCD20-mAB) (HBL1: Figure 67 B). This colony analysis is used to quantify the growth of non-adherent clonal cells and is a standard in vitro alternative to in vivo tumorigenicity. Therefore, we believe that the robust therapeutic effect of ibrutinib-Cy 3.5 can only be observed when the anionic compound is assembled into stable electrostatic nanoparticles composed of a cationic αCD20-mAB-protamine / free protamine carrier complex and anionic cargo effectors.

[0476] Next, the functional consequences of BTK inactivation via αCD20-mAB-P / P-ibrutinib-Cy 3.5 in the DLBCL cell line in inducing apoptosis were investigated. Here, in HBL1 ( Figure 68 In TMD8 cells (data not shown), αCD20-mAB-P / P-ibrutinib-Cy 3.5 treatment provided excellent apoptosis signaling induction. Figure 68(The rightmost column), and compared to targeted treatment and treatment with free ibrutinib, treatment with unrecombined ibrutinib-Cy 3.5 showed only a mild effect. Therefore, it is hypothesized that targeted treatment with αCD20-mAB-P / P-ibrutinib-Cy 3.5 leads to the accumulation of active ibrutinib-Cy 3.5 in cells, and thus results in more severe apoptosis induction than with unrecombined ibrutinib-Cy 3.5. Furthermore, if unrecombined, the anionic molecule ibrutinib-Cy 3.5, as a hydrophobic free ibrutinib, has lower cellular accessibility or at least lower cellular efficacy, as evidenced by lower apoptosis induction compared to free ibrutinib.

[0477] Example 25: Ewing sarcoma xenograft tumor growth was inhibited after knocking down the oncogenic EWS-FLI1 translocation product through systemic treatment using αIGF1R-mAB-protamine-siRNA-protamine nanocarrier.

[0478] To test the in vivo efficacy of the tetetumumab-protamine nanocarrier, 10 7 Personal SK-N-MC cells were subcutaneously (sc) xenografted into the flank of CD1 nude mice, and at least 7 mice were treated with PBS or αIGF1R-mAB-P / P conjugated with mixed control-siRNA or αIGF1R-mAB-P / P conjugated with the above-mentioned EWS-FLI1-siRNA in an intraperitoneal injection. Figure 69 AC). When the tumor reaches 100-150mm 3 Treatment began when the average size was reached. When compared with two control groups, tumors in the treatment group, obtained from Tepro-mAB-P / EWS-FLI1-siRNA / P nanoparticles, showed significant and almost complete growth inhibition. Figure 69 (B and C). This indicates that knockdown of EWS-FLI1 via Tepro-mAB-P / siRNA / P nanoparticles was successful after in vivo application.

[0479] Example 26: Nanoparticles formed from carrier antibody-protamine / free protamine and siRNA have an exposed near-neutral surface charge.

[0480] The formation of nanoparticles from antibody-protamine / free protamine plus siRNA was found to be rapid and reproducible, but dependent on the antibody formulation. For example, this was demonstrated by DLS analysis (…). Figure 70Microscopic analysis revealed that, compared to nanoparticles formed by α-EGFR-protamine formulations or αCD33 formulations, different α-EGFR-protamine formulations tended to form larger particles. Furthermore, the surface charge varied only slightly within the weakly anionic range, exposing almost neutrally charged particles. This suggests that the properties of the antibody itself, as well as the electrostatic balance between the anionic and cationic components, determine the size and surface charge properties of the nanoparticles.

[0481] Example 27: Deciphering the prerequisites for effective nanoparticle formation between anti-EGFR-mAB-SMCC-protamine conjugate, free SMCC-protamine, and siRNA.

[0482] In addition, the necessity of siRNA for vesicle formation was assessed. Constant amounts of αEGFR-mAB-P with a constant 32x free SMCC-protamine were incubated with varying amounts of Alexa488 control siRNA. Figure 71 AG (top inset shows green fluorescence, bottom inset shows phase difference). It is worth noting that using an optimal molar excess of siRNA (5-10 times that of the antibody) effectively forms nanoparticles. Figure 71 DE).

[0483] Example 28: Nanoparticles formed from αEGFR-protamine / free protamine-Alexa488-siRNA are stable under serum-containing conditions.

[0484] For systemic therapeutic applications of targeted nanoparticles, their stability under various challenging conditions is paramount; otherwise, the active substance will disintegrate and separate from the nanocarrier. Here, the stability of αEGFR-mAB-protamine, free protamine, and Alexa488-siRNA in high concentrations of bovine serum albumin was tested, demonstrating that the nanocarrier remained stable even after 24 hours. Figure 72 B).

[0485] Example 29: Serum stability of αCD20-mAB-protamine / free P-ibrutinib-Cy 3.5 nanocarrier.

[0486] The construction of a stable nanoparticle-form αCD20-mAB-protamine / free P-ibrutinib-Cy3.5 antibody-inhibitor complex could be detected by fluorescence microscopy. Figure 73 The nanoparticles were stable in serum for 24 hours (AF). Figure 73 BC) and even 72 hours Figure 73 EF).

[0487] Example 30: pH stability of siRNA nanocarriers constructed with three different targeting antibodies.

[0488] For the systematic application of nanocarriers, the pH conditions under which the structure is stable are important to prevent premature disassembly and loss of the coordinated siRNA effector molecules. Here, we formed siRNA nanocarriers with three different targeting antibodies under standard conditions and tested their integrity at pH 4.8–8.0. Figure 74 This pH range encompasses all pH conditions that the nanocarriers might face during therapeutic applications. The results, determined by Alexa 488 fluorescence of the composite siRNA, indicate that the nanocarriers are stable at pH 5.2–8.0, with a tendency to form larger superstructures at lower pH levels.

[0489] Example 31: pH stability of nanocarriers constructed using αCD20-mAB-protamine / free protamine and ibrutinib-Cy3.5.

[0490] Here, ibrutinib-Cy3.5 nanocarriers were formed using αCD20-mAB-protamine / free protamine under standard conditions, and their integrity was tested at pH 4.8–8.0, a pH range that covers all pH conditions that the nanocarriers may face during therapeutic applications. Figure 75 The results showed that, based on the Cy3.5 fluorescence of the composite ibrutinib-Cy3.5, the nanocarrier was stable under pH conditions of 5.8–8.0, but exhibited a tendency to disintegrate at lower pH levels.

[0491] Example 32: Immunolabeling of targeting IgG antibodies in αEGFR-mAB-P / free protamine-siRNA nanocarrier and αIGF1R-mAB-P / free protamine-siRNA nanocarrier.

[0492] The self-assembly process of cationic antibody-protamine / free protamine formulation and siRNA results in nanoparticle structures with a defined configuration: here, αEGFR-mAB-protamine / free protamine-siRNA nanoparticles ( Figure 76 ) and αIGF1R (tetrumumab) mAb-protamine / free protamine / siRNA nanoparticles ( Figure 77 Immunological detection of human IgG signal was performed. The position and orientation of human IgG in the nanocarrier were observed using α-human IgG-Alexa647, which showed signal exposure only at the outer edge of the nanoparticle micelle structure. Figure 76B and 77B), while no signal is exposed in the lumen. In contrast, the signal of fluorescently labeled siRNA was found in the lumen of the structure (B and 77B). Figure 76 (A and 77A). Therefore, it can be concluded that the large volume of IgG molecules is oriented towards the outside of the nanoparticle micelles and thus must be precisely close to their protein targets, the extracellular domains of cell surface molecules, and receptor tyrosine kinases.

[0493] Example 33: Visualization of free protamine in nanocarrier complex

[0494] To date, the location of the important free protamine in the nanocarrier remains unclear. Therefore, we addressed this by replacing the free protamine in the αEGFR-protamine formulation with protamine conjugated to Cy-NHS ester. Figure 78 A), and combined it with non-fluorescent siRNA to form a nanocarrier structure ( Figure 78 B). The nanocarrier was then examined by fluorescence microscopy, and a staining pattern was displayed, showing that protamine-Cy3 was located within the lumen of the nanocarrier. Figure 78 CE), while the IgG portion stained with anti-human IgG-Alexa647 is located at the edge of the nanocarrier ( Figure 78 EF).

[0495] Example 34: Synthesis of gefitinib, gemcitabine and venetoclax, inhibitors of anthocyanin dyes.

[0496] To this end, three new compounds were synthesized, each reacted with two different anthocyanin dyes, sulfonyl-Cy3.5. TM (Excitation 591nm / Emission 604nm) and sulfonyl-Cy5.5 TM (ex 684nm, em 710nm) concatenation. The two anthocyanin dyes share the same core fluorophore structure, exhibiting the four strong anionic sulfonyl groups necessary for coordination of the protamine cationic peptide, but differ only in the number of conjugated double bonds, resulting in distinguishable fluorescent dye properties. Similar to ibrutinib, three different drug-dye-conjugates with comparable overall molecular shapes will be synthesized. Gefitinib (EGFR inhibitor), gemcitabine (cell-inhibiting drug), and venetoclax (BLCL-2 inhibitor) were chosen as potential candidates because, in all cases, they retained their binding potency to the target molecule after dye conjugation and allowed for fluorescence imaging applications (Wu et al., 2020; Zhu et al., 2018; Gonzales et al., 2018). They were conjugated to the anthocyanin dyes by attaching PEG4-spacers and using commercially available reactive NHS-esters or azide-functionalized dyes (see [link to article]). Figure 79 ).

[0497] First, starting with commercially available gefitinib 1, it is demethylated, and the resulting phenol is converted by nucleophilic attack with azido-PEG4-methanesulfonate to synthesize a gefitinib analog. The resulting azide is reduced to amine 2 and labeled with sulfon-Cy3.5 or sulfon-Cy5.5 to generate gefitinib-conjugates for further composite into nanocarriers.

[0498] For gemcitabine 3, the hydroxyl group is protected, and the leaving group is mounted on the cytosine to yield 4 after nucleophilic attack by propargylamine (Solanki et al., 2020). The desired conjugate is obtained by labeling with the corresponding azide-functionalized anthocyanin dye via a click reaction.

[0499] In the case of the third example, venetoclax, it will begin with the synthesis of the known venetoclax core structure 5 (Giedt et al., 2014). Using the already mentioned methanesulfonyl-PEG4-azide, sulfonamide 6 is obtained in three steps, and the corresponding venetoclax conjugate is produced for further evaluation after linking the methanesulfonyl-PEG4-azide to 5, reducing the azide, and subsequently labelling with anthocyanin dye (NHS-ester).

[0500] Example 35: Extend this concept to easier and cheaper polyanionic molecular components, as well as other therapeutic interventions such as PDT and radiotherapy.

[0501] Following the conversion and evaluation of electrostatic binding principles with other anticancer drugs having different binding motifs and targets, the aim was to modify the essential anionic characteristics of the cyanine dyes used here (important for initial optical characterization and fluorescence imaging) to (1) more readily accessible electrostatic linkers in terms of easier and cheaper synthesis, facilitating their conversion to clinical evaluation. Candidates for such electrostatic linkers are polysulfated monosaccharides, disaccharides, and branched oligosaccharides or mono-, bis-, and triphosphates, which could pave the way for large-scale synthesis. Figure 80 ).

[0502] The invention described illustratively herein may be practiced in the absence of any one or more elements or limitations not specifically disclosed herein. Furthermore, the terminology and expressions used herein are descriptive rather than limiting, and their use is not intended to exclude any equivalents or portions thereof of the shown and described features, but it should be recognized that various modifications are possible within the scope of the invention claimed. Therefore, it should be understood that although the invention has been specifically described by way of exemplary embodiments and optional features, those skilled in the art will seek modifications and variations embodied in the invention as disclosed herein, and such modifications and variations are considered to fall within the scope of the invention.

[0503] The invention has been described broadly and categorically herein. Each narrower species and subgenus falling within the general scope of disclosure constitutes part of the invention. This includes the general description of the invention with additional conditions or by removing any negative limitations on the subject matter from that genus, regardless of whether the removed material is part of the specific description of the invention.

[0504] Other embodiments are defined in the following claims.

[0505] Non-patent literature

[0506] Arvand,A.,and Denny,CT(2001).Biology of EWS / ETS fusions in Ewing'sfamily tumors.Oncogene 20,5747-5754.

[0507] N.,Appel,N.,Terheyden,L.,Buchholz,F.,Rossig,C.,Müller-Tidow,C.,Berdel,WE,and S.(2016).Antibody-coupled siRNA as an efficient method for in vivo mRNAknockdown.Nat.Protoc.11,22-36.

[0508] N.,Berdel,WE,and S.(2017).Immunoprotein-MediatedsiRNA Delivery.Mol.Pharm.14,1339-1351.

[0509] N., J.,Appel,N.,Terheyden,L.,Hartmann,W.,Wardelmann,E.,Buchholz,F.,Müller-Tidow,C.,Berdel,WE,and S.(2018).Downregulation of PIK3CA via antibody-esiRNA-complexes suppresses humanxenograft tumor growth.PLoS One 13,e0200163.

[0510] S., N., Appel, N., Terheyden, L., Fremerey, J., Schelhaas, S., Wardelmann, E., Buchholz, F., Berdel, W.E., and C. (2015). Antibody-Mediated Delivery of Anti-KRAS-siRNA In Vivo Overcomes Therapy Resistance in Colon Cancer. Clin Cancer Res 21, 1383-94.

[0511] Bose, P., and Grant, S. (2013). Mcl-1 as a Therapeutic Target in Acute Myelogenous Leukemia (AML). Leuk Res.Rep. 2, 12-14.

[0512] Byrd, J.C.; Furman, R.R.; Coutre, S.E.; Flinn, I.W.; Burger, J.A.; Blum, K.A., et al., (2013): Targeting BTK with ibrutinib in relapsed chronic lymphocytic leukemia. In: N. Engl. J. Med. 369(1), S. 32–42. DOI: 10.1056 / NEJMoa1215637.

[0513] Chen, J.; Kinoshita, T.; Sukbuntherng, J.; Chang, B.Y.; Elias, L. (2016): Ibrutinib Inhibits ERBB Receptor Tyrosine Kinases and HER2-Amplified Breast Cancer Cell Growth. In: Mol. Cancer. Ther. 15(第十二期), S. 2835–2844.

[0514] Note: In the translation of item , "第十二期" is a literal translation of "12" in Chinese, which might need to be adjusted to "12th" according to the actual context requirements. Also, the tags

[0510] -

[0514] are preserved as they are as per the instruction.Chen, X., Stewart, E., Shelat, A. A., Qu, C., Bahrami, A., Hatley, M., Wu, G., Bradley, C., McEvoy, J., Pappo, A., et al., (2013). Targeting oxidative stress in embryonal rhabdomyosarcoma. Cancer. Cell. 24, 710 - 724.

[0515] Choi, Y. S., Lee, J. Y., Suh, J. S., Kwon, Y. M., Lee, S. J., Chung, J. K., Lee, D. S., Yang, V. C., Chung, C. P., and Park, Y. J. (2009). The systemic delivery of siRNAs by a cell penetrating peptide, low molecular weight protamine. Biomaterials 31, 1429 - 43.

[0516] Chono, S., Li, S. D., Conwell, C. C., and Huang, L. (2008). An efficient and low immunostimulatory nanoparticle formulation for systemic siRNA delivery to the tumor. J. Control. Release 131, 64 - 69.

[0517] Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998). Potent and specific genetic interference by double - stranded RNA in Caenorhabditis elegans. Nature 391, 806 - 11.

[0518] Giedt, R.J., Sprachman, M.M., Yang, K.S. & Weissleder, R. Imaging cellular distribution of Bcl inhibitors using small molecule drug conjugates. Bioconjug. Chem. 25, 2081–2085; 10.1021 / bc500433k (2014).

[0519] Gonzales, J. et al., Nanoemulsion-Based Delivery of Fluorescent PARP Inhibitors in Mouse Models of Small Cell Lung Cancer. Bioconjug. Chem. 29, 3776–3782; 10.1021 / acs.bioconjchem.8b00640 (2018).

[0520] Ha, H.T., Griffith, K.A., Zalupski, M.M., Schuetze, S.M., Thomas, D.G., Lucas, D.R., Baker, L.H., and Chugh, R. (2013). Phase II trial of cetuximab in patients with metastatic or locally advanced soft tissue or bone sarcoma. Am. J. Clin. Oncol. 36, 77 - 82.

[0521] Hansen, B., Linde, S., Kolendorf, K., and Jensen, F. (1979). Absorption of protamine-insulin in diabetic patients. I. Preparation and characterization of protamine-125I-insulin. Horm. Metab. Res. 11, 85 - 90.

[0522] Hauser,PV,Pippin,JW,Kaiser,C,Krofft,RD,Brinkkoetter,PT,Hudkins,KL,Kerjaschki,D,Reiser,J,Alpers,CE,and Shankland,SJ(2010).Novel siRNAdelivery system to target podocytes in vivo.PLoS One 5,e9463.

[0523] Lowmolecularweight protamine(LMWP):a nontoxic protamine substitute and aneffective cell-penetrating peptide.J.Control.Release 193,63-73.

[0524] Herrmann, D., Seitz, G., Warmann, SW, Bonin, M., Fuchs, J., and Armeanu-Ebinger, S. (2010).Cetuximab promotes immunotoxicity against rhabdomyosarcoma in vitro.J.Immunother.33,279-286.

[0525] http: / / dx.doi.org / 10.1037 / 0021-843X.111.2.203 Kikuchi, K., Tsuchiya, K., Otabe, O., Gotoh, T., Tamura, S., Katsumi, Y., Yagyu, S., Tsubai-Shimizu, S., Miyachi, M., Iehara, T., and Hosoi, H. (2008). alveolarrhabdomyosarcoma.Biochem.Biophys.Res.Commun.365,568-574.

[0526] Kim,E.;Yang,K.S.;Kohler,R.H.;Dubach,J.M.;Mikula,H.;Weissleder,R.(2015):Optimized Near-IR Fluorescent Agents for in VivoImaging of BtkExpression.In:Bioconjug.Chem.26(8),S.1513–1518.DOI:10.1021 / acs.bioconjchem.5b00152.

[0527] Lenz,G.(2017):Deciphering Ibrutinib Resistance in ChronicLymphocyticLeukemia.In:J.Clin.Oncol.35(13),S.1451–1452.DOI:10.1200 / JCO.2016.72.0102.

[0528] Liu,B.(2007).Exploring cell type-specific internalizing antibodiesfortargeted delivery of siRNA.Brief Funct.Genomic Proteomic 6,112-119.

[0529] Liu,L.,Wang,Y.D.,Wu,J.,Cui,J.,and Chen,T.(2012).Carnitinepalmitoyltransferase 1A(CPT1A):a transcriptional target of PAX3-FKHR andmediates PAX3-FKHR-dependent motility in alveolar rhabdomyosarcomacells.BMC Cancer 12,154-2407-12-154.

[0530] Paulussen, M., Ahrens, S., Craft, A. W., Dunst, J., Frohlich, B., Jabar, S., Rube, C., Winkelmann, W., Wissing, S., Zoubek, A., and Jurgens, H. (1998). Ewing's tumors with primary lung metastases: survival analysis of 114 (European Intergroup) Cooperative Ewing's Sarcoma Studies patients. J. Clin. Oncol. 16, 3044 - 3052.

[0531] Paulussen, M., Bielack, S., Jurgens, H., Jost, L., and ESMO Guidelines Working Group. (2008). Ewing's sarcoma of the bone: ESMO clinical recommendations for diagnosis, treatment and follow-up. Ann. Oncol. 19 Suppl 2, ii97 - 8.

[0532] Smith, C. G., Fisher, D., Claes, B., Maughan, T. S., Idziaszczyk, S., Peuteman, G., Harris, R., James, M. D., Meade, A., Jasani, B., etc. (2013). Somatic profiling of the epidermal growth factor receptor pathway in tumors from patients with advanced colorectal cancer treated with chemotherapy + / - cetuximab. Clin. Cancer Res. 19, 4104 - 4113.

[0533] Solanki,A.,King,D.,Thibault,G.,Wang,L.&Gibbs,S.L.Quantification offluorophore distribution and therapeutic response in matched in vivo and exvivo pancreatic cancer model systems.PLoS One 15,e0229407;10.1371 / journal.pone.0229407(2020).

[0534] Song,E.,Zhu,P.,Lee,S.K.,Chowdhury,D.,Kussman,S.,Dykxhoorn,D.M.,Feng,Y.,Palliser,D.,Weiner,D.B.,Shankar,P.,Marasco,W.A.,and Lieberman,J.(2005a).Antibody mediated in vivo delivery of small interfering RNAs via cell-surface receptors.Nat Biotechnol 23,709-17.

[0535] Song,E.,Zhu,P.,Lee,S.K.,Chowdhury,D.,Kussman,S.,Dykxhoorn,D.M.,Feng,Y.,Palliser,D.,Weiner,D.B.,Shankar,P.,Marasco,W.A.,and Lieberman,J.(2005b).Antibody mediated in vivo delivery of small interfering RNAs via cell-surface receptors.Nat Biotechnol 23,709-17.

[0536] Stevens,M.C.(2005).Treatment for childhood rhabdomyosarcoma:the costof cure.Lancet Oncol.6,77-84.

[0537] Turetsky, A.; Kim, E.; Kohler, R. H.; Miller, M. A.; Weissleder, R. (2014): Single-cell imaging of Bruton's tyrosine kinase using an irreversible inhibitor. In: Sci. Rep. 4, S. 4782. DOI: 10.1038 / srep04782.

[0538] Verdine, G. L., and Walensky, L. D. (2007). The challenge of drugging undruggable targets in cancer: lessons learned from targeting BCL-2 family members. Clin. Cancer Res. 13, 7264 - 7270.

[0539] Wilson, W. H.; Young, R. M.; Schmitz, R.; Yang, Y.; Pittaluga, S.; Wright, G., et al., (2015): Targeting B cell receptor signaling with ibrutinib in diffuse large B cell lymphoma. In: Nat. Med. 21(8), S. 922–926. DOI: 10.1038 / nm.3884.

[0540] Wu, Q., et al., Development of small molecule inhibitor-based fluorescent probes for highly specific super-resolution imaging. Nanoscale 12, 21591–21598; 10.1039 / d0nr05188h (2020).

[0541] Zhang, Hui; Patel, Atish; Wang, Yi-Jun; Zhang, Yun-Kai; Kathawala, Rishil J.; Qiu, Long-Hui et al., (2017): The BTK Inhibitor Ibrutinib (PCI-32765) Overcomes Paclitaxel Resistance in ABCB1- and ABCC10-Overexpressing Cells and Tumors. In: Mol. Cancer Ther. 16(6), S. 1021–1030. DOI: 10.1158 / 1535-7163.MCT-16-0511.

[0542] Zhu, D. et al., Cell- and Tissue-Based Proteome Profiling and Dual Imaging of Apoptosis Markers with Probes Derived from Venetoclax and Idasanutlin. Angewandte Chemie (International ed. in English) 57, 9284–9289; 10.1002 / anie.201802003 (2018).

Claims

1. A method for producing nanoparticles, the method comprising: c) Contacting the antibody with a composition comprising a first conjugate (A), the first conjugate comprising a positively charged polypeptide conjugated to a bifunctional linker, characterized in that, The composition is substantially free of unconjugated bifunctional linkers, wherein the molar ratio of substantially free of the first conjugate to unconjugated linkers is 10:1 or greater, thereby obtaining a second conjugate (B), the second conjugate comprising the positively charged polypeptide, the bifunctional linker and the antibody, wherein the molar ratio between the first conjugate (A) and the antibody is at least 10:1; as well as d) Contacting the second conjugate (B), the positively charged polypeptide, and the negatively charged molecule to form nanoparticles, wherein the molar ratio of the positively charged polypeptide to the second conjugate (B) is at least 10:

1. The antibody is IgG and is specific to CD33, EGFR, IGF1R, or CD20. The positively charged polypeptides mentioned therein are protamine or histones. The bifunctional connectors mentioned above are heterofunctional bifunctional connectors. The negatively charged molecule mentioned therein is a nucleic acid or ibrutinib conjugated with Cy 3.5 or Alexa488.

2. The method according to claim 1, wherein prior to step c), the method comprises: a) Conjugating positively charged peptides to bifunctional linkers; b) Remove unconnected bifunctional connectors.

3. The method according to claim 1, wherein in step c), the molar ratio between the first conjugate (A) and the antibody is 10:1 to 50:

1.

4. The method according to claim 1, wherein in step d), the molar ratio between the positively charged polypeptide and the second conjugate (B) is 10:1 to 50:

1.

5. The method according to claim 1, wherein the heterobifunctional linker is sulfonyl-SMCC.

6. The method according to claim 1, wherein the nucleic acid is siRNA or antisense oligonucleotide.

7. The method according to claim 1, wherein the positively charged polypeptide is protamine.

8. A nanoparticle, said nanoparticle being obtainable by any one of the preceding claims.

9. A nanoparticle comprising: a) Positively charged polypeptides; b) A second conjugate (B), the second conjugate comprising an antibody conjugated to a positively charged polypeptide; and c) One or more negatively charged molecules, The antibody is IgG and is specific to CD33, EGFR, IGF1R, or CD20. The positively charged polypeptides mentioned therein are protamine or histones. The bifunctional connectors mentioned above are heterofunctional bifunctional connectors. The negatively charged molecule mentioned therein is a nucleic acid or ibrutinib conjugated with Cy 3.5 or Alexa488.

10. The nanoparticles of claim 8, wherein the second conjugate is enriched in the outer portion of the nanoparticles.

11. The nanoparticles of claim 8, wherein one or more negatively charged molecules are enriched in the internal portion of the nanoparticles.

12. The nanoparticles of claim 8, wherein the nanoparticles have an average diameter of 0.05 μm to 10 μm.

13. A composition comprising the nanoparticles according to any one of claims 8-12.

14. The nanoparticles according to any one of claims 8-12 or the composition according to claim 13, used in treatment.

15. A kit comprising the nanoparticles of any one of claims 8-12 or the composition of claim 13.

Images