Application of LINC02159 as a therapeutic target in the preparation of drugs for preventing and treating non-small cell lung cancer

Abstract

The present invention provides the use of LINC02159 as a therapeutic target in the preparation of drugs for the prevention and treatment of non-small cell lung cancer, belonging to the field of biomedical technology. Through research, the present invention found that LINC02159 is a gene closely related to the occurrence and development of non-small cell lung cancer; compared with adjacent adjacent tissues, LINC02159 is highly expressed in non-small cell lung cancer tissues. By inhibiting the expression of LINC02159, the malignant processes of non-small cell lung cancer, such as cell proliferation, cloning, migration, and invasion, in vitro and in vivo can be significantly inhibited, and cell apoptosis can be promoted. The present invention provides a new drug therapeutic target for the treatment of non-small cell lung cancer, which is beneficial to subsequent drug development and clinical treatment, and provides scientific, precise, and personalized diagnosis and treatment plans for patients with non-small cell lung cancer.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and specifically relates to the use of LINC02159 as a therapeutic target in the preparation of drugs for preventing and treating non-small cell lung cancer. Background Art

[0002] Lung cancer is a malignant tumor that seriously endangers human life and health, and its morbidity and mortality rates are among the highest among malignant tumors. Non-small cell lung cancer (NSCLC) is the most common subtype of lung cancer clinically, but some patients do not have obvious early symptoms and are already in the late stage when diagnosed, missing the best treatment opportunity. The main treatment options for NSCLC include surgical resection, chemoradiotherapy, targeted therapy, and immunotherapy. Although there are multiple treatment options, the overall survival rate of lung cancer patients remains low due to the late diagnosis and strong heterogeneity of lung cancer. Therefore, there is an urgent need to find new diagnostic markers and therapeutic targets for NSCLC.

[0003] Only 2% of the human genome is protein-coding RNA; the remainder is non-coding RNA. Long non-coding RNA (lncRNA) is a class of non-coding RNA greater than 200 nucleotides in length. Studies have shown that lncRNAs can regulate gene expression at multiple levels, including epigenetic, transcriptional, and post-transcriptional, and are involved in malignant processes such as tumorigenesis, proliferation, metastasis, and drug resistance. With the widespread application of high-throughput technologies in the life sciences, an increasing number of novel lncRNAs have been discovered, but the role of lncRNAs in tumorigenesis remains to be fully elucidated. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a use of LINC02159 as a therapeutic target in the preparation of drugs for the prevention and treatment of non-small cell lung cancer. By inhibiting the expression of LINC02159, the cell proliferation, migration, and invasion of non-small cell lung cancer can be effectively inhibited, and the apoptosis of non-small cell lung cancer cells can be promoted, thereby achieving the purpose of treating non-small cell lung cancer.

[0005] The present invention provides a use of long non-coding RNA LINC02159 as a therapeutic target in the preparation of a medicament for preventing and treating non-small cell lung cancer.

[0006] Preferably, the long non-coding RNA LINC02159 affects the occurrence and development of non-small cell lung cancer through positive regulation.

[0007] The present invention provides an application of a long non-coding RNA LINC02159 expression inhibitor in the preparation of a medicament for preventing and treating non-small cell lung cancer.

[0008] Preferably, the long non-coding RNA LINC02159 expression inhibitor includes siRNA targeting LINC02159.

[0009] Preferably, the siRNA targeting LINC02159 includes one or more of the following: si-LINC02159-1, si-LINC02159-2, and si-LINC02159-3;

[0010] The si-LINC02159-1 is composed of a sense strand 1 having a nucleotide sequence as shown in SEQ ID NO: 2 and an antisense strand 1 having a nucleotide sequence as shown in SEQ ID NO: 3;

[0011] The si-LINC02159-2 is composed of a sense strand 2 having a nucleotide sequence as shown in SEQ ID NO: 4 and an antisense strand 2 having a nucleotide sequence as shown in SEQ ID NO: 5;

[0012] The si-LINC02159-3 is composed of a sense strand 3 with a nucleotide sequence as shown in SEQ ID NO: 6 and an antisense strand 3 with a nucleotide sequence as shown in SEQ ID NO: 7.

[0013] Preferably, the drug has at least one of the following anti-cancer effects:

[0014] 1) Inhibit the proliferation of non-small cell lung cancer cells;

[0015] 2) Inhibit the migration of non-small cell lung cancer cells;

[0016] 3) Inhibit non-small cell lung cancer cell invasion;

[0017] 4) Promote apoptosis of non-small cell lung cancer cells;

[0018] 5) Inhibit the growth of non-small cell lung cancer in vivo.

[0019] Preferably, the non-small cell lung cancer cells include at least one of the following cells: A549, H1299 and PC9.

[0020] The present invention provides a use of long non-coding RNA LINC02159 as a diagnostic marker in the preparation of a reagent or a kit for diagnosing non-small cell lung cancer.

[0021] Preferably, the reagent for detecting the long non-coding RNA LINC02159 includes a forward primer having a nucleotide sequence as shown in SEQ ID NO: 8 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 9.

[0022] Preferably, the nucleotide sequence of the long non-coding RNA LINC02159 is shown in SEQ ID NO: 1.

[0023] This invention provides the use of the long noncoding RNA LINC02159 as a therapeutic target in the preparation of a drug for the prevention and treatment of non-small cell lung cancer. This invention demonstrates for the first time that LINC02159 is involved in the regulation of non-small cell lung cancer. Furthermore, by inhibiting LINC02159 expression, it inhibits non-small cell lung cancer cell proliferation, migration, invasion, and tumor growth in vivo, while promoting apoptosis of non-small cell lung cancer cells. LINC02159 provides a new drug target for the treatment of non-small cell lung cancer, facilitating subsequent drug development and clinical treatment, and possesses important scientific significance.

[0024] The present invention also provides the use of a long non-coding RNA, LINC02159, as a diagnostic marker in the preparation of a reagent or kit for diagnosing non-small cell lung cancer. The present invention conducted lncRNA expression profiling analysis on non-small cell lung cancer and adjacent tissues, finding that LINC02159 was highly expressed in non-small cell lung cancer. LINC02159 expression levels at the tissue and cellular levels were verified using clinical samples and cell lines. The results showed that LINC02159 was significantly more highly expressed in non-small cell lung cancer tissues compared with adjacent tissues, and more highly expressed in non-small cell lung cancer cell lines compared with human bronchial epithelial (HBE) cells. This suggests that LINC02159 can be used as a diagnostic marker in the preparation of a reagent or kit for diagnosing non-small cell lung cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a heat map of the cluster analysis of lncRNAs in non-small cell lung cancer and adjacent tissues;

[0026] Figure 2 Schematic diagram of LINC02159 expression levels in NSCLC, where A is the expression level of LINC02159 in non-small cell lung cancer tissues and their paired adjacent adjacent tissues, and B is the expression level of LINC02159 in human bronchial epithelial cells (HBE) and non-small cell lung cancer cells (A549, H1299, PC9);

[0027] Figure 3 Schematic diagram of the effect of inhibiting LINC02159 expression on the biological characteristics of non-small cell lung cancer cells, where A is the LINC02159 knockdown efficiency, B is the cell growth curve result diagram, C is the plate cloning result diagram, D is the migration result diagram, E is the invasion result diagram, and F is the cell apoptosis result diagram;

[0028] Figure 4Schematic diagram of the effect of inhibiting LINC02159 expression on subcutaneous tumor growth in nude mice, where A is a schematic diagram of subcutaneous tumor growth in nude mice, B is a schematic diagram of the quantitative analysis results of subcutaneous tumor weight and volume in nude mice, and C is a schematic diagram of HE staining and immunohistochemistry results of tumor tissue. DETAILED DESCRIPTION

[0029] The present invention provides a use of long non-coding RNA LINC02159 as a diagnostic marker in the preparation of a reagent or a kit for diagnosing non-small cell lung cancer.

[0030]

[0031] In the present invention, the reagent for detecting the long non-coding RNA LINC02159 preferably includes a forward primer having a nucleotide sequence as shown in SEQ ID NO: 8 (CCACCCCTTTCCCTGTAAGAG) and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 9 (TTGGTCAAAGCCAAAAGCCG). Simultaneously, an internal reference gene detection primer is also included during detection. The internal reference gene is preferably U6. The internal reference gene detection primer includes a forward primer having a nucleotide sequence as shown in SEQ ID NO: 10 (CTCGCTTCGGCAGCACA) and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 11 (AACGCTTCACGAATTTGCGT).

[0032] In the present invention, the reagent or kit preferably further includes a reaction buffer for qPCR detection and / or a reverse transcription reagent. The present invention has no particular restrictions on the source of the reaction buffer for qPCR detection and / or the reverse transcription reagent, and the reaction buffer for qPCR detection and / or the reverse transcription reagent well known in the art can be used. In the embodiment of the present invention, the reaction buffer for qPCR detection is purchased from Nanjing Novozymes Biotech Co., Ltd. The reverse transcription reagent is preferably purchased from Nanjing Novozymes Biotech Co., Ltd.

[0033] Given that the expression inhibition of LINC02159 can effectively inhibit the proliferation, migration, invasion and tumor growth of non-small cell lung cancer cells in vivo, while promoting cell apoptosis, the present invention provides a use of long non-coding RNA LINC02159 as a therapeutic target in the preparation of drugs for the prevention and treatment of non-small cell lung cancer.

[0034] In the present invention, the long non-coding RNA LINC02159 preferably affects the occurrence and development of non-small cell lung cancer through positive regulation. Experiments have shown that the expression of long non-coding RNA LINC02159 in non-small cell lung cancer tissue is significantly upregulated, and inhibiting LINC02159 expression through transgenic means can effectively inhibit the occurrence and development of non-small cell lung cancer. Therefore, the present invention provides the use of LINC02159 as a therapeutic target in the prevention and treatment of non-small cell lung cancer.

[0035] The present invention provides use of a long non-coding RNA LINC02159 expression inhibitor in the preparation of a medicament for preventing and treating non-small cell lung cancer.

[0036] In the present invention, the long non-coding RNA LINC02159 expression inhibitor preferably includes siRNA targeting LINC02159. The siRNA targeting LINC02159 preferably includes one or more of the following: si-LINC02159-1, si-LINC02159-2 and si-LINC02159-3; the si-LINC02159-1 is preferably composed of a sense chain 1 such as a nucleotide sequence as SEQ ID NO: 2 (ggccuguguaaacauaacatt) and an antisense chain 1 such as a nucleotide sequence as SEQ ID NO: 3 (uguuauguuuacacaggcctt); the si-LINC02159-2 is preferably composed of a sense chain 2 such as a nucleotide sequence as SEQ ID NO: 4 (cagcccugcacauuauguatt) and an antisense chain 2 such as a nucleotide sequence as SEQ ID NO: 5 (uacauaaugugcagggcugtt); the si-LINC02159-3 is preferably composed of a sense chain 3 such as a nucleotide sequence as SEQ ID NO: 6 (cgcacuuaga gagaguaaatt) and an antisense chain such as SEQ ID NO: The antisense strand 3 is composed of the sequence shown in NO:7 (uuuacucucucuaagugcgtt). Compared with siRNAs designed simultaneously for the same target gene, these three siRNAs have higher targeted knockdown efficiency, which is beneficial for inhibiting LINC02159 expression in non-small cell lung cancer cells, thereby improving the therapeutic effect of the drug. The siRNA sequences were synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd.

[0037] In the present invention, the drug preferably has at least one of the following anti-cancer effects:

[0038] 1) Inhibit the proliferation of non-small cell lung cancer cells;

[0039] 2) Inhibit the migration of non-small cell lung cancer cells;

[0040] 3) Inhibit non-small cell lung cancer cell invasion;

[0041] 4) Promote apoptosis of non-small cell lung cancer cells;

[0042] 5) Inhibit the growth of non-small cell lung cancer in vivo.

[0043] In the examples of the present invention, it was verified at the cellular level that inhibiting LINC02159 expression has an inhibitory effect on NSCLC cell proliferation, migration, and invasion, and a promoting effect on NSCLC apoptosis. The non-small cell lung cancer cells preferably include at least one of the following cells: A549, H1299, and PC9. At the same time, the present invention also carried out animal level verification experiments, using a nude mouse subcutaneous tumor model as the experimental subject. After knocking down LINC02159, the tumor volume decreased and the weight decreased. It can be seen that after knocking down LINC02159 at the animal level, the proliferation of subcutaneous tumors in nude mice slowed down and apoptosis increased. It can be seen that the present invention has obtained the application of LINC02159 expression inhibitors in the preparation of drugs for the prevention and treatment of non-small cell lung cancer at both the cellular and animal levels, providing a new technical means for the treatment of non-small cell lung cancer.

[0044] The following examples describe in detail the use of LINC02159 as a therapeutic target in the preparation of drugs for preventing and treating non-small cell lung cancer. However, these examples should not be construed as limiting the scope of protection of the present invention.

[0045] It should be understood that the specific embodiments described in the present invention are only used to explain the present invention and are not intended to limit the present invention. Unless otherwise indicated, all technical and scientific terms used in the present invention have the same meanings as those generally understood by those of ordinary skill in the art to which this application belongs. The experimental methods for the following examples without specifying specific conditions are generally based on conventional conditions, such as Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. In addition, the cell strains and reagents mentioned in the present invention are all commercially available, and they are only examples without any limiting effect on the present invention and can be replaced with other suitable tools and biomaterials.

[0046] Example 1

[0047] Schematic diagram of lncRNA expression profiles in non-small cell lung cancer and adjacent tissues

[0048] Three pairs of non-small cell lung cancer and adjacent tissues were collected and transcriptome sequencing was performed by Shanghai Ouyi Biomedical Technology Co., Ltd. The lncRNA expression profiles were analyzed through bioinformatics analysis processes such as transcript reconstruction, filtering of known protein-coding transcripts, coding capacity prediction, and lncRNA expression level analysis. The difference in lncRNA expression between the tumor group and the control group was displayed using a heat map with p < 0.05 and |log2FC| > 1 as the thresholds ( Figure 1), a total of 173 differentially expressed lncRNAs were screened, of which 84 were upregulated and 89 were downregulated in NSCLC tissues. LINC02159 (SEQ ID NO: 1) ranked at the top in terms of upregulated fold in non-small cell lung cancer.

[0049] Example 2

[0050] LINC02159 expression in clinical samples and cells

[0051] 1. Experimental Methods

[0052] (1) Extraction of cellular RNA

[0053] 1) Take cells with good growth conditions, wash them twice with PBS, and discard the supernatant.

[0054] 2) Add 1 mL of TRIzol lysis buffer and place on ice for 5 minutes.

[0055] 3) Add 200 μL of chloroform, vortex mix for 15 seconds, and let stand at room temperature for 15 minutes.

[0056] 4) Centrifuge at 12,000 g for 15 min at 4°C. Carefully aspirate the upper aqueous phase into a new Eppendorf tube. Add isopropanol equal to the aspirated volume, invert to mix, and let stand at room temperature for 10 min.

[0057] 5) Centrifuge at 12,000 g for 10 min at 4°C. A white flocculent precipitate will be visible. Carefully discard the supernatant and add 1 mL of 75% ethanol diluted in DEPC water to thoroughly wash the precipitate.

[0058] 6) Centrifuge at 7400 g for 5 min at 4°C. Discard as much ethanol as possible and carefully air-dry in a clean bench. When the precipitate becomes a translucent film, add an appropriate amount of DEPC water to fully dissolve the RNA.

[0059] 7) Use NanoDrop TM RNA concentration was measured using a One / OneC micro-volume UV-visible spectrophotometer, and RNA was stored in an ultra-low temperature freezer.

[0060] (2) Reverse transcription PCR (kit purchased from Vazyme, product number R312)

[0061] 1) Removal of genomic DNA

[0062] Prepare the mixture shown in Table 1 in an RNase-free centrifuge tube:

[0063] Table 1 Reverse transcription system 1

[0064] <![CDATA[RNase free ddH2O]]> Add to 10 μL 5×gDNA wiper mix 2μL Total RNA 1 μg

[0065] Mix gently by pipetting. Incubate at 42°C for 2 minutes.

[0066] 2) Prepare the first-strand cDNA synthesis reaction solution

[0067] Prepare the following mixture in an RNase-free centrifuge tube:

[0068] Table 2 Reverse transcription system 2

[0069]

[0070]

[0071] Mix gently by pipetting. Incubate at 37°C for 15 minutes, 85°C for 5 seconds, and store at 4°C.

[0072] (3) qPCR (kit purchased from Vazyme, catalog number Q511)

[0073] 1) Prepare the following mixture in a qPCR tube:

[0074] Table 3 qPCR system preparation

[0075] 2×AceQ Universal SYBR qPCR Master Mix 10 μL Forward primer (10 μM) 0.4μL Reverse primer (10 μM) 0.4μL cDNA 2μL <![CDATA[RNase-freeddH2O]]> 7.2μL

[0076] Table 4 Primer sequences

[0077] LINC02159 forward primer 5'-CCACCCCTTTCCCTGTAAGAG-3'(SEQ ID NO:8) LINC02159 reverse primer 5'-TTGGTCAAAGCCAAAAGCCG-3'(SEQ ID NO:9) U6 forward primer 5'-CTCGCTTCGGCAGCACA-3'(SEQ ID NO:10) U6 reverse primer 5'-AACGCTTCACGAATTTGCGT-3'(SEQ ID NO:11)

[0078] 2) Perform qPCR reaction according to the conditions in Table 4:

[0079] Table 4 qPCR conditions

[0080]

[0081]

[0082] 2. Experimental Results

[0083] The expression of LINC02159 was detected in 50 pairs of non-small cell lung cancer tissues and paired adjacent tissues. qRT-PCR results showed that LINC02159 was significantly overexpressed in non-small cell lung cancer tissues ( Figure 2 Middle A); Compared with human bronchial epithelial cells HBE, LINC02159 is highly expressed in non-small cell lung cancer cell lines ( Figure 2 Middle B).

[0084] Example 3

[0085] Effects of inhibiting LINC02159 expression on proliferation, migration, invasion, and apoptosis of NSCLC cells

[0086] 1. Experimental Methods

[0087] (1) Cell transfection

[0088] 1) Take cells (A549 and PC9) in good growth condition and seed them into 6-well plates 18-24 hours before transfection, so that the cell confluence reaches 30%-50% before transfection.

[0089] 2) Take 5 μL of siRNA and add it to 250 μL of Place in an Eppendorf tube containing culture medium and mix gently. The siRNA is si-LINC02159-1 (S1), si-LINC02159-2 (S2), or si-LINC02159-3 (S3); si-LINC02159-1 is formed by a complementary pairing of SEQ ID NO: 2 and SEQ ID NO: 3. si-LINC02159-2 is formed by a complementary pairing of SEQ ID NO: 4 and SEQ ID NO: 5. si-LINC02159-3 is formed by a complementary pairing of SEQ ID NO: 6 and SEQ ID NO: 7.

[0090] 3) Take 5 μL Lipofectamine TM 2000 μL transfection reagent was added to another 250 μL Add the culture medium to the Eppendorf tube, mix gently, and incubate at room temperature for 5 minutes.

[0091] 4) Mix the liquids from steps 2) and 3), incubate at room temperature for 20 minutes, add to the 6-well plate from step 1), add culture medium to 2 mL, and perform transfection in an incubator. After 4–6 hours, remove the mixture and add 2 mL of complete culture medium.

[0092] 5) After 48 h of culture, the cells were digested with trypsin for subsequent experiments.

[0093] (2) Cell growth curve

[0094] 1) After transfection, cells were digested and counted, and 10,000 cells / well were seeded into a 24-well plate containing 1 mL of complete culture medium and cultured in a cell culture incubator.

[0095] 2) Digest and count one group of cells every 24 hours for 6 consecutive days. Plot a cell growth curve with time as the horizontal axis and cell number as the vertical axis.

[0096] (3) Plate cloning

[0097] 1) After transfection, cells were digested and counted, and 1000 cells / well were seeded into a 6-well plate containing 2 mL of complete culture medium.

[0098] 2) Place the cells in a cell culture incubator and culture for 8 to 10 days, changing the medium every 2 to 3 days.

[0099] 3) When cells have formed visible colonies, discard the culture medium and wash with PBS. Add 1 mL of 4% paraformaldehyde and fix for 30 minutes, then discard. Add 1 mL of crystal violet stain and stain for 15 minutes. Remove the stain, rinse with running water until no more purple stain remains, and air dry.

[0100] 4) Take photos and count the number of cell clones in each well.

[0101] (4) Transwell migration assay

[0102] 1) After transfection, trypsinize the cells, resuspend them in basal medium, count them, and adjust the cell density to 2.5×10 5 / mL, take 200 μL and add it into the Tranwell chamber.

[0103] 2) The Tranwell chamber was placed in a 24-well plate with 600 μL of complete culture medium and cultured in a cell culture incubator for 24 h.

[0104] 3) Discard the culture medium and wash with PBS, add 1 mL of 4% paraformaldehyde and fix for 30 minutes, then discard the solution, add 1 mL of crystal violet staining solution and stain for 15 minutes.

[0105] 4) Carefully wipe off the non-migrated cells with a cotton swab and take pictures under a microscope.

[0106] (5) Matrigel invasion assay

[0107] 1) One day before the experiment, place Matrigel from -20°C into a 4°C refrigerator overnight to allow it to melt from a solid state to a liquid state.

[0108] 2) Prepare 20% Matrigel on ice, spread 50 μL of the solution on the upper layer of the chamber, and incubate at 37°C for 30 minutes to allow the Matrigel to solidify.

[0109] 3) The transfected cells were trypsinized, resuspended in basal medium and counted, and the cell density was adjusted to 5×10 5 / mL, take 200 μL and add it into the Tranwell chamber.

[0110] 4) The Tranwell chamber was placed in a 24-well plate with 600 μL of complete culture medium and cultured in a cell culture incubator for 48 h.

[0111] 5) Discard the culture medium and wash with PBS. Add 1 mL of 4% paraformaldehyde and fix for 30 min, then discard. Add 1 mL of crystal violet staining solution and stain for 15 min.

[0112] 6) Carefully wipe away the uninvaded cells with a cotton swab and take photos under a microscope.

[0113] (6) Cell apoptosis assay (the kit was purchased from Formace, catalog number FMSAV647)

[0114] 1) The transfected cells were digested with EDTA-free trypsin.

[0115] 2) Wash the cells twice with ice-cold PBS, add 1× binding buffer and adjust the cell concentration to 1×10 6 pieces / mL.

[0116] 3) Take 100 μL of cell suspension into a flow cytometry tube, add 10 μL of propidium iodide (20 μg / mL) and 5 μL of Annexin Alexa Fluor 647, and mix well.

[0117] 4) Incubate at room temperature in the dark for 15 min, add 400 μL PBS, and analyze by flow cytometry.

[0118] 2. Experimental Results

[0119] The results of cell growth curve, clone formation, migration, invasion and apoptosis experiments are shown in Figure 3 The results showed that for A549 cells, si-LINC02159-3 had the best targeted knockdown effect, while for PC9 cells, si-LINC02159-1 had the highest targeted knockdown efficiency ( Figure 3 Therefore, si-LINC02159-1 and si-LINC02159-3 were selected for subsequent experiments. The proliferation rate, plate cloning, migration and invasion abilities of NSCLC cells transfected with si-LINC02159-1 and si-LINC02159-3 were much lower than those of the control group ( Figure 3 BE), flow cytometry results showed that knockdown of LINC02159 promoted cell apoptosis ( Figure 3 These results indicate that knockdown of LINC02159 can inhibit NSCLC cell proliferation and metastasis and promote cell apoptosis in vitro. LINC02159 is expected to become a new target for NSCLC treatment.

[0120] Example 4

[0121] Effect of inhibiting LINC02159 expression on subcutaneous tumor growth in nude mice

[0122] A549 cells with good growth status were transfected with control and LINC02159 siRNA (si-LINC02159-3) respectively. The transfected cells were digested and counted. The cells were counted as 1×10 7The cells were injected subcutaneously into 4-6 week old female nude mice to establish a subcutaneous tumor model in nude mice.

[0123] Compared with nude mice injected with control A549 cells, knockdown of LINC02159 significantly reduced tumor volume and weight in the model ( Figure 4 Immunohistochemical analysis of tumor tissues showed that after knocking down LINC02159, the proliferation index of subcutaneous tumors in nude mice was significantly slowed down and the apoptosis index was significantly increased ( Figure 4 Middle C).

[0124] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Use of a long non-coding RNA LINC02159 expression inhibitor in the preparation of a medicament for treating non-small cell lung cancer, wherein the long non-coding RNA LINC02159 expression inhibitor comprises an siRNA targeting LINC02159; The siRNA targeting LINC02159 includes si-LINC02159-1 and / or si-LINC02159-3; The si-LINC02159-1 is composed of a sense strand 1 having a nucleotide sequence as shown in SEQ ID NO: 2 and an antisense strand 1 having a nucleotide sequence as shown in SEQ ID NO: 3; The si-LINC02159-3 is composed of a sense strand 3 with a nucleotide sequence as shown in SEQ ID NO: 6 and an antisense strand 3 with a nucleotide sequence as shown in SEQ ID NO:

7.

2. The application according to claim 1, characterized in that The siRNA targeting LINC02159 also includes si-LINC02159-2; The si-LINC02159-2 is composed of a sense strand 2 having a nucleotide sequence as shown in SEQ ID NO: 4 and an antisense strand 2 having a nucleotide sequence as shown in SEQ ID NO:

5.

3. The use according to claim 1 or 2, characterized in that: The drug has at least one of the following anti-cancer effects: 1) Inhibit the proliferation of non-small cell lung cancer cells; 2) Inhibit the migration of non-small cell lung cancer cells; 3) Inhibit non-small cell lung cancer cell invasion; 4) Promote apoptosis of non-small cell lung cancer cells; 5) Inhibit the growth of non-small cell lung cancer in vivo.

4. The application according to claim 3, characterized in that The non-small cell lung cancer cells include at least one of the following cells: A549, H1299 and PC9.

5. The use according to claim 1 or 2, characterized in that: The nucleotide sequence of the long non-coding RNA LINC02159 is shown in SEQ ID NO: 1.

Images