A protein and its application in the prevention and treatment of spodoptera frugiperda

Abstract

The present application relates to a kind of protein and its application in the prevention and treatment of Spodoptera frugiperda.The amino acid sequence of the protein is shown in SEQ ID No.4.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological control, in particular to the application of a protein in the control of Spodoptera frugiperda. BACKGROUND

[0002] Spodoptera frugiperda is a polyphagous pest originally from the tropical and subtropical regions of the Americas, which has strong reproductive, adaptive and migratory abilities. Its larvae can feed on 76 families and 353 species of plants mainly from the families of Gramineae, Asteraceae, Leguminosae and Amaranthaceae. Since its invasion into China in January 2019, Spodoptera frugiperda has rapidly spread across the country, posing a significant threat to food production safety and ecological safety. At present, the control of Spodoptera frugiperda mainly adopts two strategies: chemical control and biological control. Biological control mainly relies on entomopathogenic fungi, such as Bacillus thuringiensis (Bt). However, with the continuous planting of Bt Cry gene crops, Spodoptera frugiperda has gradually developed resistance to this type of gene.

[0003] Therefore, it is necessary to find a gene that can maintain a low level of resistance gene frequency in the field against Spodoptera frugiperda. SUMMARY

[0004] One of the present application provides a protein, the amino acid sequence of which is shown in SEQ ID No. 4.

[0005] The second aspect of the present application provides a nucleic acid encoding the protein as described in the first aspect of the present application.

[0006] In one specific embodiment, the nucleotide sequence of the nucleic acid is shown in SEQ ID No. 1.

[0007] The third aspect of the present application provides a composition containing the protein as described in the first aspect of the present application.

[0008] The fourth aspect of the present application provides a microorganism carrying the nucleic acid as described in the second aspect of the present application, and the nucleic acid is capable of expressing the protein as described in the first aspect of the present application.

[0009] In one specific embodiment, the microorganism is Escherichia coli and / or Bacillus thuringiensis.

[0010] The fifth aspect of the present application provides the application of one of the protein as described in the first aspect of the present application, the nucleic acid as described in the second aspect of the present application, the composition as described in the third aspect of the present application and the microorganism as described in the fourth aspect of the present application in the control of Spodoptera frugiperda.

[0011] The beneficial effects of the present application are:

[0012] The present application first discovers that the protein with amino acid sequence as shown in SEQ ID No. 4 has excellent insecticidal activity on Spodoptera frugiperda. DETAILED DESCRIPTION

[0013] The above content of the present application is further described in detail in the form of preferred embodiments, but it does not constitute a limitation to the present application.

[0014] Unless otherwise specified, the reagents in the examples of the present application can be purchased through commercial channels.

[0015] Spodoptera frugiperda was provided by the Institute of Plant Protection, Jilin Academy of Agricultural Sciences.

[0016] Example 1

[0017] Expression of the protein

[0018] 1. Construction of recombinant Bt strain

[0019] Primers F1 / R1 (SEQ ID No. 2 / SEQ ID No. 3) were designed based on the nucleotide sequence as shown in SEQ ID No. 1, and the nucleotide sequence as shown in SEQ ID No. 1 and the primers were synthesized by Shengong Bioengineering (Shanghai) Co., Ltd. The nucleotide sequence as shown in SEQ ID No. 1 encodes the protein as shown in SEQ ID No. 4.

[0020] PCR amplification was performed with F1 / R1 as the template and the synthesized nucleotide as shown in SEQ ID No. 1 as the template, and then the amplified product was ligated to the pSTK vector to obtain the pSTK-Cry1-1 recombinant plasmid, and then the positive recombinant plasmid was transformed into the Bt crystal-free mutant strain HD73-, and the positive transformant HD73 / pSTK-Cry1-1 was screened out.

[0021] 2. Expression and extraction of the protein

[0022] (1) Single colony picking: pick a single colony of Bt HD73 / pSTK-Cry1-1 in 5 mL LB liquid medium containing kanamycin, and culture at 30°C, 220 rpm for 12 hours;

[0023] (2) Inoculate 1% volume into a 1L triangular flask containing 300 mL 1 / 2 LB liquid medium (containing kanamycin), and culture at 30°C, 220 rpm until about 80% of the bacterial bodies are lysed under microscopic observation, then stop the culture;

[0024] (3) Centrifuge the fermentation broth at 6,500 x g at low temperature for 15 minutes, and collect the precipitate;

[0025] (4) The precipitate was washed once with pre-cooled 1 mol / L NaCl, centrifuged at 8,000 x g for 15 minutes at low temperature, and the supernatant was removed;

[0026] (5) The precipitate was washed once or twice with pre-cooled sterilized water, and mixed well during the washing process;

[0027] (6) The lysis solution was added to the precipitate of the cell crystal mixture, and mixed well. The precipitate was lysed at 100 rpm on ice for more than 8 hours;

[0028] (7) The supernatant and the precipitate were collected after centrifugation at 9,500 x g for 10 minutes at 4°C;

[0029] (8) The precipitate was repeated steps (7) and (8) twice;

[0030] (9) The supernatant was poured into a clean 50 mL centrifuge tube, and about 1 / 7 volume of 4 mol / L NaAc-HAc was slowly added while stirring with a sterile glass rod. The mixture was placed on ice for 4 hours;

[0031] (10) The supernatant was discarded and the precipitate was collected after centrifugation at 9,500 x g for 15 minutes at 4°C;

[0032] (11) The precipitate was washed 2-3 times with pre-cooled sterilized water, and each washing was mixed well. The NaAc-HAc was washed clean;

[0033] (12) An appropriate amount of 50 mmol / L Na2CO3(pH 10.0) was added to resuspend the precipitate, and the mixture was repeatedly blown and beaten with a 5 mL pipette until it was fully dissolved.

[0034] (13) The protein extraction result was detected by SDS-PAGE, and quantified with BSA.

[0035] Comparative Example 1

[0036] Primers F1 / R1 (SEQ ID No. 2 / SEQ ID No. 3) were designed based on the nucleotide sequence shown in GenBank: X53985.1. The nucleotide sequence shown in GenBank: X53985.1 and the primers were synthesized by Shengong Bioengineering (Shanghai) Co., Ltd. The nucleotide sequence shown in GenBank: X53985.1 encodes a protein shown in GenBank: CAA37933.1. The protein has 99% identity with the protein of Example 1.

[0037] F1 / R1 as primers, and the synthesized nucleotide sequence as shown in GenBank: X53985.1 as a template, PCR amplification was performed, and then the amplified product was ligated to the pSTK vector to obtain the pSTK-Cry1-2 recombinant plasmid. Then, the positive recombinant plasmid was transformed into the Bt crystal-free mutant strain HD73-, and the positive transformant HD73 / pSTK-Cry1-2 was screened out.

[0038] The expression and extraction of the protein were the same as those in the second subsection of Example 1, except that the single colony picked in step (1) was Bt HD73 / pSTK-Cry1-2.

[0039] Comparative Example 2

[0040] Primers F1 / R1 (SEQ ID No. 2 / SEQ ID No. 3) were designed based on the nucleotide sequence as shown in GenBank: M73252.1. The nucleotide sequence as shown in GenBank: M73252.1 and the primers were synthesized by Shengong Bioengineering (Shanghai) Co., Ltd. The nucleotide sequence as shown in GenBank: M73252.1 encodes a protein as shown in GenBank: AAA22345. The protein has 99% identity with the protein of Example 1.

[0041] F1 / R1 as primers, and the synthesized nucleotide sequence as shown in GenBank: M73252.1 as a template, PCR amplification was performed, and then the amplified product was ligated to the pSTK vector to obtain the pSTK-Cry1-3 recombinant plasmid. Then, the positive recombinant plasmid was transformed into the Bt crystal-free mutant strain HD73-, and the positive transformant HD73 / pSTK-Cry1-3 was screened out.

[0042] The expression and extraction of the protein were the same as those in the second subsection of Example 1, except that the single colony picked in step (1) was Bt HD73 / pSTK-Cry1-3.

[0043] Example 2

[0044] Activity determination of the protein on Spodoptera exigua

[0045] 20 mmol / L Tris-HCl (pH 8.0) was used as a blank control; the concentrations of the proteins of Example 1, Comparative Example 1 and Comparative Example 2 were set to be 1.250 μg / mL, 2.50 μg / mL, 5.00 μg / mL, 10.00 μg / mL, 20.00 μg / mL, 40.00 μg / mL, 80.00 μg / mL and 160.00 μg / mL, respectively, to obtain the samples to be tested.

[0046] Take 5g artificial feed (formula see Table 1) in a sterile culture dish, add 1mL of each concentration of the protein sample to be tested or blank control, mix thoroughly, evenly divided into sterilized 24-well cell culture plates, room temperature until the excess moisture in the feed is completely evaporated; use a hair brush to pull the line into the hole with healthy, active, not fed Spodoptera frugiperda newly hatched larvae (within 12h after hatching), 1 head of worm per hole, cover with plastic cover after wet toilet paper, tighten with rubber band, stand in the biochemical incubator, at 28℃, light cycle 16L:8D, relative humidity 65%, culture, observe daily, check light, humidity, temperature and whether the feed is moldy, whether there is water vapor condensation; investigate the number of dead worms after 7d, the results are shown in Table 2. Then calculate the mortality rate. 24 worms per treatment, repeated 3 times. Use SPSS24 software to analyze the lethal concentration (LC 50 ) of the protein, the results are shown in Table 2.

[0047] Table 1

[0048] Feed components 1 part usage 2 parts usage Agar agar 55 g 110g Soybean meal 110g 220g Wheat bran / germ meal 210g 420g Yeast powder 40 g 80g Sorbic acid 4g 8g Casein 55g 110g Ascorbic acid 4g 8g Complex vitamin 3 mL 6 mL Formaldehyde 3 mL 6 mL Acetic acid 6 mL 12 mL Tektamer 1 mL 2 mL Distilled water 1800 (1600 + 200) mL 3600 (3400 + 200) mL

[0049] Table 2

[0050] Example LC 50 (μg / g) 95% confidence limit (μg / g) Example 1 0.701 0.287-1.195 Comparative Example 1 2.744 1.302-6.802 Comparative Example 2 2.435 1.339-5.635

[0051] According to Table 2, the protein of Example 1 is 3.91 times the activity of the protein of Comparative Example 1, and 3.47 times the activity of the protein of Comparative Example 2.

[0052] Although the present application has been described with reference to specific embodiments, it is understood by those skilled in the art that various changes can be made without departing from the true spirit and scope of the application. In addition, various modifications can be made to the subject matter, spirit and scope of the application to adapt to specific situations, materials, material compositions and methods. All these changes are included in the scope of the claims of the present application. SEQUENCE LISTING <110> Institute of Plant Protection, Chinese Academy of Agricultural Sciences <120> A protein and its application in the prevention and treatment of Spodoptera frugiperda <130> LHA2160509 <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 3516 <212> DNA <213> Artificial sequence <400> 1 atggagatag tgaataatca gaatcaatgc gtgccttata attgtttaaa taatcctgaa 60 aatgagatat tagatattga aaggtcaaat agtactgtag caacaaacat cgccttggag 120 attagtcgtc tgctcgcttc cgcaactcca atagggggga ttttattagg attgtttgat 180 gcaatatggg ggtctatagg cccttcacaa tgggatttat ttttagagca aattgagcta 240 ttgattgacc aaaaaataga ggaattcgct agaaaccagg caatttctag attagaaggg 300 ataagcagtc tgtacggaat ttatacagaa gcttttagag agtgggaagc agatcctact 360 aatccagcat taaaagaaga gatgcgtact caatttaatg acatgaacag tattcttgta 420 acagctattc ctcttttttc agttcaaaat tatcaagtcc catttttatc agtatatgtt 480 caagctgcaa atttacattt atcggttttg agagatgttt cagtgtttgg gcaggcttgg 540 ggatttgata tagcaacaat aaatagtcgt tataatgatc tgactagact tattcctata 600 tatacagatt atgctgtacg ctggtacaat acgggattag atcgcttacc acgaactggt 660 gggctgcgaa actgggcaag atttaatcag tttagaagag agttaacaat atcagtatta 720 GATATTATTT CTTTTTTCAG AAATTACGAT TCTAGATTA TATCCAATTC CAACAAGCTC C 780 CAATTAACGC GGGAAGTATA TACAGATCCG GTAATTAATA TAAC TGA CTA TAG AGTTGGC 840 CCCAGCTTCG AGAATATTGA GAAC T C AGCC ATTA GAAGCCC C CACCTTAT GGACTTCTTA 900 AATAATTTGA CCATTGATAC GGATT TGATT AGAGGTGTTCA CTATTGGGC AGGGCATCGT 960 GTAAC T TCTC ATTTTACAGGT AGTTCTCAA GTGATAACAA CCCCTCAATATGGGATAACC 1020 GCAAATGCGG AACCAAGACG AACTATTGCT CCTAGTACTT TTCCAGGTCT TAACCTATTT 1080 TATAGAACAT TATCAAATCC TTTCTTCCGA AGATCAGAAA ATATTACTCC TACCTTAGGG 1140 ATAAATGTAG TACAGGGAGT AGGGTTCA TTCAACCAA T A ATGCTGAAGT TCTATATAGA 1200 AGTAGGGGGA CAGTAGATTC TCTTAATGAG TTACCAATTC ATGGTGAGAA TTCATTAGTT 1260 GGATATAGTC ATCGATTAAG TCA T GTTACAC T AACCAGGTC GTTATATAA TACTAATATA 1320 ACTAGCCTGC CAACATTTGT TTGGACACAT CACAGTGCTA CTAATACAAT ACAATTAAT 1380 CCAGATATAT TACACAAAT ACC TTTAGTGA AAGGATTTAG ACTTGGTGGT GGCACCTCT 1440 gtcattaaag gaccaggatt tacaggagggg gatatccttc gagaaatac cattggtgag 1500 ttgtgtctt tacaagtca tattactca ccaattaccc aaagataccg tttaagattt 1560 cgttatgctt ccagtaggga tgcacgaatt actgtagcga taggaggaca aattagagta 1620 gatatgaccc ttgaaaaaac catggaattt gggagagct taacatctag aacaatttagc 1680 tatgcagcat ttagtaatcc tttcattt agggctaatc cagatataat tagatagct 1740 gaagaacttc ctattcgtgg tggtgagctt tatatagata aaattgaact tattcttagca 1800 gatgcaacat ttgagaaga atatgatttg gaagagcac agaaggcggt gatgccctg 1860 tttactcta space aggctaaa acgatgtga cggattca tattgatca 1920 gtttccaatt tagttgagtg tttacggat gatttttgtc tggatgaaaa gagagaatta 1980 tccgagaaag tcaacatgc gaagcgactc agtgatgaac ggaatttact tcaagatcca 2040 aacttcagag ggatcatag gcaaccagac cgtggctgga gaggaagcac ggattattact 2100 atccaaggtg gagatgacgt attchaagg attacgtca cattaccggg taccttttgat 2160 GAGTGCTATC CAACGTATTT ATATCAAAAA ATAGATGA GT CGAAGTTAAA AGCTTATACC 2220 CGCTATG AATT AAGAGGGT ATATCGAGGAT AGTCAAGACT TAGAAATCTA TTTAATTCGC 2280 TACAATGCAA AACACGAGAC AGTAAACGTG CCAGGTACGG GTTCCTTATG GCCGCTTTCA 2340 GCCCAAAGTCCAATCGGAAAGTGTGGAGAACCGAATCGATGC GC GCCACACCTTGAATGG 2400 AATCCTAATCTAGATTGCTCCTGCAGAGACGGGGAAAAAT GTGCCCATCATTCCCATCAT 2460 TTCTCCTTGGACATTGATGTTGGATGTACAGACTTAAATG AGGACTTAGGTGTATGGGTG 2520 ATATTCAAGATT AAGACAC AAGATGGCTAT GCAAGACTAG GAAATCTAGAGTTTCTCGAA 2580 GAGAAACCACTATTAGGGGAAGC ACTAGCTCGTGTGAAAA GAGCGGAGAAAAAATGGAGA 2640 GACA AATGC GAAAAAT GG AATGGGAAAC A AATATTGTTT AT AAAGAGGC AAAAGAATCT 2700 GTAGATGCTTTATTTTGTA AACTCTCAATAT GATAGATTA C AAGCGGATAC G AATATCGCG 2760 ATGATTCATGC GGC AGAT A A AC G C GTT C AT AG C ATTC G AGA AGC GT AT CT GCC AG AGCTG 2820 TCTGTGATTC CGG GTGTCA AT GC GGCT ATTTTTG AAGAAT TAG AAGGGCGT ATTTTTC ACT 2880 gcattctccc tatatgatgc gagaaatgtc attaaaaatg gcgatttcaa taatggctta 2940 tcatgctgga acgtgaaagg gcatgtagat gtagaagaac agaacaacca tcgttcggtc 3000 cttgttgttc cagaatggga agcagaagtg tcacaagaag ttcgtgtttg tccgggtcgt 3060 ggctatatcc ttcgtgttac agcgtacaaa gagggatatg gagagggctg tgtaacgatt 3120 catgagatcg aagacaatac agacgaactg aaattcagca actgtgtaga agaggaagta 3180 tatccaaaca acacggtaac gtgtaataat tatactgcga ctcaagaaga acatgagggt 3240 acgtacactt cccgtaatcg aggatatgac gaagcctatg aaagcaattc ttctgtacat 3300 gcgtcagtct atgaagaaaa atcgtataca gatagacgaa gagagaatcc ttgtgaatct 3360 aacagaggat atggggatta cacaccacta ccagctggct atgtgacaaa agaattagag 3420 tacttcccag aaaccgataa ggtatggatt gagatcggag aaacggaagg aacattcatc 3480 gtggacagcg tggaattact tcttatggag gaataa 3516 <210> 2 <211> 37 <212> DNA <213> Artificial sequence <400> 2 cgcggatccg cgatggagat agtgaataat cagaatc 37 <210> 3 <211> 37 <212> DNA <213> Artificial sequence <400> 3 ccgctcgagc ggttattcct ccataagaag taattcc 37 <210> 4 <211> 1171 <212> PRT <213> Artificial sequence <400> 4 Met Glu Ile Val Asn Asn Gln Asn Gln Cys Val Pro Tyr Asn Cys Leu 1 5 10 15 Asn Asn Pro Glu Asn Glu Ile Leu Asp Ile Glu Arg Ser Asn Ser Thr 20 25 30 Val Ala Thr Asn Ile Ala Leu Glu Ile Ser Arg Leu Leu Ala Ser Ala 35 40 45 Thr Pro Ile Gly Gly Ile Leu Leu Gly Leu Phe Asp Ala Ile Trp Gly 50 55 60 Ser Ile Gly Pro Ser Gln Trp Asp Leu Phe Leu Glu Gln Ile Glu Leu 65 70 75 80 Leu Ile Asp Gln Lys Ile Glu Glu Phe Ala Arg Asn Gln Ala Ile Ser 85 90 95 Arg Leu Glu Gly lie Ser Ser Leu Tyr Gly lie Tyr Thr Glu Ala Phe 100 105 110 Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Lys Glu Glu Met 115 120 125 Arg Thr Gin Phe Asn Asp Met Asn Ser lie Leu Val Thr Ala lie Pro 130 135 140 Leu Phe Ser Val Gin Asn Tyr Gin Val Pro Phe Leu Ser Val Tyr Val 145 150 155 160 Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser Val Phe 165 170 175 Gly Gin Ala Trp Gly Phe Asp lie Ala Thr lie Asn Ser Arg Tyr Asn 180 185 190 Asp Leu Thr Arg Leu lie Pro lie Tyr Thr Asp Tyr Ala Val Arg Trp 195 200 205 Tyr Asn Thr Gly Leu Asp Arg Leu Pro Arg Thr Gly Gly Leu Arg Asn 210 215 220 Trp Ala Arg Phe Asn Gin Phe Arg Arg Glu Leu Thr lie Ser Val Leu 225 230 235 240 Asp lie lie Ser Phe Phe Arg Asn Tyr Asp Ser Arg Leu Tyr Pro lie 245 250 255 Pro Thr Ser Ser Gln Leu Thr Arg Glu Val Tyr Thr Asp Pro Val Ile 260 265 270 Asn Ile Thr Asp Tyr Arg Val Gly Pro Ser Phe Glu Asn Ile Glu Asn 275 280 285 Ser Ala Ile Arg Ser Pro His Leu Met Asp Phe Leu Asn Asn Leu Thr 290 295 300 Ile Asp Thr Asp Leu Ile Arg Gly Val His Tyr Trp Ala Gly His Arg 305 310 315 320 Val Thr Ser His Phe Thr Gly Ser Ser Gln Val Ile Thr Thr Pro Gln 325 330 335 Tyr Gly Ile Thr Ala Asn Ala Glu Pro Arg Arg Thr Ile Ala Pro Ser 340 345 350 Thr Phe Pro Gly Leu Asn Leu Phe Tyr Arg Thr Leu Ser Asn Pro Phe 355 360 365 Phe Arg Arg Ser Glu Asn Ile Thr Pro Thr Leu Gly Ile Asn Val Val 370 375 380 Gln Gly Val Gly Phe Ile Gln Pro Asn Asn Ala Glu Val Leu Tyr Arg 385 390 395 400 Ser Arg Gly Thr Val Asp Ser Leu Asn Glu Leu Pro Ile Asp Gly Glu 405 410 415 Asn Ser Leu Val Gly Tyr Ser His Arg Leu Ser His Val Thr Leu Thr 420 425 430 Arg Ser Leu Tyr Asn Thr Asn Ile Thr Ser Leu Pro Thr Phe Val Trp 435 440 445 Thr His His Ser Ala Thr Asn Thr Asn Thr Ile Asn Pro Asp Ile Ile 450 455 460 Thr Gln Ile Pro Leu Val Lys Gly Phe Arg Leu Gly Gly Gly Thr Ser 465 470 475 480 Val Ile Lys Gly Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg Arg Asn 485 490 495 Thr Ile Gly Glu Phe Val Ser Leu Gln Val Asn Ile Asn Ser Pro Ile 500 505 510 Thr Gln Arg Tyr Arg Leu Arg Phe Arg Tyr Ala Ser Ser Arg Asp Ala 515 520 525 Arg Ile Thr Val Ala Ile Gly Gly Gln Ile Arg Val Asp Met Thr Leu 530 535 540 Glu Lys Thr Met Glu Ile Gly Glu Ser Leu Thr Ser Arg Thr Phe Ser 545 550 555 560 Tyr Ala Ala Phe Ser Asn Pro Phe Ser Phe Arg Ala Asn Pro Asp Ile 565 570 575 Ile Arg Ile Ala Glu Glu Leu Pro Ile Arg Gly Gly Glu Leu Tyr Ile 580 585 590 Asp Lys Ile Glu Leu Ile Leu Ala Asp Ala Thr Phe Glu Glu Glu Tyr 595 600 605 Asp Leu Glu Arg Ala Gln Lys Ala Val Asn Ala Leu Phe Thr Ser Thr 610 615 620 Asn Gln Leu Gly Leu Lys Thr Asp Val Thr Asp Tyr His Ile Asp Gln 625 630 635 640 Val Ser Asn Leu Val Glu Cys Leu Ser Asp Glu Phe Cys Leu Asp Glu 645 650 655 Lys Arg Glu Leu Ser Glu Lys Val Lys His Ala Lys Arg Leu Ser Asp 660 665 670 Glu Arg Asn Leu Leu Gln Asp Pro Asn Phe Arg Gly Ile Asn Arg Gln 675 680 685 Pro Asp Arg Gly Trp Arg Gly Ser Thr Asp Ile Thr Ile Gln Gly Gly 690 695 700 Asp Asp Val Phe Lys Glu Asn Tyr Val Thr Leu Pro Gly Thr Phe Asp 705 710 715 720 Glu Cys Tyr Pro Thr Tyr Leu Tyr Gin Lys lie Asp Glu Ser Lys Leu 725 730 735 Lys Ala Tyr Thr Arg Tyr Glu Leu Arg Gly Tyr lie Glu Asp Ser Gin 740 745 750 Asp Leu Glu lie Tyr Leu lie Arg Tyr Asn Ala Lys His Glu Thr Val 755 760 765 Asn Val Pro Gly Thr Gly Ser Leu Trp Pro Leu Ser Ala Gin Ser Pro 770 775 780 lie Gly Lys Cys Gly Glu Pro Asn Arg Cys Ala Pro His Leu Glu Trp 785 790 795 800 Asn Pro Asn Leu Asp Cys Ser Cys Arg Asp Gly Glu Lys Cys Ala His 805 810 815 His Ser His His Phe Ser Leu Asp lie Asp Val Gly Cys Thr Asp Leu 820 825 830 Asn Glu Asp Leu Gly Val Trp Val lie Phe Lys lie Lys Thr Gin Asp 835 840 845 Gly Tyr Ala Arg Leu Gly Asn Leu Glu Phe Leu Glu Glu Lys Pro Leu 850 855 860 Leu Gly Glu Ala Leu Ala Arg Val Lys Arg Ala Glu Lys Lys Trp Arg 865 870 875 880 Asp Lys Cys Glu Lys Leu Glu Trp Glu Thr Asn Ile Val Tyr Lys Glu 885 890 895 Ala Lys Glu Ser Val Asp Ala Leu Phe Val Asn Ser Gln Tyr Asp Arg 900 905 910 Leu Gln Ala Asp Thr Asn Ile Ala Met Ile His Ala Ala Asp Lys Arg 915 920 925 Val His Ser Ile Arg Glu Ala Tyr Leu Pro Glu Leu Ser Val Ile Pro 930 935 940 Gly Val Asn Ala Ala Ile Phe Glu Glu Leu Glu Gly Arg Ile Phe Thr 945 950 955 960 Ala Phe Ser Leu Tyr Asp Ala Arg Asn Val Ile Lys Asn Gly Asp Phe 965 970 975 Asn Asn Gly Leu Ser Cys Trp Asn Val Lys Gly His Val Asp Val Glu 980 985 990 Glu Gln Asn Asn His Arg Ser Val Leu Val Val Pro Glu Trp Glu Ala 995 1000 1005 Glu Val Ser Gln Glu Val Arg Val Cys Pro Gly Arg Gly Tyr Ile Leu 1010 1015 1020 Arg Val Thr Ala Tyr Lys Glu Gly Tyr Gly Glu Gly Cys Val Thr Ile 1025 1030 1035 1040 His Glu Ile Glu Asp Asn Thr Asp Glu Leu Lys Phe Ser Asn Cys Val 1045 1050 1055 Glu Glu Glu Val Tyr Pro Asn Asn Thr Val Thr Cys Asn Asn Tyr Thr 1060 1065 1070 Ala Thr Gln Glu Glu His Glu Gly Thr Tyr Thr Ser Arg Asn Arg Gly 1075 1080 1085 Tyr Asp Glu Ala Tyr Glu Ser Asn Ser Ser Val His Ala Ser Val Tyr 1090 1095 1100 Glu Glu Lys Ser Tyr Thr Asp Arg Arg Arg Glu Asn Pro Cys Glu Ser 1105 1110 1115 1120 Asn Arg Gly Tyr Gly Asp Tyr Thr Pro Leu Pro Ala Gly Tyr Val Thr 1125 1130 1135 Lys Glu Leu Glu Tyr Phe Pro Glu Thr Asp Lys Val Trp Ile Glu Ile 1140 1145 1150 Gly Glu Thr Glu Gly Thr Phe Ile Val Asp Ser Val Glu Leu Leu Leu 1155 1160 1165 Met Glu Glu 1170

Claims

1. A protein, the amino acid sequence of which is shown as SEQ ID No.

4.

2. A nucleic acid encoding the protein of claim 1.

3. The nucleic acid of claim 2, wherein, The nucleotide sequence of the nucleic acid is shown as SEQ ID No.

1.

4. A composition comprising the protein of claim 1.

5. A recombinant microorganism carrying the nucleic acid of claim 2 or 3, and the nucleic acid is capable of expressing the protein of claim 1.

6. The recombinant microorganism of claim 5, wherein, The recombinant microorganism is Escherichia coli and / or Bacillus thuringiensis.

7. Use of one of the protein of claim 1, the nucleic acid of claim 2 or 3, the composition of claim 4 and the recombinant microorganism of claim 5 or 6 in controlling Spodoptera frugiperda.