Genetically engineered bacteria for high-efficiency synthesis of 2-phenylethanol, construction method and application thereof
By expressing endogenous and exogenous stress-resistance elements ampk, gdh, strap and gsh, slc in the host bacteria, a genetically engineered bacterium that synthesizes 2-phenylethanol efficiently was constructed. This solved the toxicity problem of high concentrations of 2-phenylethanol to yeast strains, improved yield and tolerance, and achieved high-efficiency production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-05-29
- Publication Date
- 2026-03-31
AI Technical Summary
In existing technologies, high concentrations of 2-phenylethanol are toxic to microorganisms, resulting in low product concentrations during yeast fermentation. Furthermore, the combined effect of ethanol and 2-PE produces even higher toxicity, becoming a bottleneck in the biological production of natural 2-PE.
By expressing endogenous stress-resistance elements ampk, gdh, strap, and tcyc, as well as exogenous stress-resistance elements gsh and slc in the host bacteria, a genetically engineered bacterium capable of efficiently synthesizing 2-phenylethanol was constructed, enhancing the strain's tolerance to 2-PE and its yield.
This improved the strain's tolerance to 2-phenylethanol and its synthesis efficiency, thereby increasing the yield of 2-phenylethanol and providing a new, highly efficient production strain.
Smart Images

Figure CN116836826B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering, specifically relating to genetically engineered bacteria for efficient synthesis of 2-phenylethanol, their construction methods, and applications. Background Technology
[0002] 2-Phenylacetyl alcohol (2-PE) is an aromatic alcohol with a rose-like scent. Although it exists naturally in the essential oils of many plants such as rose and lily, the concentration is usually too low for extraction. Microbial transformation is used to produce natural 2-phenylethanol, preserving the product's purity and natural characteristics while offering advantages such as low cost, short cycle time, and high efficiency, and the product quality meets international standards. Research shows that yeast cells have a metabolic pathway for de novo synthesis of 2-phenylethanol, and can also directly convert L-phenylalanine (L-Phe) into 2-phenylethanol through amino acid catabolism. In 1907, Ehrlich added L-phenylalanine to yeast cultures, significantly increasing the yield of 2-phenylethanol and bringing hope for the industrialization of natural 2-phenylethanol production using yeast biotransformation.
[0003] Like many alcohols, high concentrations of 2-PE are toxic to microorganisms, for example, damaging cell membrane function, affecting intracellular energy metabolism, and accumulating reactive oxygen species (ROS) that disrupt the redox state within cells. Concentrations of 2–3 g / L of 2-PE can completely inhibit the growth of many bacteria and fungi, and thus it is used as a bactericide in the pharmaceutical industry. Furthermore, yeast produces large amounts of ethanol during fermentation, in addition to 2-PE. The combined toxicity of ethanol and 2-PE is higher than the sum of their individual toxicities, which is the main reason for the low product concentration in the microbial transformation process for producing 2-PE and a bottleneck in the biological production of natural 2-PE. Therefore, cultivating a robust strain is necessary for more efficient 2-PE production. Tolerance-enhancing genetic engineering, such as global transcriptional mechanical engineering (GTME), evolutionary engineering, combinations of omics technologies and genetic engineering, and reverse engineering through genome-scale screening, has been applied to improve tolerance to many organic solvents, thereby contributing to economical and efficient production. While enhanced tolerance does not always lead to increased yield, various studies have shown that improved tolerance directly promotes product production.
[0004] Due to changes in genetic background, yeast strains can acquire significant tolerance to long-term exposure to high concentrations of inhibitors. Long-term adaptation is a way of mimicking natural selection caused by environmental stress. Given the complexity of the underlying molecular mechanisms associated with inhibitor tolerance, evolutionary engineering strategies have been used to enhance the fermentation capacity of yeast strains in the presence of inhibitory compounds. Comparative genomics analysis using Illumina next-generation sequencing and PacBio third-generation sequencing was performed on highly tolerant 2-PE strains obtained through a combination of multi-combination mutagenesis strategies and adaptive evolution. Based on the cellular damage pathways of 2-PE—damaging cell membrane function, affecting intracellular ATP energy metabolism, and accumulating reactive oxygen species (ROS) disrupting the intracellular redox state—suitable stress-resistance elements were screened and their performance characterized to further improve metabolic flux and stress resistance, providing more possibilities for the discovery of new stress-resistance elements. gsh It encodes glutathione synthase, which converts glycine and L-γ-glutamyl-L-cysteine into glutathione. Increased glutathione levels reduce ROS accumulation, lipid peroxidation, and cell membrane damage, thereby improving tolerance and yield of 2-phenylethanol. slc The first step in catalyzing phospholipid synthesis is the regulation of cell membrane composition, as phospholipids are an important component of cell membranes. slc Increased expression may alter the composition of cell membrane phospholipids, such as the distribution of membrane phospholipid heads (e.g., PE, PG, and CL) and the length and unsaturation percentage of phospholipid fatty acid tails (e.g., C16:0, C16:1, and C18:1), thereby improving cell membrane integrity and leading to higher 2-PE tolerance. Summary of the Invention
[0005] The primary objective of this invention is to provide a genetically engineered bacterium for the efficient synthesis of 2-phenylethanol.
[0006] To achieve the above technical objectives, the present invention adopts the following technical solution:
[0007] A genetically engineered bacterium that efficiently synthesizes 2-phenylethanol, wherein the bacterium expresses endogenous stress-resistance elements in a host bacterium. ampk , gdh , strap and tcyc and external stress-resistant elements gsh and slc get;
[0008] The endogenous stress-resistant element is derived from Pichia pastoris EA20, whose accession number is CCTCC NO: M2022053;
[0009] The exogenous anti-reverse element gsh The Gene ID is 34714842;
[0010] The exogenous anti-reverse element slc The GeneID is 5124237;
[0011] The host bacteria is Pichia pastoris EA20.
[0012] A second objective of this invention is to provide a method for constructing the aforementioned genetically engineered bacteria, comprising: constructing endogenous stress-resistance elements respectively. ampk , strap and tcyc co-expression plasmids and gdh Recombinant expression plasmids;
[0013] After linearizing the co-expression plasmid and the recombinant expression plasmid, they were introduced into the host bacteria using a yeast transformation kit to obtain a recombinant host bacteria expressing endogenous stress resistance elements.
[0014] Constructing exogenous stress-resistant elements gsh , slc The co-expression plasmid was linearized and then introduced into the recombinant host bacteria using a yeast transformation kit to obtain the genetically engineered bacteria.
[0015] As a preferred embodiment, the vector plasmid used to express endogenous and exogenous stress-resistance elements is the 113-GPD-TEF plasmid.
[0016] A third objective of this invention is to provide the application of the above-mentioned genetically engineered bacteria in the synthesis of 2-phenylethanol.
[0017] One specific application method is as follows: after seed culture of the genetically engineered bacteria, the seed liquid is inoculated into a fermentation culture for fermentation culture to synthesize 2-phenylethanol.
[0018] In a preferred embodiment, the genetically engineered bacteria use glucose as a substrate to ferment and synthesize 2-phenylethanol.
[0019] This invention combines endogenous and external stress-resistance elements to genetically engineer host bacteria, resulting in genetically engineered bacteria with high tolerance to 2-phenylethanol and high synthesis efficiency, thereby increasing the yield of 2-phenylethanol and providing a new production strain for 2-phenylethanol synthesis. Attached Figure Description
[0020] Figure 1 A schematic diagram of stress-resistance element metabolism in comparative genomic analysis.
[0021] Figure 2 These are the spot dilution control results for engineered strain E-EA20, mutant strain EA20, and original strain WT.
[0022] Figure 3The results are from shake-flask fermentation of engineered strain E-EA20, mutant strain EA20, and original strain WT to synthesize 2-PE.
[0023] Figure 4 It is an engineered strain gsh - slc Spot dilution control results of E-EA20, engineered strain E-EA20 and original strain WT.
[0024] Figure 5 It is an engineered strain gsh - slc Results of 2-PE synthesis by shake-flask fermentation of E-EA20, engineered strain E-EA20 and original strain WT.
[0025] Figure 6 It is an engineered strain gsh - slc -E-EA20 content of raw materials and products at different times in fermentation broth during fermentation scale-up experiments. Detailed Implementation
[0026] The examples used Meyerozyma guilliermondii YLG18 and Meyerozyma guilliermondii EA20 has been disclosed in the applicant's prior applications CN112442452A (accession number CCTCC NO: M 2020638) and CN114574374A (accession number CCTCC NO: M 2022053), respectively, as an anti-reverse element. ampk , tcyc , strap and gdh All of them were derived from strain EA20. The specific gene sequences were obtained by genome alignment through NCBI query and were extracted and synthesized from the genome, as shown in SEQ ID NO: 1-4.
[0027] slc Gene sequence GeneID: 5124237 gsh Gene sequence Gene ID: 34714842.
[0028] The 113 plasmid used was a gift from Professor Qi Qingsheng's research group at Shandong University and is a publicly available plasmid. The 113 (113-GPD-TEF) plasmid has the following characteristics: ori, AmpR, URA3, pGPD, tXPR2, pTEF-in, tCYC1, loxP, T7 promoter, and T3 promoter.
[0029] The culture medium used in the examples is as follows:
[0030] (1) YPD seed culture medium: yeast powder 10 g / L; peptone 20 g / L; glucose 20 g / L.
[0031] (2) LB medium: peptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L
[0032] (3) Synthetic fermentation medium (shake flask): 100 x salt (salt solution): 10 mL / L; Trace element: 1 mL / L; Tris ethanesulfonic acid: 2.292 g / L; YNB 0.5 g / L; Na2HPO4 20 g / L; trisodium citrate 10 g / L; L-phenylalanine 8 g / L; glucose 40 g / L (digested separately).
[0033] (4) Synthetic fermentation medium (fermenter): 100 x salt (salt solution): 10 mL / L; Trace element: 1 mL / L; Tris ethanesulfonic acid: 2.292 g / L; YNB 0.5 g / L; Na2HPO4 20 g / L; trisodium citrate 10 g / L; L-phenylalanine 10 g / L; glucose 60 g / L (digested separately).
[0034] 100 x salt (salt solution): NaCl 100 g / L; MgCl2·6H2O 50 g / L; KH2PO4 20 g / L; NH4Cl 30 g / L; KCl 30 g / L; CaCl2·2H2O 1.5 g / L.
[0035] (5) Trace elements Trace: HCl 25% solution, w / w) 10 mL / L; FeCl2·4H2O 1.5 g / L; CoCl2·6H2O 0.19 g / L; MnCl2·4H2O 0.1 g / L; ZnCl2 0.07 g / L; H3BO3 0.006 g / L; Na2MoO4·2H2O 0.036 g / L; NiCl2·6H2O 0.024 g / L; CuCl2·2H2O 0.002 g / L.
[0036] (6) Resistance screening solid culture medium: 1 / 1000 ampicillin; 20 g / L agar powder; the rest is the same as LB medium.
[0037] (7) hph Resistance screening medium: 0.2 g / L HPH; agar powder 20 g / L; the rest is the same as the yeast synthetic fermentation medium (shake flask).
[0038] All prepared culture media and solutions were sterilized in an autoclave at 115°C for 20 minutes. Solid cultures were prepared by pouring the culture medium into a laminar flow hood.
[0039] The measurement methods for 2-phenylethanol (2-PE) and L-phenylalanine (L-Phe) in the examples are as follows:
[0040] The concentrations of L-Phe and 2-PE in the fermentation supernatant were determined using high-performance liquid chromatography (HPLC) with an Agilent Technologies 1260 instrument. The specific method involved centrifuging the fermentation broth, diluting the supernatant by a certain factor, and filtering the diluted solution through a 0.22 µm aqueous filter membrane to remove impurities such as bacterial cells and proteins. The chromatographic column used was a C18 column (Acclaim™, 120, 5 µm, 120 Å, 4.6 × 250 mm); the mobile phase was 50% methanol and 50% pure water; the flow rate was 0.6 mL / min; the column temperature was 30 °C; the UV detection wavelength was 210 nm; and the sample injection volume was 10 µL. Standards were prepared fresh and used immediately, and a standard curve was plotted.
[0041] The dot dilution control tolerance experiment and shake-flask fermentation culture method of the engineered strains in the examples are as follows:
[0042] ① Spot dilution control tolerance test;
[0043] After the engineered strain was inoculated into YPD seed medium containing glucose and grown to the logarithmic growth phase, approximately 1 × 10⁻⁶ samples were collected. 8 Collect the cells into a 1 mL sterile centrifuge tube. After centrifugation, wash and resuspend the collected bacterial culture with 1 mL of physiological saline (0.9 mol / L) at pH 7.0, repeating the process twice. Then, transfer the washed and resuspended engineered bacterial strain to a 10-cell culture. -1 10 -2 10 -3 10 -4 10 -5 Spot dilution control tolerance experiments were conducted by dropping 1 μL of bacterial culture onto solid medium containing 0–6 g / L 2-PE at equal gradients and incubating at 30 °C for 1–2 days. The growth tolerance of the control strains was then observed.
[0044] ③ Shake-flask fermentation culture;
[0045] The engineered strain was inoculated into YPD seed medium containing glucose and grown to the logarithmic growth phase. Then, it was inoculated at a 1% inoculum into a synthetic fermentation medium with L-Phe as the sole nitrogen source to produce 2-PE. The fermentation growth and 2-PE synthesis performance were investigated. Fermentation parameters were: 50 mL shake flask volume, 30℃ fermentation temperature, 200 rpm fermentation speed, pH 5.5. 1 mL of fermentation broth was collected, centrifuged, and the supernatant was used to determine the 2-PE yield using high-performance liquid chromatography (HPLC).
[0046] The primers and sequences used in the examples are as follows:
[0047] Primer Sequence strap-F tgcagtactaaccgcagATTTAAATATGGTCTTTGGCTTTTCTACCG strap-R CATAACTAATTACATGAATTTAAATgcgcgcgcgcgcCTATCGTCCATCTTTTGTTTTC ampk-F tgcagtactaaccgcagATTTAAATgcgcgcATGAACAAGCAAGAAATATCG ampk-R CATAACTAATTACATGAATTTAAATgcgcgcgcCTACTCTATGCTATCCGTTCCC gdh-F tgcagtactaaccgcagATTTAAATATGTCTGACTTCTGGATCGAC gdh-R CATAACTAATTACATGAATTTAAATgcgcgcgcCTATTTTGCAGCAGCAGAGCC tcyc-F tgcagtactaaccgcagATTTAAATATGTCTACATTCTACGGACGG tcyc-R GCGTGACATAACTAATTACATGAATTTAAATTTAATTTTCGATTCCAGAGCCCGAGCCGCGC gsh-YL-F cacatcaacaATGACGTTCCAAGAGAAAATCAAA gsh-YL-R catggaggtacCTAATCCACAAGGTAAACACCATCA slc-MG-F acaATGACTCCCACTTCACCAAATGC slc-MG-R caggccatggaggtacTTAATTCTCTCCATTACCTTCCTCTTC ITS1 TCCGTAGGTGAACCTGCGG ITS4 T CCTCCGCTTATTGATATGC Example
[0048] This embodiment specifically illustrates the recombinant engineered strain. gsh - slc -E-EA20 construction method.
[0049] (1) Comparative genomic analysis of strains EA20 and YLG18 using Illumina second-generation sequencing and PacBio third-generation sequencing ( Figure 1 Four potential stress-resistance elements were screened for the 2-PE damage cellular pathway and their functions were analyzed. The results showed that the regulatory genes... strap Regulates cell membrane phospholipid and glycerol composition, promotes endocytosis, and enhances the integrity of the Pichia pastoris cell membrane; synthesizes genes. gdh Increasing glutathione levels in the strain, converting glutamate into α-ketoglutarate (α-KG), an intermediate in the TCA cycle, and accelerating the regulation of the tricarboxylic acid cycle enhances the strain's metabolic activity; synthetic genes ampk Accelerating glycolysis promotes ATP synthesis and enhances cellular metabolic activity; transport genes ABC transport proteins tcyc It regulates the function of membrane proteins and the energy regulation within the cell membrane, thereby regulating membrane permeability.
[0050] The above four differentially expressed genes with potential stress resistance: tcyc , gdh , ampk , strap As a gene for the next step of metabolic engineering, it will be integrated into the genome of the mutant strain EA20 to improve the stress resistance of strain EA20 (see subsequent steps for details).
[0051] (2) Construction of recombinant plasmids for stress resistance elements
[0052] The genome of *Pichia pastoris* EA20 was extracted using a yeast genomic DNA extraction kit. Using the genome as a template, four pairs of primers were used... strap F / R, ampk F / R,gdh F / R, tcyc F / R amplified four stress-resistant elements with homologous arms of the pTEF promoter and tCYC1 terminator at both ends. strap , ampk , gdh , tcyc , will have filter tags hph Gene plasmid 113- hph The vector plasmid was linearized by digestion with the restriction endonuclease Swal. The linearized vector plasmid was then ligated and integrated with the target gene, which has homologous arms at both ends corresponding to promoters and terminators, using a one-step cloning and transformation kit to obtain a new plasmid, which was then transformed into competent E. coli cells. DH5α The plasmid was plated on LB selection plates containing ampicillin resistance (100 mg / L). Positive clones were selected for PCR verification and further sequencing verification. The resulting recombinant plasmid was named 113-GPD-TEF- hph - ampk 113-GPD-TEF- hph - strap 113-GPD-TEF- hph - tcyc and 113-GPD-TEF- hph - gdh .
[0053] With 113-GPD-TEF- hph - strap For example, the specific construction steps are as follows:
[0054] Using primers strap F / R amplification produces stress-resistant elements with homologous arms of the pTEF promoter and tCYC1 terminator at both ends. strap , will have filter tags hph Gene plasmid 113- hph Linearization was achieved by digestion with the restriction endonuclease Swal; the linearized vector plasmid was then coupled with the target gene containing homologous arms of the corresponding promoter and terminator at both ends. strap A new plasmid was obtained by ligation and integration using a one-step cloning and transformation kit. The resulting plasmid was named 113-GPD-TEF- hph - strap Similarly, the remaining recombinant plasmids were obtained and named 113-GPD-TEF- hph - ampk 113-GPD-TEF- hph - tcyc and 113-GPD-TEF- hph - gdh .
[0055] (3) Construction of engineered strain E-EA20
[0056] Because when four genes are co-expressed on a single plasmid, too many bp in the bands can easily lead to deletions and other problems. Based on gene length, the expression method in this embodiment is as follows: first, […]. ampk , ampk , strap Three genes are co-expressed. gdh Expressed alone.
[0057] a. Construction of recombinant plasmids co-expressing stress resistance elements
[0058] With plasmid 113-GPD-TEF- hph - tcyc Using the template, the target fragment was obtained by PCR amplification using primers ampk F / R. ampk Plasmid 113-GPD-TEF- was digested with the restriction endonuclease Pme I. hph - tcyc Linearize it; use a one-step cloning transformation kit to transform the linear plasmid vector 113-GPD-TEF- hph - tcyc With the target segment ampk The new plasmid was obtained by ligation and integration and then transformed into competent E. coli cells. DH5α The plasmid was plated on LB selection plates containing ampicillin resistance (100 mg / L), and positive clones were selected for PCR and sequencing verification to obtain plasmid 113-GPD-TEF- hph - tcyc - ampk The recombinant plasmid 113-GPD-TEF- was obtained by digestion with the restriction endonuclease SmaI, following the same procedure described above. hph - tcyc - ampk - strap .
[0059] b. Co-expression plasmid 113-GPD-TEF- hph - tcyc - ampk - strap and recombinant plasmid 113-GPD-TEF- hph - gdh Linearization was performed using the restriction endonuclease Not I, and the linear DNA fragment was integrated into the EA20 yeast genome using yeast transformation, as follows:
[0060] Yeast conversion methods:
[0061] Yeast conversion was performed using the Frozen-EZ yeast conversion kit manufactured by ZYMO RESEARCH, USA. The procedure is as follows:
[0062] 1. Inoculate Pichia pastoris EA20 into YPD test tubes and incubate at 30 ℃ and 200 rpm for 2-4 h until OD is reached. 600 It reaches 0.8~1.0.
[0063] 2. Take 10 mL of seed culture, centrifuge at 500 g for 4 min, collect the bacterial sludge, and discard the supernatant.
[0064] 3. Add 10 mL of EZ 1 solution to resuspend the bacterial sludge, centrifuge again, and discard the supernatant.
[0065] 4. Add 1 mL of EZ 2 solution to resuspend the bacterial sludge.
[0066] 5. Aliquot 50 μL of competent cells into each tube and proceed directly to the next transformation step, or wrap the cells in 2-6 layers of paper and store them in a -80 ℃ freezer for 6 months.
[0067] 6. Add 0.2-1 μg DNA (maximum 5 μL) to 50 μL of freshly prepared or thawed competent cells, then add 500 μL of EZ3 solution and mix thoroughly.
[0068] 7. Incubate the above mixture at 30 °C for 45 min, and use a vortex mixer to thoroughly mix the incubation system every 10 min.
[0069] 8. Pipette 50-150 μL of the above conversion solution onto a prepared hygromycin B resistance screening plate and spread it on the plate.
[0070] 9. Incubate in a 30 ℃ incubator for 2-4 days.
[0071] The co-expression plasmid 113-GPD-TEF- hph - tcyc - ampk - strap After the linear DNA fragment was integrated into the EA20 yeast genome, it was plated on a 0.2 g / L HPH resistance selection plate and cultured for 2-3 days. Positive clones were selected for PCR verification. The correctly verified clones were inoculated into YPD tubes and cultured overnight. The genome was then extracted for sequencing verification. The successfully constructed recombinant engineered strain EA20- was obtained. tcyc - ampk - strap The plasmid 113- constructed above hph-gdh Linearization was performed using the restriction endonuclease Not I to obtain the linear target fragment. The linear DNA fragment was then integrated into the engineered strain EA20- using the yeast transformation method described above. tcyc - ampk - strapThe genome was plated on a selection plate with a higher concentration of hygromycin B resistance (0.4 g / L HPH), cultured for 2-3 days, and positive clones were selected for PCR verification. The verified clones were inoculated into YPD tubes and cultured overnight. The genome was extracted and sequenced for verification, and finally the successfully constructed engineered strain E-EA20 was obtained.
[0072] (4) Construction of recombinant plasmids for exogenous stress resistance elements
[0073] The genomes of *Pichia pastoris* (MG) and *Yardia lactis* (YL) were extracted using a yeast genomic DNA extraction kit. Using the genomes as templates, two pairs of primers were used... gsh - YL F / R, slc - MG F / R amplified two target genes with homologous arms of the pGPD promoter and txpr2 terminator at both ends. gsh - YL , gslc - MG The above-constructed filter tag hph Gene plasmid 113- hph The vector plasmid was linearized by digestion with the restriction endonuclease SmaI. The linearized vector plasmid was then ligated and integrated with the target gene, which has homologous arms at both ends corresponding to promoters and terminators, using a one-step cloning and transformation kit to obtain a new plasmid, which was then transformed into competent E. coli cells. DH5α In this process, the plasmids were plated on LB selection plates containing ampicillin resistance (100 mg / L). Positive clones were selected for PCR verification and further sequencing verification. The successfully constructed recombinant plasmids carrying the target gene were named 113-GPD-TEF- hph - gsh -YL and 113-GPD-TEF - hph - slc -MG.
[0074] With 113-GPD-TEF- hph - gsh Taking YL as an example, the specific construction method of the recombinant plasmid is as follows:
[0075] use gsh - YL F / R amplification yielded the target gene containing the pGPD promoter and the homologous arm of the txpr2 terminator. gsh - YL The above-constructed filter tag hph Gene plasmid 113- hphLinearization was achieved by digestion with the restriction endonuclease Sma I. The linearized vector plasmid was then ligated and integrated with the target gene, which has homologous arms at both ends corresponding to the promoter and terminator, using a one-step cloning and transformation kit to obtain a new plasmid. The resulting plasmid containing the target gene was then... gsh - YL The recombinant plasmid was named 113-GPD-TEF- hph - gsh -YL. Following the same procedure, other recombinant plasmids were obtained, named 113-GPD-TEF- hph - slc -MG.
[0076] (5) Construction of recombinant plasmids co-expressing exogenous stress resistance elements
[0077] With plasmid 113-GPD-TEF- hph - slc - MG Using primers as templates slc - MG F / R was used for PCR amplification to obtain the target fragment. slc - MG Plasmid 113-GPD-TEF- was digested with the restriction endonuclease Pme I. hph - gsh - KM Linearize it; use a one-step cloning transformation kit to transform the linear plasmid vector 113-GPD-TEF- hph - gsh - KM With the target segment slc - MG The new plasmid was obtained by ligation and integration and then transformed into competent E. coli cells. DH5α In this process, the sample was plated on LB selection plates containing ampicillin resistance (100 mg / L), and positive clones were selected for PCR and sequencing verification, yielding clones with 113-GPD-TEF- hph - gsh - KM as a carrier , Recombination of Target Fragments slc - MG The recombinant plasmid was named 113-GPD-TEF-. hph - gsh - slc .
[0078] (6) Engineered strains gsh - slc -E-EA20 construction:
[0079] The plasmid 113-GPD-TEF- constructed above hph -gsh - slc Linearization was performed using the restriction endonuclease Not I to obtain the linear target fragment. The 113-GPD-TEF- fragment was then transformed into a linear target fragment using the yeast transformation method described in step (3). hph - gsh - slc The linear DNA fragment was integrated into the genome of the engineered strain E-EA20, plated on a resistance selection plate with a higher concentration of hygromycin B (0.6 g / L HPH), and cultured for 2-3 days. Positive clones were selected for PCR verification. The correctly verified clones were inoculated into YPD tubes and cultured overnight. The genome was then extracted for sequencing verification. The successfully constructed final recombinant engineered strain was obtained. gsh - slc -E-EA20. Example
[0080] This embodiment describes the performance characterization method and results of the engineered strain E-EA20, which is used to construct stress-resistant elements.
[0081] Engineered strain E-EA20, mutant strain EA20, and original strain WT (YLG18) were serially diluted and then dropped into 1 μL solutions on solid plates containing 3–6 g / L 2-PE. The solutions were incubated at 30 °C for 1–2 days. The growth of the bacterial solutions at different dilutions on plates with varying 2-PE concentrations visually demonstrated the further improvement in the engineered strain's tolerance to 2-PE. According to the strain tolerance analysis method, the original strain WT could only survive at 10% of its concentration diluted to 3 g / L 2-PE. -1 Dilute 10 g / L of the surviving bacterial culture on 4 g / L 2-PE plates. 0 The mutant strain EA20 could not survive on a 5 g / L 2-PE plate. However, the mutant strain was able to grow and survive at 10 times the concentration of the diluted culture on a 5 g / L 2-PE plate. -3 It can also grow to 10 times the strain dilution on 6 g / L 2-PE plates. -2 However, E-EA20 was able to grow and survive bacterial cultures diluted at 5 g / L on 2-PE plates for 10 times the normal volume. -5 It can also grow to 10 times the strain dilution on 6 g / L 2-PE plates. -4 Results from spot dilution control ( Figure 2 The results indicate that the characterization of the four stress-resistance elements further improved the strain's tolerance to 2-PE.
[0082] Performance analysis of 2-PE synthesis by shake-flask fermentation of engineered strain E-EA20, mutant strain EA20 and original strain WT ( Figure 3E-EA20, EA20, and WT all reached stable growth at 48 hours, but E-EA20 had a higher biomass than EA20 and WT. OD at 48 hours... 600 The WT strain reached a biomass of 36 g / L, a 21% increase compared to EA20. After 72 hours, strain WT began to undergo apoptosis, at which point the 2-PE synthesis yield reached 2.25 g / L, and then ceased to increase. EA20, due to its improved tolerance to 2-PE, continued stable growth and metabolism after 72 hours. At 120 hours, the OD... 600 It could grow to 37°C, with a 2-PE yield of 3.15 g / L. E-EA20 showed no signs of apoptosis in the later stages of fermentation, exhibiting slow but increasing growth and more vigorous metabolism. At 120 h OD... 600 It was able to grow to 42°C, and the 2-PE yield reached 3.658 g / L, which was 62.6% higher than that of WT. This shows that the growth performance and 2-PE synthesis efficiency of the engineered strain E-EA20 have been further improved. Example
[0083] This embodiment uses engineered strains. gsh - slc Performance characterization methods and results of -E-EA20.
[0084] The engineered bacterial strain was diluted according to a certain gradient and then dropped into 1 μL of bacterial solution onto a solid plate containing 3-6 g / L 2-PE. The plates were incubated at 30 ℃ for 1-2 days. The growth of bacterial solutions at different dilution gradients on plates with different concentrations of 2-PE can visually demonstrate the strain's tolerance to 2-PE. Figure 4 According to the method for analyzing the tolerance of engineered strains, WT can only grow and survive at 10% of the diluted bacterial suspension on a 3 g / L 2-PE plate. -1 Dilute 10 g / L of the surviving bacterial culture on 4 g / L 2-PE plates. 0 The strain could not survive on 5 g / L 2-PE plates. The original strain E-EA20 was able to grow and survive at 10 times the concentration of the diluted culture on 5 g / L 2-PE plates. -5 It can also grow to 10 times the strain dilution on 6 g / L 2-PE plates. -4 .but gsh -slc-E-EA20 can be diluted to 10 g / L on 2-PE plates to grow and survive bacterial cultures. -5 Furthermore, the biomass grown on 5 g / L 2-PE plates exceeded that of E-EA20. Spot dilution control results indicated that the characterization of exogenous stress-resistance elements further enhanced the strain's tolerance to 2-PE.
[0085] Further verification was conducted on the enhancement of 2-PE synthesis performance by exogenous stress-resistant elements and the effects on engineered strains. gsh -slc The fermentation performance of E-EA20, E-EA20 and the original strain WT was compared and verified. Figure 5 Compared to E-EA20, which only reaches a logarithmic growth phase of 48 hours followed by stable and slow growth, the engineered strain gsh-slc-E-EA20 exhibits a logarithmic growth phase extended to 84 hours in shake flasks, and no apoptosis was observed within 120 hours. E-EA20 showed no apoptosis in the later stages of fermentation, exhibiting slow and increasing growth, with an OD of [value missing] at 120 hours. 600 It can grow to 42, and the yield of 2-PE reaches 3.658 g / L, but the growth OD of the engineered strain gsh-slc-E-EA20 is... 600 It can reach 47.8, with higher biomass accumulation. The 2-PE yield of gsh-slc-E-EA20 is around 4.05 g / L, which is 11% higher than E-EA20 and 62.6% higher than WT. Example
[0086] This embodiment illustrates engineered bacterial strains. gsh - slc -Fermentation effect of E-EA20 in fermenter scale-up system.
[0087] Scale-up fermentation using fermenters allows for better control of various fermentation system conditions, such as constant pH, increased dissolved oxygen, and continuous feeding, which is more conducive to the cultivation of *Pichia pastoris* and the synthesis of 2-PE. For engineered strains... gsh - slc -E-EA20 was used for fermenter scale-up experiments to further improve the synthesis efficiency of 2-PE. The experimental conditions were: fermentation temperature 30℃, pH constant at 5.5, fermentation system 2L, and aeration rate controlled at 2vvm.
[0088] The results are as follows Figure 6 As shown, engineered strains gsh - slc -E-EA20 reaches its stable growth period within 60-72 hours, OD 600 The growth rate reached 82%, the growth cycle was shortened, and the growth rate was increased, with a 2-PE yield of approximately 5.7 g / L. The results show that, unlike shake-flask fermentation, in the fermenter, due to the fed-batch fermentation strategy, the glucose consumption rate, strain growth rate, substrate consumption rate, and product synthesis rate were all faster in the early stages of fermentation, and the fermentation cycle of the strain was significantly shortened.
Claims
1. A genetically engineered bacterium for efficient synthesis of 2-phenylethanol, characterized by, The genetically engineered bacteria are obtained by expressing endogenous stress resistance elements amino acid , gdh , strap and tcyc and exogenous stress resistance elements gsh and slc in a host bacteria The endogenous stress resistance element is derived from Pichia guilliermondii EA20, which has a preservation number of CCTCC NO: M 2022053. the exogenous stress resistance element gsh Gene ID 34714842; the exogenous stress resistance element slc GeneID is 5124237; The host strain is Pichia guilliermondii EA20.
2. The method for constructing the genetically engineered bacteria according to claim 1, characterized in that, comprising Constructing a co-expression plasmid of endogenous stress resistance elements amino acid , strap and tcyc and a recombinant expression plasmid of gdh ; After linearizing the co-expression plasmid and the recombinant expression plasmid, the plasmids are introduced into the host strain by a yeast transformation kit to obtain a recombinant host strain expressing the endogenous stress resistance element; Construction of exogenous stress resistance elements gsh , slc The co-expression plasmid of the exogenous stress resistance elements is linearized and introduced into the recombinant host strain by a yeast transformation kit to obtain the genetically engineered strain.
3. The genetically engineered strain of claim 1 is applied in the synthesis of 2-phenylethanol.
4. Use according to claim 3, characterized in that, The genetically engineered strain is subjected to seed culture to obtain a seed liquid, and the seed liquid is inoculated into a fermentation medium for fermentation culture to obtain 2-phenylethanol.
5. Use according to claim 3, characterized in that, The genetically engineered strain ferments glucose as a substrate to synthesize 2-phenylethanol.
Citation Information
Patent Citations
Bacterial strain for producing 2-phenethyl alcohol and application thereof
CN114574374A
Bacterial strain for producing 2-phenethyl alcohol and application thereof
CN112442452A
Method for producing 2-phenethyl alcohol by utilizing mixed bacteria fermentation
CN112538504A