Kit and method for rapid detection of Vibrio parahaemolyticus based on LAMP-CRISPR / Cas12b integrated system

通过LAMP-CRISPR/Cas12b一体化体系,结合特异性LAMP引物和Cas12b酶,解决了现有技术中副溶血性弧菌检测的灵敏度低和非特异性扩增问题,实现了简便、快速、精准的食品安全检测。

CN116837125BActive Publication Date: 2025-07-08SHANGHAI VETERINARY RESEARCH INSTITUTE CAAS (CHINESE ANIMAL HEALTH & EPIDEMIOLOGY CENTER SHANGHAI BRANCH)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311039454.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-17
Publication Date
2025-07-08
Estimated Expiration
2043-08-17

AI Technical Summary

Technical Problem

The prior art has low sensitivity and non-specific amplification problems in rapid detection of Vibrio parahaemolyticus, and requires expensive instruments and equipment, which are not suitable for on-site testing and are difficult to meet the needs of food safety monitoring.

Method used

The integrated LAMP-CRISPR/Cas12b system is adopted to design specific LAMP primers and sgRNA-guided Cas12b enzymes, isothermal amplification and CRISPR cleavage in the same reaction system, and detection is combined with ssDNA fluorescent probes to achieve high specificity and high sensitivity detection.

Benefits of technology

It realizes rapid, simple and accurate detection of Vibrio parahaemolytic in an isothermal environment of 60℃, with a sensitivity of up to 37CFU/mL, which is suitable for on-site detection and reduces dependence on large-scale laboratory instruments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116837125B_ABST
    Figure CN116837125B_ABST
Patent Text Reader

Abstract

The present invention relates to a kit and method for rapidly detecting Vibrio parahaemolyticus based on an integrated LAMP-CRISPR / Cas12b system, including LAMP primers, sgRNA guiding sequences, Cas12b enzymes, and ssDNA fluorescent probes. The present invention has the following advantages: The kit for visual detection of Vibrio parahaemolyticus first performs LAMP amplification on the sample to be tested. Under the mediation of the sgRNA guiding sequence, the CRISPR-Cas12b system recognizes, binds to, and cleaves the target double-stranded DNA of the LAMP amplification product, and activates the non-specific nuclease function. Then, it arbitrarily cleaves the ssDNA fluorescent probe in the system to obtain cleavage products. Finally, by detecting the fluorescence signal of the cleavage products, or using a colloidal gold test strip to visually detect whether there is a cleaved FAM group in the reaction system for judgment. The LAMP-CRISPR / Cas12b technology for detecting Vibrio parahaemolyticus in the present invention specifically detects Vibrio parahaemolyticus through double specificity of LAMP amplification and sgRNA recognition, has strong specificity, and can be as low as 37 CFU / mL in sensitivity, and can rapidly detect Vibrio parahaemolyticus contaminated on food on-site.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a technology for rapid detection of Vibrio parahaemolyticus by isothermal amplification of target genes and CRISPR / Cas12b-specific cleavage, and a corresponding detection kit. Background Art

[0002] Vibrio parahaemolyticus is a Gram-negative, halophilic bacterium widely distributed in marine environments and seafood such as fish, shrimp, and shellfish. It is a common pathogen in aquaculture. The primary sources of food poisoning caused by V. parahaemolyticus are seafood (fish, shrimp, crab, shellfish, and their products), but it can also be detected in significant quantities in freshwater products. V. parahaemolyticus food poisoning often occurs in summer and autumn, with an acute onset and a short incubation period. Symptoms primarily include typical gastroenteritis, such as diarrhea, intestinal cramps, nausea, vomiting, and fever. Severe cases can lead to sepsis. V. parahaemolyticus is a global disease, with a particularly high incidence in coastal areas. In coastal cities in my country, V. parahaemolyticus now accounts for the largest proportion of bacterial food poisoning incidents, surpassing Salmonella, diarrheagenic Escherichia coli, and Staphylococcus aureus. Therefore, rapid and accurate detection of Vibrio parahaemolyticus in seafood and other foods is crucial for controlling and preventing the spread of this bacterium in aquatic products and aquaculture environments, and for safeguarding food safety and public health. Vibrio parahaemolyticus is a key component of food safety monitoring, food poisoning source investigations, and inbound and outbound aquatic product testing in my country.

[0003] Conventional PCR, nested PCR, semi-nested PCR, and fluorescent quantitative PCR have been established and developed for the detection of V. parahaemolyticus both domestically and internationally, continuously improving detection sensitivity and accuracy. The current national food safety standard for detecting foodborne V. parahaemolyticus, Food Microbiology Test - Vibrio parahaemolyticus (GB 4789.7-2013), is the gold standard for detecting V. parahaemolyticus in my country. This method is based on bacterial culture and involves the following steps: sample preparation, enrichment, isolation, pure culture, preliminary identification, definitive identification, serological testing (optional), and the Kanagawa test (optional). The procedure is cumbersome and the test cycle is long (total testing time is 48-120 hours). In the inspection of imported and exported food in my country, there are five standards for Vibrio parahaemolyticus detection, all of which use molecular biological detection methods different from the traditional culture method of GB 4789.7-2013. They are: SN / T 1869-2007 "Rapid Detection Method for Multiple Pathogenic Bacteria in Foods - PCR Method", SN / T2424-2010 "Rapid and Identification Detection Method for Vibrio parahaemolyticus in Imported and Exported Foods - Real-time Fluorescence PCR Method", SN / T2754.5-2011 "Loop-Mediated Isothermal Amplification (LAMP) Detection Method for Pathogenic Bacteria in Exported Foods - Part 5: Vibrio parahaemolyticus", SN / T4603-2016 "Detection Method for Common Pathogenic Genes of Toxigenic Vibrio parahaemolyticus in Exported Foods and Water - Multiplex PCR and Multiplex Real-time Fluorescence PCR", and SN / T5364.1-2021 "Detection Method for Pathogenic Bacteria in Exported Foods - Droplet Digital PCR Method - Part 1: Vibrio parahaemolyticus". The PCR and fluorescent quantitative PCR methods involved here require relatively expensive instruments and are carried out in the laboratory, making them unsuitable for rapid on-site testing. In addition, in most cases, the number of Vibrio parahaemolyticus contaminating food may be small, requiring bacterial enrichment. However, the PCR method has low detection sensitivity. If the number of contaminated bacteria in food is low, the detection limit will not be reached after bacterial enrichment, resulting in missed detection.

[0004] Isothermal amplification techniques (such as LAMP, RPA, and RAA) are currently attracting significant attention for the rapid detection of pathogenic microorganisms due to their advantages, including short detection time, high sensitivity (e.g., studies have shown that LAMP can be 100-10,000 times more sensitive than conventional PCR), good specificity, and the lack of expensive instrumentation (a constant-temperature water bath or metal bath is sufficient). They have been used for the rapid detection of foodborne pathogens (such as Salmonella and Vibrio parahaemolyticus) and viruses (such as the novel coronavirus SARS-CoV-2). Because the number of Vibrio parahaemolyticus contaminating food may be low, isothermal amplification techniques such as LAMP and RPA, which are highly sensitive and suitable for rapid on-site detection, are the preferred choice for developing related detection methods. Furthermore, due to the high incidence of nonspecific amplification (false positives) during LAMP and RPA testing, and the lack of means to further confirm positive samples, this issue has become a significant obstacle to the commercialization of these research results.

[0005] Chinese patent CN105219845A discloses a dual LAMP detection method and primer set for simultaneous detection of Vibrio parahaemolyticus and Vibrio vulnificus. Although the LAMP detection method based on the ompA target gene in this patent can rapidly detect Vibrio parahaemolyticus, it does not address the nonspecific amplification problem associated with highly sensitive isothermal amplification technology. The industry standard SN / T2754.5-2011, which uses the LAMP method to detect Vibrio parahaemolyticus, also carries the potential for nonspecific amplification. The CRISPR-Cas system, derived from the adaptive immunity of microorganisms, has been widely used in the field of genome editing due to its ease of use and stability. The CRISPR / Cas12a system belongs to the V-type CRISPR-Cas system. Cas12a nuclease recognizes the PAM-side DNA target sequence that is complementary to the CRISPR RNA (crRNA) spacer. Therefore, some researchers have combined LAMP and Cas12a to detect Vibrio parahaemolyticus. However, since the enzymes in the LAMP and CRISPR reactions work at different temperatures (Bst DNA polymerase: 60-65°C; Cas12a: 37°C), the reagents for the CRISPR reaction must be added after the LAMP reaction. Some researchers have taken measures such as adding soluble polyvinyl alcohol membranes as automatic valves to avoid this problem (Yang T, et al. Biosensors (Basel). 2023, 13(1): 111), but the reliability of the results obtained by this treatment needs further verification, and it also increases the complexity of the experimental operation. Therefore, it is urgent to provide a detection method and corresponding detection kit that has the high sensitivity of LAMP or RPA isothermal amplification technology, short detection time (fast), simple operation, and does not require expensive instruments and equipment (suitable for on-site detection); and can also achieve accurate detection (high specificity). The Cas12b family is a class of nucleases mediated by crRNA and tracrRNA (or modified fusion sgRNA). In addition to its specific "cis-cleavage activity" against dsDNA or ssDNA targets, Cas12b forms a ternary complex with sgRNA and target DNA, which also activates its "trans-cleavage activity" against ssDNA, allowing it to non-specifically cleave ssDNA in the system. Cas12b has good heat resistance and can be used in conjunction with LAMP to achieve one-step rapid nucleic acid detection. Summary of the Invention

[0006] The purpose of the present invention is to overcome the above-mentioned defects and deficiencies in the prior art and to provide a simple, rapid, highly sensitive and accurate kit for detecting Vibrio parahaemolyticus.

[0007] In order to solve the above technical problems, the technical solution provided by the present invention is:

[0008] A kit for rapid detection of Vibrio parahaemolyticus based on the LAMP-CRISPR / Cas12b integrated system, comprising LAMP primers, sgRNA guide sequences, Cas12b enzymes, and ssDNA fluorescent probes.

[0009] The nucleotide sequence of the LAMP primer is:

[0010] F3:5'-AACTACTTCCCAACTCGC-3', B3:5'-CTCCACTCGAACCAAACT-3';

[0011] FIP: 5'-CGATATTGTCCGAAAGGAAATTCGAAGATTTGGTTGATGAAGTTCTCA-3';

[0012] BIP: 5'-CTAGACATACACGCTCGTGAAAACCAGTGACAATCTTGGCTTA-3';

[0013] The sgRNA guide sequence is:

[0014] 5'-GUCUAGAGGACAGAAUUUUUCACGGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGC CCGUUGAACUUCAAGCGAAGUGGCACACGAGCGUGUAUGUCUAGGUCGA-3'.

[0015] Preferably, the ssDNA fluorescent probe is a single-stranded nucleotide sequence labeled with FAM or FITC at the 5' end and BHQ1 at the 3' end, or a single-stranded nucleotide sequence labeled with FAM or FITC at the 5' end and Biotin at the 3' end.

[0016] Preferably, the nucleotide sequence of the ssDNA fluorescent probe is 5'-FAM-TTTTTT-BHQ1-3', 5'-FITC-TTTTTT-BHQ1-3', or 5'-FAM-TTTTTT-Biotin-3'.

[0017] Preferably, the visual detection kit comprises a colloidal gold detection test strip; the colloidal gold conjugate pad contains a colloidal gold-labeled anti-FAM antibody, and the chromatographic membrane is provided with a detection line T and a quality control line C, the detection line T is coated with an anti-mouse antibody, and the quality control line C is coated with Biotin's ligand streptavidin.

[0018] Preferably, the positive control Vibrio parahaemolyticus ATCC17802 strain genomic DNA and the negative control Escherichia coli DH5a genomic DNA are also included.

[0019] The present invention also provides use of any of the above-mentioned kits in visual detection of Vibrio parahaemolyticus.

[0020] A method for visually detecting Vibrio parahaemolyticus comprises the following steps:

[0021] S1, extracting genomic DNA of the sample to be tested;

[0022] S2. Using the DNA in step S1 as a template, LAMP primers were added to a reaction system to perform a LAMP isothermal amplification reaction. At the same time, AapCas12b enzyme, sgRNA, and ssDNA fluorescent probe were added to the reaction system to perform a Cas12b-based CRISPR cleavage reaction, so that LAMP isothermal amplification and CRISPR cleavage reactions were carried out simultaneously in one reaction system, with LAMP amplification and CRISPR cleavage at the same time.

[0023] S3. Determination of test results: Place the reaction tube in an instrument capable of simultaneously performing a constant temperature reaction and detecting fluorescence signals. The test results can be determined by collecting the fluorescence signals in the reaction system and analyzing the fluorescence signal curves at different time points. Alternatively, place the reaction tube in a constant temperature water bath or a constant temperature metal bath, and after the reaction is completed, detect the fluorescence signal with a handheld UV lamp. Alternatively, the reaction product obtained in S2 can be colorimetrically detected using colloidal gold test strips. If a red band appears on the test line of the sample to be tested, or if a red band appears on both the test line of the sample to be tested and the quality control line of the negative sample, Vibrio parahaemolyticus has been detected in the sample to be tested. If no red band appears on the test line, but a red band appears on the quality control line, Vibrio parahaemolyticus has not been detected in the sample to be tested.

[0024] Preferably, the reaction system of step S2 is: 0.2 μM of each F3 / B3 primer, 1.6 μM of each FIP / BIP primer, 6 mM MgSO4, 5 μl 10×Isothermal Amplification Buffer II, 320 units / mL Bst 3.0 DNA Polymerase, 50 nM AapCas12b enzyme, 50 nM sgRNA, 250 nM ssDNA, DNA template 5.0 μL, ddH20 is added to 50 μL, mixed and reacted at 60°C for 40-60 minutes.

[0025] Preferably, the reaction tube in step S2 can simultaneously perform constant temperature reaction and fluorescence signal detection; or react in a 60°C water bath or metal bath for 40-60 minutes, and then observe the results under a handheld ultraviolet lamp, or use colloidal gold test strips for color development and visual detection.

[0026] Compared with the prior art, the present invention has the following advantages:

[0027] The kit for visual detection of Vibrio parahaemolyticus of the present invention first performs LAMP amplification on the sample to be tested, and then, under the mediation of the sgRNA guide sequence, guides the CRISPR / Cas12b system to recognize, bind and cut the target double-stranded DNA of the LAMP amplification product, and activates the non-specific nuclease function, and then arbitrarily cuts the ssDNA fluorescent probe in the system to obtain the sheared product, and finally judges by the fluorescence signal detection of the sheared product. The LAMP-CRISPR / cas12b technology for detecting Vibrio parahaemolyticus of the present invention detects Vibrio parahaemolyticus with dual specificity through LAMP amplification and sgRNA recognition, with strong specificity and sensitivity as low as 37 CFU / mL, which can detect infection with Vibrio parahaemolyticus earlier and prevent and treat it. The kit in the present invention has the characteristics of low cost, convenient operation, less time consuming, high sensitivity and strong specificity. The detection reaction is carried out under an isothermal environment of 60°C throughout the whole process, which can effectively break away from the dependence on large laboratory instruments.

[0028] The above summary is for illustrative purposes only and is not intended to be limiting in any way. In addition to the illustrative aspects, embodiments and features described above, further aspects, embodiments and features of the present invention will be readily apparent by reference to the full text and detailed description below. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is a flow chart of the present invention for visual detection of Vibrio parahaemolyticus based on the LAMP-CRISPR / Cas12b system;

[0030] Figure 2 This is a graph showing the specificity experimental results of the Vibrio parahaemolyticus LAMP assay of the present invention;

[0031] Figure 3 This is a diagram for screening sgRNA for the opaR gene of Vibrio parahaemolyticus of the present invention;

[0032] Figure 4 This is a graph showing the sensitivity test results of the LAMP-CRISPR / Cas12b one-step method for detecting Vibrio parahaemolyticus of the present invention;

[0033] Figure 5 This is a graph showing the specificity analysis results of the LAMP-CRISPR / Cas12b one-step method for detecting Vibrio parahaemolyticus.

[0034] Figure 6 This is a graph showing the test results of a lateral flow test strip for detecting Vibrio parahaemolyticus using the LAMP-CRISPR / Cas12b one-step method of the present invention. DETAILED DESCRIPTION

[0035] Specific embodiments of the present invention will now be mentioned in detail. Although the present invention is described in conjunction with these specific embodiments, it should be appreciated that the present invention is not intended to be limited to these specific embodiments. On the contrary, these embodiments are intended to cover substitutions, changes or equivalent embodiments that may be included in the spirit and scope of the invention defined by the claims. In the following description, a large amount of specific details have been set forth to provide a comprehensive understanding of the present invention. The present invention can be implemented without some or all of these specific details. In other cases, in order not to unnecessarily obscure the present invention, well-known process operations have not been described in detail.

[0036] When used in conjunction with "including," "methods comprising," or similar language in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0037] The present invention will be described in further detail below in conjunction with the full text.

[0038] In conjunction with the full text, the first purpose of the present invention is to provide a simple, rapid, highly sensitive and accurate method for detecting Vibrio parahaemolyticus.

[0039] The second object of the present invention is to provide the use of the kit in visual detection of Vibrio parahaemolyticus.

[0040] The third object of the present invention is to provide a kit for visually detecting Vibrio parahaemolyticus.

[0041] The above-mentioned object of the present invention is to achieve the technical solution of completing detection in the same reaction system and at the same reaction temperature by combining LAMP isothermal amplification and CRISPR-specific cleavage based on heat-resistant Cas12b. The specific scheme is as follows:

[0042] A kit for rapid detection of Vibrio parahaemolyticus based on the LAMP-CRISPR / Cas12b integrated system, comprising LAMP primers, sgRNA guide sequences, Cas12b enzymes, and ssDNA fluorescent probes.

[0043] The nucleotide sequence of the LAMP primer is:

[0044] F3:5'-AACTACTTCCCAACTCGC-3', B3:5'-CTCCACTCGAACCAAACT-3';

[0045] FIP: 5'-CGATATTGTCCGAAAGGAAATTCGAAGATTTGGTTGATGAAGTTCTCA-3';

[0046] BIP: 5'-CTAGACATACACGCTCGTGAAAACCAGTGACAATCTTGGCTTA-3';

[0047] The sgRNA guide sequence is:

[0048] 5'-GUCUAGAGGACAGAAUUUUUCACGGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGC CCGUUGAACUUCAAGCGAAGUGGCACACGAGCGUGUAUGUCUAGGUCGA-3'.

[0049] The present invention designs specific LAMP amplification primers for the conserved region of the opaR gene DNA sequence in the Vibrio parahaemolyticus genome, and prepares the sgRNA guide sequence by reverse transcription and purification; by first performing LAMP amplification on the target DNA in the test sample to enrich the nucleic acid detection target, Cas12b and then the Cas12b enzyme guided by sgRNA can specifically recognize and cut the dsDNA target with PAM; at the same time, after Cas12b forms a ternary complex with sgRNA and target DNA, it can activate the "trans-cleavage activity" for ssDNA, which can non-specifically shear the ssDNA in the system. After FAM and BHQ1 on the ssDNA probe molecule are cut, the fluorescent signal emitted by FAM is detected, thereby generating a specific detection (such as fluorescence). The above reaction is completed in one step at the same reaction system and the same temperature (60°C) for 40-60 minutes.

[0050] The ssDNA fluorescent probe is a single-stranded nucleotide sequence labeled with FAM at the 5' end and BHQ1 at the 3' end, or a single-stranded nucleotide sequence labeled with FITC at the 5' end and BHQ1 at the 3' end. After the ssDNA fluorescent probe is cut, FAM and BHQ1 are not on the same ssDNA. Therefore, by detecting the FAM fluorescence signal under the excitation of blue-green light, the presence of Vibrio parahaemolyticus in the target system can be detected using a small instrument, a handheld ultraviolet lamp, or the naked eye.

[0051] The nucleotide sequence of the ssDNA fluorescent probe is 5'-FAM-TTTTTT-BHQ1-3', or 5'-FAM-TTTTTT-Biotin-3'.

[0052] Also included are the positive control Vibrio parahaemolyticus ATCC17802 strain genomic DNA and the negative control Escherichia coli DH5a genomic DNA.

[0053] The kit is used in visual detection of Vibrio parahaemolyticus.

[0054] A method for visually detecting Vibrio parahaemolyticus comprises the following steps:

[0055] S1, extracting genomic DNA of the sample to be tested;

[0056] S2. Using the DNA of step S1 as a template, the LAMP primers described in claim 1 are added to a reaction system to perform a LAMP isothermal amplification reaction. At the same time, AapCas12b enzyme, sgRNA (to help AapCas12b recognize and cut target DNA) and ssDNA fluorescent probe are added to the reaction system to perform a CRISPR cleavage reaction based on Cas12b, so that LAMP isothermal amplification and CRISPR cleavage reactions are carried out simultaneously in the same reaction system, while LAMP amplification and CRISPR cleavage are carried out;

[0057] S3. Determination of test results: In the laboratory, the reaction tube is placed in an instrument that can perform constant temperature reaction and fluorescence signal detection (such as a fluorescence quantitative PCR instrument, etc.). The test result can be determined by collecting the fluorescence signal in the reaction system and based on the fluorescence signal curve at different time points; during on-site testing, the reaction tube is placed in a 60°C water bath or metal bath for reaction for 40-60 minutes, and then the result is observed under a handheld ultraviolet lamp. If the reaction product has no fluorescence brightness under ultraviolet light or no brightness when observed with the naked eye, it means that Vibrio parahaemolyticus has not been detected in the sample to be tested; if the reaction product has fluorescence brightness under ultraviolet light or has brightness when observed with the naked eye, it means that Vibrio parahaemolyticus has been detected in the sample to be tested. Alternatively, the reaction product obtained in step S2 is subjected to colorimetric detection using a colloidal gold test strip. If a red band appears on the test line of the test sample or red bands appear on both the test line of the test sample and the quality control line of the negative sample, it indicates that Vibrio parahaemolyticus is detected in the test sample. If no red band appears on the test line but a red band appears on the quality control line, it indicates that Vibrio parahaemolyticus is not detected in the test sample.

[0058] Vibrio parahaemolyticus LAMP detection specificity test results: Figure 2As shown, A: 2% agarose gel; B: SYBR Green I observed under natural light; C: SYBR Green I observed under UV light; A: 2% agarose gel; B: SYBR Green I under daylight; C: SYBR Green I under UV light; M: DNA molecular mass standard; 1-11: genome DNA of Vibrio parahaemolyticus, Staphylococcus aureus, Listeria monocytogenes, Capsula perfringens, Shigella flexneri, Shigella dysenteriae, enterohemorrhagic Escherichia coli O157:H7, Salmonella typhimurium, Yersinia enterocolitica, Campylobacter jejuni and ddH2O.

[0059] Vibrio parahaemolyticus opaR gene sgRNA screening: Figure 3 As shown, A is the real-time fluorescence amplification diagram; B is 365nm ultraviolet light observation.

[0060] Sensitivity test results of LAMP-CRISPR / Cas12b one-step detection of Vibrio parahaemolyticus: Figure 4 As shown in the figure, A is the fluorescence signal detected on the real-time fluorescence PCR instrument; B is the observation result under ultraviolet light. First, the plate count of the 10-fold diluted bacterial solution of Vibrio parahaemolyticus ATCC17802 was performed, and the colony forming unit of Vibrio parahaemolyticus with OD600nm=1.0 was determined to be 3.7×10 8 CFU / mL. 3.7×10 6 -3.7×10 0 The genomic DNA extracted from Vibrio parahaemolyticus with 7 different concentrations of CFU / mL was used as the detection template and detected using the LAMP-CRISPR / Cas12b one-step method. The experimental results showed that the minimum detection limit of the LAMP-CRISPR one-step method for detecting Vibrio parahaemolyticus based on the opaR target gene was 3.7×10 1 CFU / mL.

[0061] The reaction system in step S2 is as follows: 0.2 μM each of F3 / B3 primers, 1.6 μM each of FIP / BIP primers, 6 mM MgSO4, 5 μl 10×Isothermal Amplification Buffer II, 320 units / mL Bst 3.0 DNA Polymerase, 50 nM AapCas12b enzyme, 50 nM sgRNA, 250 nM ssDNA, 5.0 μL DNA template, ddH2O to 50 μL, mix well and react at 60°C for 40-60 minutes.

[0062] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0063] Vibrio parahaemolyticus ATCC17802 genomic DNA was used as a positive control, and Escherichia coli DH5a genomic DNA was used as a negative control.

[0064] The present invention provides a method for visually detecting Vibrio parahaemolyticus based on the LAMP-CRISPR / Cas12b system, the process is as follows Figure 1 As shown, the sample to be tested is first subjected to LAMP amplification, and then, under the mediation of the sgRNA guide sequence, the CRISPR / Cas12b system is guided to recognize, bind and cut the target double-stranded DNA of the LAMP amplification product, and activate the non-specific nuclease function. The ssDNA fluorescent probe in the reaction system is then arbitrarily cut to obtain a cleavage product. Finally, the cleavage product is detected by color development for judgment, and the test results can be displayed using a variety of user-friendly terminals.

[0065] Example 1: LAMP primer design, screening, and amplification system determination:

[0066] A series of primer pairs that meet the principles of LAMP primer design were designed using the opaR gene DNA sequence (5'--3') from the genome of Vibrio parahaemolyticus Colony 83 strain (NZ_CP078705) using PrimerExplorer V5 software. These primers were synthesized by Beijing Qingke Biotechnology (PAGE purified). After a series of preliminary tests and screening, the primer screening results are shown below:

[0067] F3:5'-AACTACTTCCCAACTCGC-3', B3:5'-CTCCACTCGAACCAAACT-3'; FIP: 5'-CGATATTGTCCGAAAGGAAATTCGAAGATTTGGTTGATGAAGTTCTCA-3'; BIP: 5'-CTAGACATACACGCTCGTGAAAACCAGTGACAATCTTGGCTTA-3';

[0068] The amplified fragment size was 191 bp;

[0069] After determining the optimal primer set, the reaction system including primer concentration, MgSO4 concentration, amplification temperature, amplification time, etc. was optimized.

[0070] The optimized LAMP amplification system is: 10×Isothermal Amplification BufferⅡ2.5μL, dNTPsmix (10mM) 3.5μL, F3 (10μM) 0.5μL, B3 (10μM) 0.5μL, FIP (10μM) 4.0μL, BIP (10μM) 4.0μl, Bst3.0DNA polymerase (8000U / mL) 1.0μL, sample DNA 2.0μL, add ddH2O to 25.0μL.

[0071] Example 2: sgRNA screening:

[0072] Based on the 191bp DNA sequence amplified by LAMP, 6 possible Cas12b cleavage PAM sites (5'-TTN-3') and their 3' end 20-23bp fragments were selected as targets for potential sgRNA guide sequences. Using a plasmid (constructed in the applicant's laboratory) carrying a T7 promoter and a Cas12b DR DNA fragment (synthesized by Beijing Qingke Biotechnology Co., Ltd.) as a template, a DNA fragment containing a T7 promoter, Cas12b DR and a potential sgRNA guide sequence (20-23bp) was amplified using Q5 high-fidelity DNA polymerase. After purification and recovery, the DNA fragment was purified and then analyzed using HiScribe TM RNA was obtained by reverse transcription using the T7 Rapid and Efficient RNA Synthesis Kit (NEB) and then Each sgRNA was purified using an RNA purification kit (NEB). The designed sgRNAs were validated and screened using the LAMP-CRIPSR / Cas12b one-step method. The sgRNA sequences that were ultimately used in the LAMP-CRIPSR / Cas12b one-step detection system were:

[0073] 5'-GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAACUUCAAGCGAAGUGGCACACGAGCGUGUAUGUCUAGGUCGA-3'.

[0074] Example 3: Specificity and sensitivity determination of the LAMP-CRISPR / cas12b method:

[0075] 1. Methods

[0076] (1) Based on the previously optimized LAMP reaction system based on the opaR target gene, the reaction temperature, Cas12b and sgRNA concentrations for LAMP-CRISPR / Cas12b detection of Vibrio parahaemolyticus were further optimized, and the stability of the detection reaction was analyzed by collecting fluorescence signals (curves and fluorescence intensity values).

[0077] (2) The specificity of the detection system was analyzed by the LAMP-CRISPR / Cas12b one-step method using the extracted genomes of Vibrio parahaemolyticus, Shigella dysenteriae, enterohemorrhagic Escherichia coli O157:H7, Staphylococcus aureus, Salmonella typhimurium, Yersinia enterocolitica and Listeria monocytogenes as templates, and ultrapure sterile water as the blank control group. The fluorescence signal was collected by selecting the FAM fluorescence channel using a fluorescence quantitative PCR instrument. The reaction temperature was set to 60°C, and the fluorescence signal was measured every 1 minute for a total of 60 times for 1 hour. The detection results were then determined by the fluorescence signal curve. After the reaction was completed, the PCR tubes were placed under ultraviolet light for observation. The positive reaction tubes should show a green fluorescence reaction, while the negative reaction tubes and the blank control group should not show a significant change.

[0078] (3) The plate count method was first used to determine the number of viable V. parahaemolyticus cells per ml of culture solution when the culture solution reached an OD600nm concentration of 1.0. The V. parahaemolyticus culture solution at an OD600nm concentration of 1.0 was then diluted 10-fold using sterile PBS, and 1 ml of the genome was extracted from each concentration of culture solution. The sensitivity of the LAMP-CRISPR / Cas12b one-step detection system was then determined.

[0079] 2. Results

[0080] 1. Specificity analysis of the detection system:

[0081] The specificity of the established LAMP-CRISPR / Cas12b one-step detection method for Vibrio parahaemolyticus was analyzed by using the extracted genomes of Vibrio parahaemolyticus, Listeria monocytogenes, enterohemorrhagic Escherichia coli O157:H7, Staphylococcus aureus, Salmonella typhimurium, Shigella dysenteriae, Campylobacter jejuni and ultrapure sterile water as detection templates. The results showed that only when the genomic DNA of Vibrio parahaemolyticus was used as the detection template did the real-time fluorescence detection show an amplification curve, and no obvious fluorescence signal appeared when the genomic DNA of the other six foodborne pathogens or ultrapure sterile water was used as the template. The reaction tubes were placed under ultraviolet light for observation, and only the reaction tube with the genomic DNA of Vibrio parahaemolyticus as the template showed obvious green fluorescence, and no fluorescence reaction appeared in the other groups. Therefore, the established LAMP-CRISPR / Cas12b one-step detection system for Vibrio parahaemolyticus has good specificity, such as Figure 5 As shown in FIG, A is the fluorescence signal curve on the real-time fluorescence PCR instrument; B is the observation result under 365nm ultraviolet light.

[0082] Example 4: A kit for rapid detection of Vibrio parahaemolyticus:

[0083] A kit for visually detecting Vibrio parahaemolyticus based on a LAMP-CRISPR / Cas12b integrated detection system includes LAMP primers, sgRNA guide sequences, ssDNA fluorescent probes, LAMP reaction system and reagents required for CRISPR / Cas12b cleavage detection system, Vibrio parahaemolyticus ATCC17802 strain genomic DNA as a positive control, and Escherichia coli DH5a genomic DNA as a negative control.

[0084] Required instruments: instruments that can perform isothermal amplification and fluorescence signal detection simultaneously (such as fluorescence quantitative PCR instrument, small dedicated instrument), or constant temperature water bath (constant temperature metal bath) and handheld UV lamp.

[0085] The LAMP primers:

[0086] F3:5'-AACTACTTCCCAACTCGC-3', B3:5'-CTCCACTCGAACCAAACT-3'; FIP: 5'-CGATATTGTCCGAAAGGAAATTCGAAGATTTGGTTGATGAAGTTCTCA-3'; BIP: 5'-CTAGACATACACGCTCGTGAAAACCAGTGACAATCTTGGCTTA-3';

[0087] The sgRNA guide sequence:

[0088] 5'-GUCUAGAGGACAGAAUUUUUCACGGGGUGCCAAUGGCCACUUUCCAG GUGGCAAAGCCCGUUGAACUUCAAGCGAAGUGGCACACGAGCGUGUAUGUCUAG GUCGA-3';

[0089] The ssDNA fluorescent probe:

[0090] 5'-FAM-TTTTTT-BHQ1-3', this fluorescent probe is used to detect the presence of Vibrio parahaemolyticus in the target system under the excitation of blue-green light or with the naked eye.

[0091] The method for visually detecting Vibrio parahaemolyticus using the kit comprises the following steps:

[0092] (1) Extracting genomic DNA of the sample to be tested;

[0093] (2) Using the DNA from step S1 as a template, LAMP primers, Bst 3.0 DNA polymerase, AapCas12b enzyme, sgRNA, and ssDNA fluorescent probes (5'-FAM, 3'-BHQ1) were added to a reaction system, so that LAMP isothermal amplification and CRISPR cleavage reactions were carried out simultaneously in the same reaction system.

[0094] (2) The reaction product is colored under blue-green light or observed with the naked eye. If the cleavage product has no fluorescence brightness under blue-green light or no brightness when observed with the naked eye, it means that Vibrio parahaemolyticus is not detected in the sample to be tested. If the cleavage product has fluorescence brightness under blue-green light or brightness when observed with the naked eye, it means that Vibrio parahaemolyticus is detected in the sample to be tested.

[0095] (3) Determination of test results: In the laboratory, the reaction tube is placed in an instrument that can simultaneously perform constant temperature reaction and fluorescence signal detection (such as a fluorescence quantitative PCR instrument, etc.). The test results can be determined by collecting the fluorescence signal in the reaction system and based on the fluorescence signal curve at different time points; during on-site testing, the reaction tube is placed in a 60°C water bath for 40 to 60 minutes, and then the results are observed under a handheld ultraviolet lamp. If the reaction product has no fluorescence brightness under ultraviolet light or no brightness when observed with the naked eye, it means that Vibrio parahaemolyticus has not been detected in the sample to be tested; if the reaction product has fluorescence brightness under ultraviolet light or has brightness when observed with the naked eye, it means that Vibrio parahaemolyticus has been detected in the sample to be tested.

[0096] The reaction system for the integrated LAMP-CRISPR / Cas12b detection of Vibrio parahaemolyticus described in step (2) is as follows: 0.2 μM each of F3 / B3 primers, 1.6 μM each of FIP / BIP primers, 6 mM MgSO4, 5 μl 10×Isothermal Amplification Buffer II, 320 units / mL Bst 3.0 DNA Polymerase, 50 nM AapCas12b enzyme, 50 nM sgRNA, 250 nM ssDNA, 5.0 μL DNA template, and ddH2O to 50 μL. Mix well and incubate at 60°C for 40-60 minutes.

[0097] Example 5: A Colloidal Gold Detection Kit for Visual Detection of Vibrio parahaemolyticus

[0098] A kit for visually detecting Vibrio parahaemolyticus based on a LAMP-CRISPR / Cas12b integrated detection system includes LAMP primers, sgRNA guide sequences, ssDNA fluorescent probes, LAMP reaction system and reagents required for CRISPR / Cas12b cleavage detection system, Vibrio parahaemolyticus ATCC17802 strain genomic DNA as a positive control, and Escherichia coli DH5a genomic DNA as a negative control.

[0099] The FAM (FITC)-biotin immunoassay system required for visualization detection is a commercial lateral flow test strip (CRISPR).

[0100] The LAMP primers:

[0101] F3:5'-AACTACTTCCCAACTCGC-3', B3:5'-CTCCACTCGAACCAAACT-3'; FIP: 5'-CGATATTGTCCGAAAGGAAATTCGAAGATTTGGTTGATGAAGTTCTCA-3'; BIP: 5'-CTAGACATACACGCTCGTGAAAACCAGTGACAATCTTGGCTTA-3';

[0102] The sgRNA guide sequence:

[0103] 5'-GUCUAGAGGACAGAAUUUUUCACGGGGUGUGCCAAUGGCCACUUUCCA GGUGGCAAAGCCCGUUGAACUUCAAGCGAAGUGGCACACGAGCGUGUAUGUCUA GGUCGA-3';

[0104] The ssDNA fluorescent probe:

[0105] 5'-FAM-TTTTTT-Biotin-3', after cleavage of this fluorescent probe, FAM is separated from Biotin, and then the cleaved FAM group is detected by a lateral flow test strip (CRISPR). The presence of Vibrio parahaemolyticus in the target system is determined by whether a red band appears at the test line.

[0106] The method for visually detecting Vibrio parahaemolyticus using the kit comprises the following steps:

[0107] (1) Extracting genomic DNA of the sample to be tested;

[0108] (2) Using the DNA from step S1 as a template, LAMP primers, Bst 3.0 DNA polymerase, AapCas12b enzyme, sgRNA, and ssDNA fluorescent probe (5'-FAM, 3'-Bio) were added to a reaction system, so that LAMP isothermal amplification and CRISPR cleavage reactions were carried out simultaneously in the same reaction system.

[0109] The reaction system for the integrated LAMP-CRISPR / Cas12b detection of Vibrio parahaemolyticus described in step (2) is as follows: 0.2 μM each of F3 / B3 primers, 1.6 μM each of FIP / BIP primers, 6 mM MgSO4, 5 μl 10×Isothermal Amplification Buffer II, 320 units / mL Bst 3.0 DNA Polymerase, 50 nM AapCas12b enzyme, 50 nM sgRNA, 100 nM ssDNA, 5.0 μL DNA template, and ddH2O to 50 μL. Mix well and incubate at 60°C for 40-60 minutes.

[0110] (3) Place the lateral flow test strip (CRISPR) into the above reaction tube. The liquid level must not exceed the MAX line. Read the results within 7-10 minutes.

[0111] (3) Determination of test results: Figure 6 As shown, a clear red band appears on both the test line and the control line, or on the test strip, indicating a positive result. A red band appears only on the test line, indicating a negative result. Test strip 1 in the figure detects genomic DNA from Vibrio parahaemolyticus, while test strips 2-6 detect genomic DNA from Salmonella, Enterohemorrhagic Escherichia coli O157:H7, Listeria monocytogenes, Staphylococcus aureus, and Campylobacter jejuni, respectively.

[0112] Example 6. Detection of clinical samples using a kit for rapid detection of Vibrio parahaemolyticus based on the LAMP-CRISPR / Cas12b integrated detection system:

[0113] From September 2022 to March 2023, a total of 50 marine fish samples were collected from seafood markets, large vegetable markets, fresh food supermarkets, and large supermarkets in Minhang District, Fengxian District, Songjiang District, Jinshan District, and Qingpu District of Shanghai. The LAMP-CRISPR / Cas12b integrated detection system was used to detect Vibrio parahaemolyticus (using a fluorescent quantitative PCR instrument) and the national standard method (GB4789.7-2013) to detect Vibrio parahaemolyticus carried in the above-mentioned foods. The experimental results showed that among the 50 clinical samples tested, Vibrio parahaemolyticus was detected in 6 marine fish samples using the LAMP-CRISPR / Cas12b one-step detection method, which was consistent with the test results of the national standard method, with a compliance rate of 100%. This suggests that the LAMP-CRISPR / Cas12b integrated detection system for Vibrio parahaemolyticus can be used for rapid detection of clinical samples.

[0114] The present invention and its embodiments are described above. This description is not restrictive. What is shown in the full text is only one embodiment of the present invention, and the actual structure is not limited thereto. In short, if a person skilled in the art is inspired by this and, without departing from the purpose of the present invention, designs a structure and embodiment similar to this technical solution without creatively designing, they shall all fall within the scope of protection of the present invention.

Claims

1. A kit for rapid detection of Vibrio parahaemolyticus based on the LAMP-CRISPR / Cas12b integrated system, characterized in that: Including LAMP primers, sgRNA guide sequence, Cas12b enzyme, ssDNA fluorescent probe and colloidal gold test strips, The nucleotide sequence of the LAMP primer is: F3:5'-AACTACTTCCCAACTCGC-3', B3:5'-CTCCACTCGAACCAAACT-3'; FIP: 5'-CGATATTGTCCGAAAGGAAATTCGAAGATTTGGTTGATGAAGTTCTCA-3'; BIP: 5'-CTAGACATACACGCTCGTGAAAACCAGTGACAATCTTGGCTTA-3'; The sgRNA guide sequence is: 5'-GUCUAGAGGACAGAAUUUUUCACGGGGUGUGCCAAUGGCCACUU UCCAGGUGGCAAAGCCCGUUGAACUUCAAGCGAAGUGGCACACGAGCG UGUAUGUCUAGGUCGA-3'; The ssDNA fluorescent probe is a single-stranded nucleotide sequence labeled with FAM or FITC at the 5' end and BHQ1 at the 3' end, or a single-stranded nucleotide sequence labeled with FAM or FITC at the 5' end and Biotin at the 3' end; The nucleotide sequence of the ssDNA fluorescent probe is 5'-FAM-TTTTTT-BHQ1-3', 5'-FITC-TTTTTT-BHQ1-3' or 5'-FAM-TTTTTT-Biotin-3'.

2. The kit for rapid detection of Vibrio parahaemolyticus based on the LAMP-CRISPR / Cas12b integrated system according to claim 1, characterized in that: Also included are the positive control Vibrio parahaemolyticus ATCC17802 strain genomic DNA and the negative control Escherichia coli DH5a genomic DNA.

3. Use of the kit according to any one of claims 1 to 2 in the visual detection of Vibrio parahaemolyticus for non-disease diagnosis purposes.

4. A method for visually detecting Vibrio parahaemolyticus for non-disease diagnosis purposes, characterized in that: The steps include: S1, extracting genomic DNA of the sample to be tested; S2. Using the DNA from step S1 as a template, LAMP primers were added to a reaction system to perform a LAMP isothermal amplification reaction. At the same time, AapCas12b enzyme, sgRNA, and ssDNA fluorescent probe were added to the reaction system to perform a Cas12b-based CRISPR cleavage reaction, so that LAMP isothermal amplification and CRISPR cleavage reactions were carried out simultaneously in the same reaction system, with LAMP amplification and CRISPR cleavage at the same time. S3. Determination of test results: Place the reaction tube in an instrument capable of performing constant temperature reaction and fluorescence signal detection, collect the fluorescence signal in the reaction system, and determine the test result based on the fluorescence signal curve at different time points; or place the reaction tube in a constant temperature water bath or a constant temperature metal bath, and detect the fluorescence signal with a handheld ultraviolet lamp after the reaction is completed; Alternatively, the reaction product obtained in step S2 is subjected to colorimetric detection using a colloidal gold test strip. If a red band appears on the test line of the test sample or a red band appears on both the test line of the test sample and the quality control line of the negative sample, it indicates that Vibrio parahaemolyticus is detected in the test sample. If no red band appears on the test line but a red band appears on the quality control line, it indicates that Vibrio parahaemolyticus is not detected in the test sample. The nucleotide sequence of the LAMP primer is: F3:5'-AACTACTTCCCAACTCGC-3', B3:5'-CTCCACTCGAACCAAACT-3'; FIP: 5'-CGATATTGTCCGAAAGGAAATTCGAAGATTTGGTTGATGAAGTTCTCA-3'; BIP: 5'-CTAGACATACACGCTCGTGAAAACCAGTGACAATCTTGGCTTA-3'; The sgRNA guide sequence is: 5'-GUCUAGAGGACAGAAUUUUUCACGGGGUGUGCCAAUGGCCACUU UCCAGGUGGCAAAGCCCGUUGAACUUCAAGCGAAGUGGCACACGAGCG UGUAUGUCUAGGUCGA-3'; The ssDNA fluorescent probe is a single-stranded nucleotide sequence labeled with FAM or FITC at the 5' end and BHQ1 at the 3' end, or a single-stranded nucleotide sequence labeled with FAM or FITC at the 5' end and Biotin at the 3' end; The nucleotide sequence of the ssDNA fluorescent probe is 5'-FAM-TTTTTT-BHQ1-3', 5'-FITC-TTTTTT-BHQ1-3' or 5'-FAM-TTTTTT-Biotin-3'.

5. A method for visually detecting Vibrio parahaemolyticus for non-disease diagnosis purposes according to claim 4, characterized in that: the visual detection comprises immunochromatographic detection using a FAM or FITC-biotin reporter system - a lateral flow colloidal gold test strip, wherein the chromatographic membrane of the test strip is provided with a test line T and a control line C, the sample loading area of ​​the chromatographic membrane is coated with a gold-labeled anti-FAM or FITC antibody, the control line C is coated with streptavidin, and the test line T is coated with an anti-mouse antibody.

6. The method for visually detecting Vibrio parahaemolyticus for non-disease diagnosis purposes according to claim 4, characterized in that: The reaction system of step S2 is as follows: 0.2 μM each of F3 / B3 primers, 1.6 μM each of FIP / BIP primers, 6 mM MgSO4, 5 μl 10×Isothermal Amplification Buffer II, 320 units / mL Bst 3.0 DNA Polymerase, 50 nM ApCas12b enzyme, 50 nM sgRNA, 250 nM ssDNA, 5.0 μL of DNA template, ddH2O is added to 50 μL, mixed well, and reacted at 60°C for 40 to 60 minutes.

7. The method for visually detecting Vibrio parahaemolyticus for non-disease diagnosis purposes according to claim 4, characterized in that: The reaction tube in step S2 can simultaneously perform constant temperature reaction and fluorescence signal detection, or react in a 60° C. water bath or metal bath for 40-60 minutes, and then observe the results using a test strip or under a handheld ultraviolet lamp.

Citation Information

Patent Citations

  • Double-LAMP (loop-mediated isothermal amplification) method for simultaneously detecting vibrio parahaemolyticus and vibrio vulnificus

    CN105219845A