A super-high molecular weight xanthan gum, its production strain, and molecular markers for detection
Through genetic engineering, the ultra-high molecular weight xanthan gum production strain T-XM is solved, and the existing xanthan gum is insufficient in molecular weight is achieved, and the viscosity and stability are achieved, which expands its application range.
Patent Information
- Application Number
- CN202310886163.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-19
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2043-07-19
AI Technical Summary
The prior art is difficult to effectively increase the molecular weight of xanthan gum, resulting in limited application in certain fields, especially in terms of viscosity, stability, and salt and high temperature resistance.
Through genetic engineering, an ultra-high molecular weight xanthan gum production strain T-XM was constructed. By knocking out some Sanzan gum in the sphingomonas strain NXdP, the xanthan gum synthesis gene cluster of the wild rapeseed Xanthan gum was introduced to form the engineering strain T-XM, and the production of ultra-high molecular weight xanthan gum was achieved.
It produces ultra-high molecular weight xanthan gum with a molecular weight far higher than ordinary xanthan gum, which has better viscosity, stability, salt and high temperature resistance, and broadens its application in the fields of food, cosmetics, medicine and petroleum industries.
Smart Images

Figure CN116854836B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of microbial products, and particularly relates to a ultra-high molecular weight xanthan gum, its production strain and molecular markers for detection. Background Art
[0002] Microbial exopolysaccharides are a class of biogums synthesized by microorganisms, with diverse properties, biocompatibility, biodegradability and sustainable production. They have been widely used in more than twenty industries and hundreds of applications such as food, daily chemicals, medicine, environmental protection, papermaking, petroleum, building materials, etc., and are a class of biotechnological products closely related to people's lives. Xanthan gum is the second microbial exopolysaccharide to achieve large-scale industrial production. Due to its high viscosity, high stability, salt and high temperature resistance and other characteristics, it has a wide range of applications in the fields of food, cosmetics, medicine and petroleum industry.
[0003] Xanthan gum is a heteropolysaccharide, which is a high molecular polymer composed of pentasaccharide repeating units. The repeating unit of xanthan gum consists of two glucoses, two mannoses and one glucuronic acid, with a molar ratio of 2:2:1. Among them, the two glucoses form the main chain, which is similar to the cellulose structure and is connected by β-1-4-glycosidic bonds. The side chain structure is that two mannoses are separated by one glucuronic acid, and the glucuronic acid is connected to the inner and outer mannoses by β-1-4-glycosidic bonds and β-1-2-glycosidic bonds respectively. This trisaccharide side chain is connected to the glucose on the main chain at intervals through β-1-3-glycosidic bonds. The molecular weight of xanthan gum is generally 2×10 6 ~2×10 7 Da. Its high viscosity, high stability, salt and high temperature resistance and other characteristics are closely related to the molecular weight. The larger the molecular weight, the higher the viscosity of xanthan gum, the better the viscoelasticity, and the stronger the salt and high temperature resistance. The low viscosity and poor salt and high temperature resistance of ordinary xanthan gum limit its application in some special fields.
[0004] Current research shows that the molecular weight of xanthan gum is affected by the strain, carbon source, nitrogen source, fermentation temperature, fermentation method and C / N ratio during the fermentation process. At present, changing the molecular weight of xanthan gum mainly depends on changing the fermentation conditions during the production process, with poor stability and limited increase in molecular weight. Summary of the Invention
[0005] In view of this, the purpose of the present invention is to provide a ultra-high molecular weight xanthan gum, whose monosaccharide composition is the same as that of ordinary xanthan gum, but the molecular weight is much higher than the molecular weight range of ordinary xanthan gum reported in the prior art.
[0006] The present invention also provides a strain T-XM for producing the above-mentioned ultra-high molecular weight xanthan gum and a method for constructing the same. Genes related to xanthan gum synthesis are inserted into the NXdPE strain in which genes related to the synthesis of trisaccharide xanthan are knocked out to obtain the xanthan gum-producing strain T-XM capable of synthesizing ultra-high molecular weight xanthan gum.
[0007] The present invention provides an ultra-high molecular weight xanthan gum, the structure of the repeating unit of which is the same as that of ordinary xanthan gum, and the molecular weight is greater than 2.0×10 7 Da.
[0008] Preferably, the repeating structural unit of the ordinary xanthan gum is composed of two glucoses, two mannoses and one glucuronic acid. The structure of the repeating structural unit is that two glucoses are connected through β-1-4-glycosidic bonds to form a main chain, and the side chain structure is that two mannoses are separated by one glucuronic acid, and the glucuronic acid is respectively connected to the inner and outer mannoses through β-1-4-glycosidic bonds and β-1-2-glycosidic bonds
[0009] connected, and the side chain structure is connected to the glucose on the main chain at intervals through β-1-3-glycosidic bonds.
[0010] Preferably, the molecular weight is (2.91~14.3)×10 7 Da.
[0011] The present invention provides a strain T-XM of extracellular polymeric Sphingomonas sanxanigenens for producing the ultra-high molecular weight xanthan gum. On the basis of the Sphingomonas sp. strain NXdP, the xanthan gum synthesis gene cluster in Xanthomonas campestri is used to replace some genes related to the synthesis of trisaccharide xanthan.
[0012] Preferably, the xanthan gum synthesis gene cluster is amplified by using a primer pair with the DNA of Xanthomonas campestri as a template;
[0013] The primer pair includes a forward primer with the nucleotide sequence shown in SEQ ID NO:1 and a reverse primer with the nucleotide sequence shown in SEQ ID NO:2.
[0014] Preferably, the xanthan gum synthesis gene cluster is expressed under the initiation of the P 916 promoter of the strain NXdP;
[0015] The partial genes related to the synthesis of trisaccharide xanthan include orf0831 gene and orf0533-orf0536 genes.
[0016] Preferably, the preservation number of the strain T-XM is CGMCC No. 27299.
[0017] The present invention provides a method for constructing the strain T-XM, comprising the following steps:
[0018] Knock out some genes related to the synthesis of gellan gum in the strain NXdP of Sphingomonas sp., to obtain the defective strain NXdPE;
[0019] Clone the P 916 promoter fragment and the xanthan gum synthesis gene cluster derived from Xanthomonas campestri into the defective strain NXdPE, to obtain the engineering strain T-XM for producing ultra-high molecular weight xanthan gum.
[0020] Preferably, for the method of cloning into the defective strain NXdPE, construct a recombinant vector with the P 916 promoter fragment, the xanthan gum synthesis gene cluster and the upstream and downstream homologous arms of the strain NXdP of Sphingomonas sp., transfer the recombinant vector by conjugation into the defective strain NXdPE, and perform single crossover and double crossover screening to obtain the double crossover engineering strain.
[0021] The present invention provides a molecular marker for detecting the strain T-XM, the ultra-high molecular weight xanthan gum or its processed products, and the nucleotide sequence is as shown in SEQ ID NO: 11.
[0022] The present invention provides an ultra-high molecular weight xanthan gum, the structure of its repeating unit is the same as that of ordinary xanthan gum, and the molecular weight is greater than 2.0×10 7 Da. The present invention uses genetic engineering means to construct a strain NXdP of Sphingomonas sp. in which the xanthan gum synthesis gene cluster of Xanthomonas campestri replaces some genes related to the synthesis of gellan gum, named Sphingomonas xanigenens, with the strain number T-XM strain. After fermentation culture, the monosaccharide composition of the produced polysaccharide is determined. The monosaccharide composition of the ultra-high molecular weight xanthan gum is glucose, glucuronic acid and mannose, which is the same as that of ordinary xanthan gum. Determined by Fourier transform infrared spectroscopy, the structure is the same as that of ordinary xanthan gum. The molecular weight of the polysaccharide is measured by multi-angle laser light scattering coupled with size exclusion chromatography. The results show that the weight average molecular weight of the ultra-high molecular weight xanthan gum is (2.91~14.3)×10 7 Da, far exceeding the molecular weight range of ordinary xanthan gum reported in the literature (2.0×106 ~2.0×10 7 Da). After viscosity measurement and salt and high temperature resistance performance measurement, the results show that the ultra-high molecular weight xanthan gum has good viscosity, high stability, and salt and high temperature resistance characteristics, and can be used as a stabilizer and thickener, having a wide range of applications in fields such as food, cosmetics, medicine, and the petroleum industry. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 For the determination of the monosaccharide composition of ultra-high molecular weight products by HPLC method;
[0024] Figure 2 For the result 1 of the determination of ultra-high molecular weight xanthan gum by multi-angle laser light scattering - size exclusion chromatography;
[0025] Figure 3 For the result 2 of the determination of ultra-high molecular weight xanthan gum by multi-angle laser light scattering - size exclusion chromatography;
[0026] Figure 4 For the structural determination results of the ultra-high molecular weight xanthan gum, ordinary xanthan gum, and gellan gum prepared in the present invention;
[0027] Figure 5 For the viscosity determination results of ultra-high molecular weight xanthan gum and ordinary xanthan gum.
[0028] BIOLOGICAL MATERIAL DEPOSIT INFORMATION
[0029] The extracellular polymer Sphingomonas xanigenens was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on May 9, 2023. The address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and the biological deposit number is CGMCC No. 27299. DETAILED DESCRIPTION OF THE INVENTION
[0030] The present invention provides an ultra-high molecular weight xanthan gum, the structure of the repeating unit is the same as that of ordinary xanthan gum, and the molecular weight is greater than 2.0×10 7 Da.
[0031] In the present invention, the molecular weight of the ordinary xanthan gum is preferably (0.2~2.0)×10 7Da; The repeating structural unit of the common xanthan gum is composed of two glucoses, two mannoses and one glucuronic acid. The structure of the repeating structural unit is that two glucoses are connected by β-1-4-glycosidic bonds to form the main chain, and the side chain structure is that two mannoses are separated by one glucuronic acid, where the glucuronic acid is connected to the inner and outer mannoses by β-1-4-glycosidic bonds and β-1-2-glycosidic bonds respectively, and the side chain structure is connected to the glucose on the main chain at intervals through β-1-3-glycosidic bonds. In the embodiments of the present invention, first, the monosaccharide composition analysis is carried out, and the results show that the monosaccharide composition of the ultra-high molecular weight xanthan gum is glucose, glucuronic acid and mannose, which is consistent with that of the common xanthan gum. In addition, Fourier transform infrared spectroscopy analysis is carried out on the common xanthan gum and the ultra-high molecular weight xanthan gum, and the results show that the spectra of the two Figure 1 are consistent, indicating that the repeating unit of the ultra-high molecular weight xanthan gum is the same as that of the common xanthan gum.
[0032] In the present invention, the molecular weight of the ultra-high molecular weight xanthan gum is preferably greater than 2.0×10 7 Da. In the embodiments of the present invention, a multi-angle laser light scattering instrument - size exclusion chromatography is used in combination to measure the molecular weight of the ultra-high molecular weight xanthan gum. The results show that the weight-average molecular weight of the ultra-high molecular weight xanthan gum is (2.91 - 14.3)×10 7 Da, far exceeding the molecular weight range (2.0×10 6 ~2.0×10 7 Da) of the common xanthan gum reported in the literature, belonging to the category of ultra-high molecular weight xanthan gum.
[0033] In the present invention, through viscosity measurement and salt and high temperature resistance performance measurement, the results show that the ultra-high molecular weight xanthan gum has good viscosity, high stability and salt and high temperature resistance characteristics, and can be used as a stabilizer and thickener, and has a wide range of applications in fields such as food, cosmetics, medicine and petroleum industry
[0034] The present invention provides an extracellular polysaccharide-producing Sphingomonas sanxanigenens strain T-XM for producing the ultra-high molecular weight xanthan gum. On the basis of the Sphingomonas sp. strain NXdP, part of the genes related to the synthesis of trisaccharide gum is replaced by the xanthan gum synthesis gene cluster in Xanthomonas campestri.
[0035] In the present invention, the xanthan gum synthesis gene cluster is preferably amplified using a primer pair with the DNA of Xanthomonas campestris as a template. The primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO:1 (GCTTATAAGCGCGACAAAGGATGTGTTCGTTCTATGCCAT) and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:2 (GGATGTCGGTGAAGCTGCGCCCATTTTTTTGACGGCGTTG). There are no special restrictions on the Xanthomonas campestris in the present invention, and well-known strains in the art can be used, such as the strains with the preservation numbers CGMCC NO.15155 or ATCC 33913. The strain of Xanthomonas campestris with the preservation number CGMCC NO.15155 is sourced from soil and is recorded and disclosed in the patent with the publication number CN109706110A. The ATCC 33913 strain can be purchased through commercial channels.
[0036] In the present invention, the xanthan gum synthesis gene cluster is preferably expressed under the control of the P 916 promoter of the strain NXdP. The primers for amplifying the P 916 promoter are preferably a forward primer with a nucleotide sequence as shown in SEQ ID NO:5 (CAACGCCGTCAAAAAAATGGGCGCAGCTTCACCGACATCC) and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:6 (GGATGTCGGTGAAGCTGCGCCCATTTTTTTGACGGCGTTG). The nucleotide sequence of the P 916 promoter is as shown in SEQ ID NO:12 (CTGCTGTTCACCTGGCTCCAGACCGGGCTGGTTCCCCGCTATCCGAC CGCGGTGCTGGCGACCGGCCTTACCATCGTCGCCTTCCTCAGTTTCGCCTGCGGCCTCATCCTCGACACGGTGGTGCACGGGCGGCGCGAGATGCGGCGGATCGCCTATCTTTCGCATGCTGCGCCGGGCGCGGCCGACGCCCGAAGCGAGGCCCCTTGAAGCCGCCCCGCTTTCACCCGATGTAGGGACACG).
[0037] In the present invention, the partial xanthan gum synthesis-related genes preferably include the orf0831 gene and the orf0533-orf0536 genes. The nucleotide sequence of the orf0831 gene is as shown in SEQ ID NO:13. The nucleotide sequence of the orf0533-orf0536 genes is as shown in SEQ ID NO:14.
[0038] In the present invention, the strain T-XM was deposited with the institution designated by the National Intellectual Property Administration, and the deposit number is CGMCC No. 27299.
[0039] The present invention provides a method for constructing the strain T-XM, comprising the following steps:
[0040] Knock out some xanthan gum synthesis-related genes in the Sphingomonas sp. strain NXdP to obtain a defective strain NXdPE;
[0041] Clone the P 916 promoter fragment and the xanthan gum synthesis gene cluster from Xanthomonas campestri into the defective strain NXdPE to obtain an engineered strain T-XM for producing ultra-high molecular weight xanthan gum.
[0042] In the present invention, the method for knocking out some xanthan gum synthesis-related genes in the Sphingomonas sp. strain NXdPE preferably comprises the following steps: sequentially knock out the orf0831 and orf0533-orf0536 genes related to xanthan gum synthesis in the strain NXdP. The knocking-out method can be completed by referring to the double-exchange homologous recombination method described in the patent of 201810737183.3.
[0043] In the present invention, the method for cloning into the defective strain NXdPE preferably constructs a recombinant vector with the upstream homologous arm fragment, the P 916 promoter fragment, the xanthan gum synthesis gene cluster, and the upstream and downstream homologous arms of the Sphingomonas sp. strain NXdP, transfers the recombinant vector by conjugation into the defective strain NXdPE, and performs single-exchange and double-exchange screening to obtain a double-exchange engineered strain.
[0044] In the present invention, the method for constructing the recombinant vector preferably comprises the following steps:
[0045] Combine the upstream homologous arm fragment, the P 916The promoter fragment, xanthan gum synthesis gene cluster and downstream homologous arm were cloned onto the backbone vector in sequence to obtain a recombinant vector. The amplification primer pair for the upstream homologous arm fragment was preferably a forward primer with a nucleotide sequence as shown in SEQ ID NO:7 (CCTAGATCCTTTAATTCGAGCCGCGATCAGATGCTGCTTGA) and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:8 (GGATGTCGGTGAAGCTGCGCCCATTTTTTTGACGGCGTTG). The amplification primer pair for the downstream homologous arm was preferably a forward primer with a nucleotide sequence as shown in SEQ ID NO:9 (TGGTGGTGTCGTTGTTGGCATGGATCGTCGCGCATCAGAC) and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:10 (TCAAACATGAGAATAGCTTGCCCCAGGTGCCGATATCGTCC). The cloning was preferably achieved by using the HiFi DNA Assembly Mastermix one-step method to ligate into the backbone vector. The present invention has no special limitation on the preparation method of the backbone vector, and a backbone vector well-known in the art can be used. In the examples of the present invention, the backbone vector was preferably the pLO3 vector.
[0046] In the present invention, for the method of conjugative transfer of the recombinant vector to the defective strain NXdPE and single-exchange and double-exchange screening, it is preferred to refer to the conjugative transfer method disclosed in the patent 201810737183.3.
[0047] In the present invention, for the method of producing ultra-high molecular weight xanthan gum using the strain T-XM obtained by the above construction method, referring to the preparation method of hydrogel disclosed in the patent 201810737183.3, it preferably includes the following steps:
[0048] The strain T-XM was inoculated into the TPG liquid medium and cultured with shaking for 20 - 26 h to obtain a culture solution; the culture solution was inoculated into the seed medium and cultured with shaking for 20 - 26 h to obtain a seed solution; the seed solution was inoculated into the fermentation medium and fermented for 68 - 75 h to obtain a fermentation broth; the fermentation broth was precipitated with ethanol to form flocs, separated, and the precipitate was obtained; the precipitate was dehydrated to obtain ultra-high molecular weight xanthan gum.
[0049] In the present invention, the temperature of the shaking culture is preferably 28 to 35 °C, more preferably 30 to 32 °C. The fermentation medium preferably comprises: 30 to 70 g / L of glucose, 0.5 to 2 g / L of soybean cake powder, 1 to 2 g / L of K2HPO4, 0.1 to 1 g / L of MgSO4, and 1 to 2 g / L of NaNO3. The temperature of the fermentation is 28 to 35 °C, more preferably 30 to 32 °C. The method for removing moisture from the precipitate is preferably drying at 60 to 90 °C for 2 to 6 h, more preferably drying at 70 to 85 °C for 4 h. After removing the moisture, the precipitate is preferably pulverized and sieved, and the material passing through a 80-mesh sieve is collected to obtain ultra-high molecular weight xanthan.
[0050] The present invention provides a molecular marker for detecting the strain T-XM, the ultra-high molecular weight xanthan gum or its processed products, and the nucleotide sequence is as shown in SEQ ID NO: 11 (TGGCGGATCTTCCGGACGATCGGCACGCTGTATCGTATCGAGCGGCCAs shown in SEQ ID NO:The forward primer shown in NO:3 (TGGCGGATCTTCCGGACGAT) and the reverse primer shown in nucleotide sequence SEQ ID NO:4 (GCGATCGCCTGCTGCAAGGT).
[0051] In the present invention, the molecular marker is an essential gene for the synthesis of ultra-high molecular weight xanthan gum. After deleting this sequence, the strain cannot synthesize extracellular polysaccharides. The application of the molecular marker in identifying ultra-high molecular weight xanthan gum synthesis strains or moderately processed products of all ultra-high molecular weight xanthan gums.
[0052] In the present invention, the detection method preferably includes the following steps:
[0053] Extract the genomic DNA of the sample to be tested. Using the genomic DNA as a template, perform PCR amplification with the amplification primers of the molecular marker. Detect and sequence the PCR amplification product. A result with a length of 1001 bp indicates that the sample to be tested is an ultra-high molecular weight xanthan gum production strain or an ultra-high molecular weight xanthan gum processed product.
[0054] The following will combine examples to elaborate in detail on an ultra-high molecular weight xanthan gum provided by the present invention, its production strain, and the molecular marker for detection, but they cannot be construed as limiting the protection scope of the present invention.
[0055] Example 1
[0056] A construction method for a production strain of ultra-high molecular weight xanthan gum, comprising the following steps:
[0057] 1. The primers involved in this experiment and their specific sequences are shown in Table 1.
[0058] Table 1 Primer Sequences
[0059]
[0060]
[0061] 2. Experimental method
[0062] 1) Construction method of the genetic engineering strain Sphingomonas sp. NXdPE that cannot synthesize trisaccharide gum
[0063] According to the method described in Patent ZL201810737183.3, sequentially knock out the orf0831, orf0533 - orf0536 genes related to trisaccharide gum synthesis in the strain NXdP to obtain the trisaccharide gum and PHB-deficient strain NXdPE. The specific steps are as follows.
[0064] The target gene is inactivated by double crossover homologous recombination. The genome of NXdP is extracted using an extraction kit. The upstream and downstream homologous arms of the target gene are amplified using the NXdP genome as a template, the primers gene-su / gene-sl and gene-xu / gene–xl, and PrimeSTAR DNA polymerase (Takara Bio, Tokyo, Japan), respectively. The PCR amplification system is 0.5 μL of a DNA template at 10–50 ng / μL, 0.4 μL of each 20 μM primer pair, 12.5 μL of PrimeStarpremix polymerase, 2 μL of DMSO, and water is added to make up to 25 μL; the PCR reaction conditions are: 98 °C for 15 s, 55 °C for 10 s, 72 °C for 30 s, for 35 cycles.
[0065] The upstream and downstream DNA fragments are ligated by overlap PCR. The product is detected by electrophoresis, and the target gene band is purified and recovered using a gel extraction kit to obtain a recombinant fragment. The recombinant fragment and the pLO3 plasmid are simultaneously digested with the restriction enzymes SacI and XbaI or PacI at 37 °C for 90 min. The digested fragments are purified and recovered by PCR using a kit. The two recovered products are ligated overnight at 16 °C using T4 DNA ligase to obtain the recombinant plasmid pLO3-Δgene, and the recombinant plasmid is transferred into competent E. coli S17 cells for amplification of the recombinant plasmid. Single colonies with correct PCR detection (detection primers gene-su / gene-xl) are picked for glycerol preservation.
[0066] The knockout plasmid is introduced into the strain NXdP by the method of conjugation transfer, and single crossover and double crossover screening are carried out. The single crossover strain is resistant to both chloramphenicol and tetracycline. The correct single colonies of the double crossover are verified by PCR detection (detection primers are the corresponding gene 1 / corresponding gene 2). The orf0831 and orf0533-orf0536 genes are knocked out in sequence.
[0067] Among them, the detection PCR conditions: the PCR amplification system is 0.5 μL of a DNA template at 10–50 ng / μL, 0.4 μL of each 20 μM primer, 12.5 μL of rTaq polymerase, 2 μL of DMSO, and water is added to make up to 25 μL;
[0068] The PCR reaction conditions are: pre-denaturation at 95 °C for 10 min; 94 °C for 45 s, 55 °C for 45 s, 72 °C for 60 s, for 35 cycles; extension at 72 °C for 10 min.
[0069] 2) Method for constructing a recombinant vector containing a target gene fragment of the xanthan gum synthesis gene cluster
[0070] (1) Extract the genomes of strains NXdP (CGMCC NO. 15406) and Xanthomonas campestris (CGMCC NO. 15155) respectively;
[0071] (2) Amplify the xanthan gum synthesis gene cluster, promoter fragment, and upstream and downstream homologous arm fragments:
[0072] The PCR amplification system is 0.5 μL of DNA template at 10 - 50 ng / μL, 0.4 μL of each primer pair at 20 μM, 12.5 μL of PrimeStar premix polymerase, 2 μL of DMSO, and add water to 25 μL;
[0073] The primers used for the upstream homologous arm are U-F (CCTAGATCCTTTAATTCGAGCCGCGATCAGATGCTGCTTGA, SEQ ID NO: 7) / U-R (GGATGTCGGTGAAGCTGCGCCCATTTTTTTGACGGCGTTG, SEQ ID NO: 8), and the template is the genome of strain NXdP;
[0074] P 916 The primers used for the promoter fragment are P916-F (CAACGCCGTCAAAAAAATGGGCGCAGCTTCACCGACATCC, SEQ ID NO: 5) / P916-R (GGATGTCGGTGAAGCTGCGCCCATTTTTTTGACGGCGTTG, SEQ ID NO: 6), and the template is the genome of strain NXdP;
[0075] The primers used for the xanthan gum synthesis gene cluster are gum-F (GCTTATAAGCGCGACAAAGGATGTGTTCGTTCTATGCCAT, SEQ ID NO: 1) / gum-R (GGATGTCGGTGAAGCTGCGCCCATTTTTTTGACGGCGTTG, SEQ ID NO: 2), and the template is the genome of Xanthomonas campestri (CGMCC NO. 15155) strain;
[0076] The primers used for the downstream homologous arm are D-F (TGGTGGTGTCGTTGTTGGCATGGATC GTCGCGCATCAGAC, SEQ ID NO: 9) / D-R (TCAAACATGAGAATAGCTT GCCCCAGGTGCCGATATCGTCC, SEQ ID NO: 10), and the template is the genome of strain NXdP.
[0077] The PCR reaction conditions were as follows: pre-denaturation at 98°C for 30 s; 98°C for 15 s, 54°C for 15 s, 72°C for 10 - 60 s, for 35 cycles; extension at 72°C for 3 min;
[0078] (3) Separate the PCR products by agarose gel electrophoresis, recover the target band from the gel to obtain the target fragment.
[0079] (4) Construction of the recombinant vector:
[0080] Use the HiFi DNA Assembly Mastermix one-step method to sequentially ligate the upstream homologous arm, P916 promoter, xanthan gum synthesis gene cluster, and downstream homologous arm to the pLO3 vector to construct the recombinant vector pLO3-P916gum.
[0081] (5) Insert the target fragment into the Sphingomonas sp. NXdPE genome
[0082] According to the method described in Patent ZL201810737183.3, transfer the pLO3-P916gum vector by conjugation into the recipient bacterium strain NXdPE. After single crossover and double crossover screening, the primers for single crossover detection include 916gumUC1, 916gumUC2, 916gumDC1, and 916gumDC2; simultaneous single crossover of the upstream and downstream homologous arms is the double crossover strain. The strain obtained after double crossover screening is the engineering strain for producing ultra-high molecular weight xanthan gum.
[0083] Example 2
[0084] Method for the engineering strain for producing ultra-high molecular weight xanthan gum to produce ultra-high molecular weight xanthan gum
[0085] According to the method for producing polysaccharides described in Patent ZL201510110078.3 and ZL201810737183.3, ferment the strain T-XM, and collect the fermentation broth. Add ethanol with a volume 2 - 3 times that of the fermentation broth and stir to obtain a flocculent precipitate. Collect the precipitate, dry it at 60 - 90°C for 2 - 6 h, pulverize it, and pass it through an 80-mesh sieve to obtain the ultra-high molecular weight xanthan gum product.
[0086] Example 3
[0087] Determine the monosaccharide composition of the ultra-high molecular weight xanthan gum product by two steps: acid hydrolysis of the sample and high performance liquid chromatography analysis
[0088] 1. Acid hydrolysis of the sample: Weigh 5 mg of the dried sample into an ampoule, add 1 mL of 2 mol / L trifluoroacetic acid solution, seal the mouth of the ampoule, place it in a forced-air drying oven, set the temperature to 120 °C, and hydrolyze the xanthan gum sample for 10 h. During the hydrolysis process, mix the sample in the ampoule every two hours. After the hydrolysis is completed, take out 500 μL of the hydrolyzate and transfer it to a 1.5 mL EP tube. Evaporate the liquid in a 95 °C water bath. If necessary, blow it dry with nitrogen. Then add 200 μL of ultrapure water, adjust it to neutral with 0.2 M sodium hydroxide, centrifuge at 12000 g to remove insoluble substances, and then filter it through a 0.22 μm filter membrane.
[0089] 2. Prepare a 1 g / L standard sugar solution (glucose, glucuronic acid, mannose), and filter it through a 0.22 μm filter membrane.
[0090] 3. Liquid chromatography conditions: The Agilent 1100 liquid chromatography system is equipped with a Waters Sugar-Pak TM I chromatographic column. Mobile phase: 50 mg / L EDTA-2NaCa solution.
[0091] Chromatographic condition settings: Injection volume is 20 μL, column temperature is 85 °C, flow rate is set at 0.5 mL / min, a differential refractive index detector is used, and the detector temperature is 35 °C.
[0092] The results are as Figure 1 shown, indicating that the monosaccharide composition of ultra-high molecular weight xanthan gum is glucose, glucuronic acid, and mannose, which is the same as that of ordinary xanthan gum.
[0093] Example 4
[0094] Determination of the molecular weight of the product by multi-angle laser light scattering coupled with size exclusion chromatography 1
[0095] Determine the molecular weight of the product by multi-angle laser light scattering coupled with size exclusion chromatography according to the method reported in the literature.
[0096] Sample preparation: Weigh 10 mg of the dried sample and dissolve it thoroughly in 10 mL of ultrapure water, and then filter it through a 0.22 μm filter membrane.
[0097] Size exclusion chromatography conditions: The Agilent 1260 liquid chromatography system is equipped with a Waters Ulturahudrogel TM linear chromatographic column; the mobile phase is phosphate buffer (pH 7.2); the injection volume is 200 μL; the column temperature is at room temperature; the flow rate is set at 0.6 mL / min; a differential refractive index detector is used, and the detector temperature is 35 °C.
[0098] Multi - angle laser scattering instrument: MALLS, Wyatt Technology DAWN HELEOS, Santa Barbara, CA, USA.
[0099] Standard sample: Bovine serum albumin BSA.
[0100] Data acquisition and analysis software: ASTRA software.
[0101] The results are as Figure 2 shown, showing that the weight - average molecular weight of ultra - high molecular weight xanthan gum is 2.91×10 7 Da, far exceeding the molecular weight range of ordinary xanthan gum reported in the literature (2.0×10 6 - 2.0×10 7 Da), belonging to the category of ultra - high molecular weight xanthan gum.
[0102] Meanwhile, this method is used to distinguish between existing xanthan gum products on the market and ultra - high molecular weight xanthan gum products.
[0103] Example 5
[0104] Determination of the molecular weight of products by coupling multi - angle laser scattering instrument with size - exclusion chromatography 2
[0105] According to the method reported in the literature, the molecular weight of the product is determined by coupling a multi - angle laser scattering instrument with size - exclusion chromatography.
[0106] Sample preparation: Weigh 10 mg of the dried sample, dissolve it fully in 10 mL of ultrapure water, and then filter it using a 0.22 - μm filter membrane.
[0107] Size - exclusion chromatography conditions: The Agilent 1260 liquid chromatography system is equipped with a Waters Ulturahudrogel TM linear chromatographic column; The mobile phase is phosphate buffer (pH 7.2); The injection volume is 200 μL; The column temperature is room temperature; The flow rate is set at 0.6 mL / min; A differential refractometer is used, and the detector temperature is 35 °C.
[0108] Multi - angle laser scattering instrument: MALLS, Wyatt Technology DAWN HELEOS, Santa Barbara, CA, USA.
[0109] Standard sample: Bovine serum albumin BSA.
[0110] Data acquisition and analysis software: ASTRA software.
[0111] The results are as Figure 3 shown, showing that the weight - average molecular weight of ultra - high molecular weight xanthan gum is 1.43×108 Da, far exceeding the molecular weight range of ordinary xanthan gum reported in the literature (2.0×10 6 -2.0×10 7 Da), belonging to the category of ultra-high molecular weight xanthan gum.
[0112] At the same time, this method is used to distinguish between existing xanthan gum products in the market and ultra-high molecular weight xanthan gum products.
[0113] Example 6
[0114] Fourier transform infrared spectroscopy was used to identify the primary structural differences among ultra-high molecular weight xanthan gum, ordinary xanthan gum, and the original polysaccharide, trisaccharide gum.
[0115] Take 5 mg of the sample and grind it with KBr to make a tablet, and perform infrared scanning with a Nicolet 170SX infrared spectrometer. The presence or absence of relevant groups was judged based on the presence or absence of spectral peaks at a certain wave number in the spectrum, the amount was judged by the strength of the spectral peaks, and various different groups were distinguished by the width and shape of the spectral peaks. The specific results are as Figure 4 shown. Ultra-high molecular weight xanthan gum and ordinary xanthan gum have basically the same peak pattern, while the original polysaccharide, trisaccharide gum, has a characteristic peak of rhamnose at 1055 cm -1 . This indicates that the polysaccharide produced by the engineered strain is xanthan gum, and the ultra-high molecular weight xanthan gum has basically the same types and contents of functional groups as ordinary xanthan gum. Thus, it can be determined that the structures of the two are the same except for the molecular weight.
[0116] Figure 4 Infrared spectra of ultra-high molecular weight xanthan gum, ordinary xanthan gum, and trisaccharide gum
[0117] Example 7
[0118] Viscosity measurement of ultra-high molecular weight xanthan gum
[0119] Prepare an aqueous solution of ultra-high molecular weight xanthan gum with a concentration of 1.0%, and use the ordinary xanthan gum synthesized by the strain with the preservation number CGMCC NO.15155 as a control. The viscosity change was measured using a TADHR-1 rheometer under the condition of 0.01 - 1001 / s.
[0120] The results are as Figure 5 shown. At an ultra-low shear rate, the viscosity of ultra-high molecular weight xanthan gum is 626 Pa·s, while the viscosity of ordinary xanthan gum is 510 Pa·s; as the shear rate increases, the viscosity difference between ultra-high molecular weight xanthan gum and ordinary xanthan gum gradually increases. This shows that ultra-high molecular weight xanthan gum has a higher viscosity than ordinary xanthan gum.
[0121] Example 8
[0122] Molecular markers and identification methods for ultra-high molecular weight xanthan gum-producing strains and their products
[0123]
[0124] (1) Extract the genome of the strain to be tested or lightly processed products (products containing xanthan gum such as food, daily chemicals, and petroleum grade), and use it as the PCR template;
[0125] (2) The PCR amplification system is as follows: 0.5 μL of DNA template at 10 - 50 ng / μL, 0.4 μL of primer pair (TXM1 / TXM2) at 20 μM, 12.5 μL of premix Taq polymerase, 2 mL of DMSO, and add water to 25 μL;
[0126] (3) The PCR reaction conditions are: pre-denaturation at 95°C for 10 min; 94°C: 45 s, 55°C: 45 s, 72°C: 60 s, for 35 cycles; extension at 72°C for 10 min;
[0127] (4) Detect by electrophoresis and recover the target fragment from the gel. Send the target fragment to a sequencing company for sequencing. The full length is 1001 bp, and the sequencing result is consistent with the expected sequence, that is, the sample to be tested is a strain for producing ultra-high molecular weight xanthan gum or a processed product of ultra-high molecular weight xanthan gum.
[0128] The above is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. An extracellular polymeric Sphingomonas strain T-XM for producing ultra-high molecular weight xanthan gum, characterized in that, Sphingomonas sanxanigenens Based on Sphingomonas sp. strain NXdP, part of the genes related to gellan gum synthesis in Sphingomonas sp. strain NXdP was replaced with the xanthan gum synthesis gene cluster in Xanthomonas campestris pv. campestris ( Sphingomonas sp.). Xanthomonas campestri The structure of the repeating unit in the ultra-high molecular weight xanthan gum is the same as that of the common xanthan gum, and the molecular weight is (2.91~14.3)×10 7 Da; The xanthan gum synthesis gene cluster is obtained by amplification using primers with the DNA of Xanthomonas campestris as a template. The primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO:1 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:
2. The preservation number of the strain T-XM is CGMCC No. 27299.
2. The strain T-XM according to claim 1, wherein The xanthan gum synthesis gene cluster is expressed under the 916 initiation of the promoter of the strain NXdP; The genes related to the synthesis of the partial three-praise glue include orf0831 gene and orf0533 - orf0536 gene.
3. A method for constructing the strain T-XM according to claim 1 or 2, characterized in that, It includes the following steps: Knock out some genes related to sanxan gum synthesis in the Sphingomonas strain NXdP to obtain the defective strain NXdPE. Clone the P promoter fragment in Sphingomonas sp. strain NXdP and the xanthan gum synthesis gene cluster from Xanthomonas campestris pv. campestris into the defective strain NXdPE to obtain the engineered strain T-XM for producing ultra-high molecular weight xanthan gum. 916 4. The construction method according to claim 3, wherein The method of cloning into the defective strain NXdPE involves constructing a recombinant vector with the P 916 promoter fragment, xanthan gum synthesis gene cluster, and upstream and downstream homologous arms of Sphingomonas strain NXdP, conjugating and transferring the recombinant vector into the defective strain NXdPE, and performing single crossover and double crossover screening to obtain the double crossover engineered strain.
5. Use of the strain T-XM according to claim 1 or 2 in the production of ultra-high molecular weight xanthan gum, wherein the structure of the repeating unit of the ultra-high molecular weight xanthan gum is the same as that of ordinary xanthan gum, and the molecular weight is (2.91~14.3)×10 7 Da.
6. The application according to claim 5, characterized in that The repeating structural unit of the common xanthan gum is composed of two glucoses, two mannoses and one glucuronic acid. The structure of the repeating structural unit is that two glucoses are connected to form a main chain through β-1-4-glycosidic bonds. The side chain structure is that two mannoses are separated by one glucuronic acid. Among them, the glucuronic acid is connected to the inner and outer mannoses through β-1-4-glycosidic bonds and β-1-2-glycosidic bonds respectively. The side chain structure is connected to the glucose on the main chain at intervals through β-1-3-glycosidic bonds.
7. A molecular marker for detection, characterized in that, The nucleotide sequence is as shown in SEQ ID NO:
11. The molecular marker is used to detect the strain T-XM described in claim 1 or 2 or to detect the ultra-high molecular weight xanthan gum in the application described in claim 5 or 6.
Citation Information
Patent Citations
Sphingomonas sp. T-3 and method for producing biological polysaccharide and poly-beta-hydroxy-butanoic acid by co-fermentation
CN104651284A
Engineering strain NXdP as well as construction method and application thereof
CN108795969A
Genetically engineered strain for producing gel-state xantham gum as well as construction method and application of genetically engineered strain
CN109706110A
Construction method of xanthan gum high-yield bacteria
CN110777104A