A wine yeast strain containing Hansenula polysaccharide G2, fermentation agents containing Hansenula polysaccharide G2, and their applications.

Abstract

This invention relates to the field of industrial microbiology, specifically disclosing a strain of *Hanseniaspora uvarum* G2, its fermentation agent, and its applications. The *Hanseniaspora uvarum* G2 strain has the preservation number CGMCC No. 25348 and exhibits excellent characteristics such as high production of β-glucosidase (66.03±2.46 U / mL). Its application in winemaking can significantly increase the content of esters and alcohols in wine. Simultaneously, it can increase the content and variety of terpenes in wine, enhance the flavor complexity of wine, and impart rich floral, banana, pear, and apple fruit aromas, thereby giving the wine a distinct regional character.

Description

Technical Field

[0001] This invention relates to the field of industrial microbiology, and more particularly to a strain of Hansenula spores G2 for winemaking, a fermentation agent containing Hansenula spores G2 for winemaking, and its application. Background Technology

[0002] Wine is the world's second most consumed alcoholic beverage after beer, holding a significant position in global regional economies and international trade. In industrial wine production, selected commercial yeasts are typically used for fermentation to ensure controllability and consistency. However, the widespread use of commercial yeasts can reduce the flavor complexity and typicality of wines, leading to product homogenization. With the development of the wine industry, consumers are demanding higher quality wines, creating an urgent need for premium wines that reflect the characteristics of their respective regions and embody local features and styles.

[0003] In recent years, domestic and international studies have shown that non-brewing yeasts play a positive role in enhancing the regional characteristics and flavor complexity of wines. The aroma substances in wine mainly include esters and alcohols, which impart fruity and floral aromas to wines, giving people a comfortable and pleasant feeling. For example, ethyl caprylate gives wine the flavors of apricot, pear and banana; ethyl hexanoate has the flavor of green apple; and phenylethyl alcohol gives wine the flavors of rose and peach.

[0004] Furthermore, β-glucosidase secreted by non-Sacchariform yeasts can hydrolyze bound aromatic compounds, releasing glycosides and monoterpenes that increase the aroma and chemical complexity of wine, raise the content of volatile compounds, and ultimately produce wines with distinctive regional flavors. However, the high-sugar, low-pH environment during wine fermentation severely affects the activity of β-glucosidase in non-Sacchariform yeasts. Therefore, screening for high-yield β-glucosidase-producing non-Sacchariform yeasts with good environmental tolerance and applying them to wine production is of great significance for improving the flavor and quality of wines from specific regions. Summary of the Invention

[0005] To address the issues that the poor environmental tolerance of existing non-brewing yeasts affects the activity of β-glucosidase and the lack of distinct regional style characteristics in wine products, this invention provides a strain of Hansenula polysaccharide G2, a fermentation agent containing Hansenula polysaccharide G2, and its application.

[0006] To solve the above-mentioned technical problems, the technical solution provided by the present invention is as follows:

[0007] In a first aspect, the present invention provides a wine yeast strain Hanseniaspora uvarum G2, with accession number CGMCC No. 25348.

[0008] The wine contains Hanseniaspora uvarum G2, classified as Hanseniaspora uvarum, which was deposited on July 18, 2022, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 25348. The deposit address is: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China.

[0009] The biological characteristics of Hansenula polysaccharide G2 for wine provided by this invention are as follows: on WL medium, the colonies are round with neat borders, the colonies are spherical protrusions, the surrounding area is light green, the center is dark green, and the surface is smooth.

[0010] Preferably, the wine contains Hanseniaspora uvarum G2, which is selected from the surface of Chizhuxia grapes from the grape-producing area of ​​Huailai County, Zhangjiakou City, Hebei Province.

[0011] The wine made using Hansenula polysaccharide G2 provided by this invention can still produce high levels of β-glucosidase under traditional winemaking conditions. β-glucosidase has high enzyme activity under traditional winemaking conditions. When applied to winemaking, it can significantly increase the content of esters and higher alcohols in the wine. At the same time, it can also increase the content of terpenes in the wine, thereby helping to increase the flavor complexity of the wine and giving it a rich floral, banana, pear, and apple fruit aroma. This allows the wine to have regional characteristics, reflect local features and style, and meet people's higher requirements for wine quality.

[0012] Furthermore, the β-glucosidase activity of Hansenula polymorpha G2 in wine provided by the present invention is 66.03±2.46 U / mL.

[0013] Secondly, the present invention also provides a fermentation agent comprising the aforementioned wine yeast Hansenula polysaccharide G2.

[0014] Furthermore, the fermentation agent is a liquid agent, a semi-liquid agent, or a solid agent.

[0015] For example, *Hansenula polymorpha* G2 was inoculated into YPD liquid medium and fermented until the viable count reached 10⁻⁶. 8 A liquid bacterial agent was obtained with a concentration of cfu / mL or higher.

[0016] The above liquid bacterial agent was concentrated to obtain a semi-liquid bacterial agent.

[0017] The above concentration can be achieved using conventional concentration methods in the field, such as centrifugation and filtration, and the present invention does not impose any special requirements.

[0018] Add buffer solution and lyophilization protectant to the above semi-liquid bacterial agent, and adjust the viable count to 10⁻⁶. 10 cfu / mL ~10 12 cfu / mL, freeze-dried to obtain solid bacterial agent.

[0019] The buffer solution described above can be a conventional buffer solution in the art, such as PBS buffer or physiological saline. The lyophilization protectant can also be a commonly used lyophilization protectant in the art, such as at least one of skim milk powder, maltodextrin, dextran, or glycerol.

[0020] Furthermore, the viable concentration of *Hansenula polymorpha* G2 in the fermentation agent is 10. 8 cfu / mL ~10 12 cfu / mL.

[0021] Thirdly, the present invention also provides the application of the above-mentioned wine-producing yeast Hansenula gibberellin G2 or fermentation agent in winemaking, especially in the production of Marselan wine or Longan wine.

[0022] The Hansenula polysaccharide G2 yeast strain provided by this invention can be widely used in the production of wines from various grape varieties in Chinese wine-producing regions, especially suitable for winemaking in Huailai County, Zhangjiakou City, Hebei Province. In terms of wine typicality, it is significantly superior to commercial yeast strains, indicating that the selected strain can reflect the typical characteristics of wines from its origin and has high application value.

[0023] The present invention also provides a method for producing wine, wherein grape raw materials are fermented using the above-mentioned wine yeast Hansenula polysaccharide G2 or any of the above-mentioned fermentation agents to obtain dry red or dry white wine.

[0024] Specifically, the steps for making dry red wine are as follows: Select healthy Marselan grapes, remove the stems and crush them to obtain grape juice. Using the grape juice as raw material, add potassium metabisulfite and pectinase to it. Then, inoculate the grape juice with Hansenula polysaccharide G2 or the fermentation agent mentioned above, mix well, and ferment at pH 3-4 and 25℃-28℃ to obtain dry red wine.

[0025] The specific steps of the above-mentioned method for producing dry white wine are as follows: using crushed, destemmed, and pressed grape juice as raw material, adding potassium metabisulfite and pectinase to the grape juice, then inoculating the grape juice with the above-mentioned wine yeast G2 or the fermentation agent mentioned above, mixing evenly, and fermenting under pH 3-4 and 12℃-16℃ conditions to obtain dry white wine.

[0026] Furthermore, the inoculation amount of *Hansenula polymorpha* G2 in the wine is 1 × 10⁻⁶. 6cfu / mL~1×10 8 cfu / mL.

[0027] Fermentation by *Hansenula polysaccharide* G2 produces a series of metabolites that impart a pleasant and unique flavor to wine. The higher alcohols and esters in these metabolites are directly influenced by the cell density of *Hansenula polysaccharide* G2. An optimal inoculum size ensures appropriate levels of higher alcohols and esters in the wine, as well as suitable alcohol content and fermentation degree, resulting in a richer and more harmonious flavor profile.

[0028] Furthermore, the grape juice raw material is obtained by crushing, destemming, and pressing Marselan or Longan grapes from Huailai County, Zhangjiakou City, Hebei Province.

[0029] It should be noted that *Hansenula polymorpha* G2 needs to be activated before fermentation. Conventional activation methods in this field can be used, such as inoculating *Hansenula polymorpha* G2 into YPD liquid medium and incubating overnight at 28°C on a shaker.

[0030] The wine produced by this invention contains Hansenula polymorpha G2 which can produce high levels of β-glucosidase (66.03±2.46U / mL) and exhibits excellent tolerance. Compared to commercial non-brewing yeast NSD, the Hansenula polymorpha G2 provided by this invention can produce dry red wines with higher ester content (1387.27±142.84 mg / L) and higher alcohol content (1020.09±94.71 mg / L). Specifically, the ethyl acetate content (224.50±15.08 mg / L) is more than twice that of commercial non-brewing yeast NSD, and the contents of 1-propanol and phenylethanol are significantly higher. This significantly increases the fruit and alcohol aromas of the wine. Furthermore, the wines brewed with Hansenula polymorpha G2 have a higher terpene content, more than twice that of commercial non-brewing yeast NSD, which significantly increases the typicality and characteristics of the wine. This results in wines with rich floral and fruity aromas, elegant and harmonious fragrances, a smooth palate, and distinct regional aroma and flavor characteristics, which is of great significance for promoting the development of the wine industry.

[0031] For dry white wines, compared with VL2 inoculation fermentation alone, sequential fermentation of G2 and VL2 results in higher ester (2490.72±17.91 mg / L) and higher alcohol (544.53±14.75 mg / L) content in the wine product, and increases the variety of terpenes (4-terpene alcohol, citronellol, and nerol). In addition, other volatile compounds were detected that were only present in G2 (ethyl 9-decenoate, phenethyl acetate, ethyl butyrate, phenethyl alcohol, n-heptyl alcohol, and 1-octanol). These compounds increase the floral and fruity aromas of the wine, enhance the varietal aromas, and make the wine more typical and characteristic of its region. Attached Figure Description

[0032] Figure 1 The colony morphology of Hansenula polysaccharide G2 on WL solid medium. Detailed Implementation

[0033] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0034] Culture medium used in the examples:

[0035] WL medium (1L): 5g yeast extract, 5g acid-hydrolyzed casein, 50g glucose, 17g agar, 0.55g potassium dihydrogen phosphate, 0.425g potassium chloride, 0.125g calcium chloride, 0.0025g ferric chloride, 0.125g magnesium sulfate, 0.0025g manganese sulfate, 0.022g bromocresol green, pH 5.3-5.7, autoclaved at 121℃ for 20min before use.

[0036] YPD liquid culture medium (1L): 20g glucose, 20g peptone, 10g yeast extract, 1000mL water, natural pH, sterilized at 121℃ for 20min before use.

[0037] YPD solid medium (1L): 20g glucose, 20g peptone, 10g yeast extract, 15g agar, 100mg chloramphenicol (pre-dissolved in a small amount of ethanol), 1000mL water, natural pH, sterilized at 121℃ for 20min before use.

[0038] Screening medium (1L): 10g yeast extract, 20g peptone, 20g glucose, 20g agar, 3g ammonium sulfate, 4g potassium dihydrogen phosphate, 1g p-NPG, 1000mL water, natural pH, sterilized at 121℃ for 20min before use.

[0039] Aescin medium formula (1L): 3g aescin, 0.5g ferric citrate, 2g sodium chloride, 0.5g magnesium sulfate heptahydrate, 0.1g potassium dihydrogen phosphate, 20g agar, 1000mL water, natural pH, sterilize at 121℃ for 20min before use.

[0040] Enzyme-producing culture medium formula (1L): 10g yeast powder, 20g peptone, 20g glucose, 3g sulfuric acid, 4g phosphate, 1000mL water, natural pH value, sterilize at 121℃ for 20min and then use.

[0041] Example 1

[0042] 1. Selection of starting strains

[0043] 1.1 Isolation and screening of fruit surface yeasts

[0044] Aseptically weigh 5g of ripe Chizhuxia grapes from Huailai County, Zhangjiakou City, and place them in 45mL of sterilized 0.9% sodium chloride solution. Shake well to prepare a bacterial suspension. Take 1mL of the bacterial suspension and place it in a thermostatically sterilized YPD liquid culture medium. Incubate at 28℃ (180r / min) for 2 days. Take 1mL of the bacterial suspension and add it to 9mL of sterilized 0.9% sodium chloride solution. Gently shake. Repeat the above operation, serially diluting 10... 2 ~10 7 Add 0.1 mL of bacterial suspension at different concentration gradients to YPD solid medium using a micropipette. Spread the solution evenly using a spreader. Incubate the YPD solid medium in a constant temperature incubator at 28°C, inverted. Set up three replicates for each concentration gradient. Pick single colonies with different appearances and colors from the YPD solid medium and purify them on WL medium using the four-zone streak method. Record the pure cultures obtained. Mix the pure cultures with 40% glycerol solution in an equal proportion, shake well, and store at -80°C.

[0045] 1.2 Screening of β-glucosidase-producing yeast strains

[0046] Initial screening: The yeast strains obtained from the above screening were inoculated onto YPD liquid medium and cultured at 28°C with shaking for 24 hours (180 r / min). The activation solution was then diluted to 10. 4 CFU / mL was inoculated into selection medium and incubated at 28°C for 72 h. Then, a 1 mol / L sodium carbonate solution was sprayed onto the medium. The mold-producing strain decomposes p-NPG to produce p-nitrophenol (p-NP). p-NP reacts with sodium carbonate to produce a yellow substance, forming a clear zone around the colony. The larger the diameter and the deeper the color of the clear zone, the higher the enzyme activity. Single colonies of the target strain were picked and cultured for 48 h. The bacterial solution was then mixed with a 40% glycerol solution in an equal proportion, shaken thoroughly, and stored at -80°C.

[0047] Secondary screening: The target strains selected in the previous step were inoculated onto YPD liquid medium and cultured at 28℃ with shaking for 24 hours (180 r / min). The activated bacterial solution was then inoculated into a medium containing aescin, and observation was performed using 96-well plates. Each strain was inoculated three times. The plates were covered with a sealing film to prevent the medium and bacterial solution in the 96-well plates from contacting the external environment and avoiding contamination. The plates were then incubated statically at 28℃ for 1 day, and the color of the medium was observed for any changes and the degree of color change. Aescin can be converted to aescinogen under the action of β-glucosidase, and aescinogen reacts with ferric ions to produce a brownish-black color. Therefore, the intensity of enzyme production activity of the strain can be judged based on the color of the medium.

[0048] 1.3 Assay of β-glucosidase activity

[0049] The high-β-glucosidase-producing strain obtained from the previous screening was inoculated onto YPD liquid medium and activated by shaking culture at 28°C for 24 h (180 r / min). The inoculum was then transferred to the enzyme-producing medium at a rate of 5% and cultured on a shaker at 28°C for 72 h. The cultured bacterial solution was placed in a refrigerated high-speed centrifuge and centrifuged at 8000 r / min for 10 min at 4°C. The supernatant, i.e., the crude enzyme solution, was collected and used for the next step of analysis and detection.

[0050] Accurately pipette 0.5 mL of crude enzyme solution into a 15 mL centrifuge tube. Then add 1 mL of 35 mM p-NPG solution (pH 5.0) prepared in advance using citrate-phosphate buffer as the solvent. Gently vortex to mix, and react in a water bath at 50 °C for 10 min. Add 8 mL of 1 mol / L sodium carbonate solution to terminate the reaction. After waiting 5 min for color development and stabilization, measure the absorbance under UV light at a wavelength of 400 nm. The blank is YPD liquid culture medium without inoculation under the same treatment.

[0051] Enzyme activity unit (U) is defined as the amount of enzyme required to hydrolyze p-NPG to produce 1 nmol of p-NP in 1 min under reaction conditions of pH 5.0 and 50℃.

[0052] The enzyme activity was measured to be 66.03 ± 2.46 U / mL.

[0053] Example 2

[0054] Identification of enzyme-producing strains

[0055] 1.1 Ecological Observation

[0056] Strain G2 was inoculated onto WL medium and incubated in a 28°C incubator for about 48 hours. The colony morphology, colony edge, color, and transparency on the medium were then observed.

[0057] On WL medium, strain G2 colonies are round with regular borders, spherical protrusions, light green around the edges and dark green in the center, with a smooth, opaque surface. Figure 1 As shown.

[0058] 1.2 Molecular biological identification

[0059] DNA extraction: Follow the instructions for the PlantZol genomic extraction kit.

[0060] PCR amplification: PCR amplification was performed using the universal primers ITS1 (5'-TCCGTAGGTGAACCTGCG G-3') and ITS4R (5'-TCCTCCGCTTATTGATATGC-3').

[0061] PCR amplification was performed using a 50 μL reaction system, which included: 5.0 μL of 10×Ex Taq buffer, 4.0 μL of 2.5 mM dNTP Mix, 2.0 μL of 10p primer 1, 2.0 μL of 10p primer 2, 0.5 μL of 5U Ex Taq (5 U / μL), 2.0 μL of DNA template (20 μg / μL), and 34.5 μL of ddH2O.

[0062] PCR reaction conditions: First, pre-denaturation at 94℃ for 3 min; then denaturation at 94℃ for 30 s, annealing at 54℃ for 30 s, extension at 72℃ for 1.5 min, for a total of 24 cycles, and a final extension at 72℃ for 10 min. PCR product detection and gel recovery: Products were electrophoresed in a 0.8% gel at 150V for 20 min. The PCR products were then recovered by gel cutting. PCR amplification and sequencing were performed by Ruiboxingke Biotechnology Co., Ltd., using the Sanger sequencing method. The sequencing results for ITS rDNA are as follows:

[0063] CCTGATTGATATCTTGTTGCTCGAGTTCTTGTTTAGATCTTTTACAATAATGTGTATCTTTATTGAAGATGTGCGCTTAATTGCGCTGCTTCTTTAGAGTGTCGCAGTGAAAGTAGTCTTGCTTGAATCTCAGTCAACGCTACACACATTGGAGTTTTTTACTTTAATTTAATTCTTTCTGCTTTGAATCCAAAGGGTC AAGGGAAAAAACAAACAACAATTTTATTTTATTATAATTTTTTAAACTAAACCAAAATTCCTAACGGAAATTTTAAAATAATTTAAAACTTTCAACAACGGATCTCTTGGGTCTCCCCTCCATGAAAAACCTAGCCAATTGCCAAAAGTAATGGGAATTGCCGATACTCCTGAATCATTGAATTTTTGAACCCCCCTTGCCCCCTTGAACATTCTCAGGGGCATGCCTGGTTGAA CCTATTTCCTTCTCCAAAGATAATTTATTATTTTTTGGGTGGGGGCCATACTCCAGGGTAGCTTGGATTGGAGACTGGTTCCGTCCTTATTATTCCACATTAGCTTCCTGGAACCTGGTTTGCTGATGTAATATTGAATATCCCTTACCTACAGGATGGTACCTACCTTAGCAAGGTGCCTCAATCATCAGTTTGACCTCAATCAGGAGATTACGTGACTTAGCATATCTAACCGAG.

[0064] The ITS rDNA sequence of Hanseniaspora uvarum strain G2 was compared with sequences in the GenBank database, confirming that strain G2 is Hanseniaspora uvarum.

[0065] This wine contains Hanseniaspora uvarum G2, which was deposited on July 18, 2022, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCCNo.25348. The deposit address is: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China.

[0066] Example 3

[0067] Evaluation of the stress resistance of β-glucosidase produced by yeast strains obtained through secondary screening, including resistance to high sugar, ethanol, metal ions, acid, and SO2.

[0068] 3.1 Evaluation of glucose tolerance

[0069] YPD liquid culture media with different glucose concentrations (5%, 10%, 15%, 20%) were prepared. *Hansenula polymorpha* G2 was inoculated into each of the YPD liquid culture media with a different glucose concentration, with an inoculation volume of 10 μL. 6 The culture medium was incubated at 28°C with shaking for 72 hours at cfu / mL. A standard YPD liquid medium (2% glucose concentration) with added bacterial culture was used as a control group. Enzyme activity was determined according to the method in Example 1 (1.3).

[0070] 3.2 Ethanol tolerance evaluation

[0071] YPD liquid culture media with different ethanol concentrations (3%, 6%, 9%, 12%) were prepared. *Hansenula polymorpha* G2 was inoculated into each of the different ethanol concentrations at an inoculation volume of 10 μL. 6 The culture medium was incubated at 28°C with shaking for 72 hours using cfu / mL. A standard YPD medium with added bacterial culture was used as a control group. Enzyme activity was determined according to the method described in Example 1 (1.3).

[0072] 3.3 Metal ions

[0073] Different metal ions (Zn) were added at 5 mmol / L to YPD liquid culture medium. 2+ Mg 2+ Cu 2+ Ca 2+ Fe 2+ Mn 2+ Hansenula spores G2 was inoculated into YPD liquid medium containing different metal ions at an inoculation volume of 10 g / L. 6 The culture medium was incubated at 28°C with shaking for 72 hours using cfu / mL. A standard YPD medium with added bacterial culture was used as a control group. Enzyme activity was determined according to the method described in Example 1 (1.3).

[0074] 3.4 pH

[0075] The pH values ​​of YPD liquid culture medium were adjusted to 2.0, 2.5, 3.0, and 3.5, respectively. *Hansenula polymorpha* G2 was then inoculated into YPD liquid culture media at different pH values, with an inoculation volume of 10 μL. 6 The culture medium was incubated at 28°C with shaking for 72 hours using cfu / mL. A standard YPD medium with added bacterial culture was used as a control group. Enzyme activity was determined according to the method described in Example 1 (1.3).

[0076] 3.5 Sulfur dioxide

[0077] Potassium metabisulfite was added to YPD liquid medium to adjust the SO2 concentration to 40 mg / L, 60 mg / L, 80 mg / L, and 100 mg / L. *Hansenula polymorpha* G2 was then inoculated into YPD liquid medium at different SO2 concentrations at an inoculation volume of 10 μL. 6 The culture medium was incubated at 28°C with shaking for 72 hours using cfu / mL. A standard YPD medium with added bacterial culture was used as a control group. Enzyme activity was determined according to the method in Example 1 (1.3). The results are shown in Table 1.

[0078] Table 1

[0079]

[0080]

[0081] As can be seen from the table, the relative enzyme activity of strain G2 was continuously inhibited with the increase of glucose concentration. However, when the glucose concentration was 15%, the relative enzyme activity of strain G2 was still as high as 83.61%. When the glucose concentration was 20%, the relative enzyme activity of β-glucosidase of strain G2 was still maintained at 67.81%, which verifies that non-Saccharomyces cerevisiae G2 has the ability to produce glucose-resistant β-glucosidase.

[0082] The growth and reproduction of Hansenula polysaccharide G2 in wine is strongly inhibited by high concentrations of ethanol, which in turn affects the activity of β-glucosidase. When the ethanol concentration is 6%, the relative enzyme activity of G2 strain can still reach 80%, but as the ethanol concentration continues to increase, its relative enzyme activity decreases significantly.

[0083] For wine containing Hansenula polymorpha G2, Mg 2+ Mn 2+ and Ca 2+ Three metal ions have an activating effect on the activity of β-glucosidase secreted by the organism, while Zn... 2+ and Fe 2+ The two metal ions will inhibit the activity of the secreted β-glucosidase, but its relative enzyme activity can still be maintained above 75%.

[0084] At pH 2, the β-glucosidase activity secreted by strain G2 decreased to below 25%. This is because excessively low pH alters the spatial structure of the enzyme protein, thus affecting enzyme activity. As the pH of the culture medium increased, enzyme activity increased to varying degrees. When the pH reached 3.5, the β-glucosidase activity secreted by strain G2 exceeded 50% of the control group. The pH of grape juice and commercially available wine is generally between 3 and 4. Within this range, strain G2 exhibited good enzyme activity, indicating that it is well-suited to the low-pH fermentation environment of wine.

[0085] When the SO2 addition was 40 mg / L, the enzyme activity of strain G2 was higher than that of the control group; when the SO2 addition was 60 mg / L, the enzyme activity of strain G2 decreased slightly; as the SO2 addition increased, the enzyme activity of the secreted β-glucosidase was continuously inhibited, but the relative enzyme activity remained above 80%, indicating that the β-glucosidase secreted by yeast strain G2 has good tolerance to sulfur dioxide.

[0086] Example 4

[0087] Hansenula polymorpha G2 is used in the production of dry red wine.

[0088] 1. Fermentation experiment

[0089] Sampling was conducted at a perennial, high-quality vineyard in Huailai County, Zhangjiakou City. Healthy, fresh Marselan grapes with undamaged skins were selected for harvesting. The juice from the destemmed and crushed Marselan grapes was used as raw material. *Hansenula polymorpha* G2 was used as the fermentation agent. 8L of Marselan grape juice was placed in a clean 12L glass bottle, and 75g / t of potassium metabisulfite and 30g / t of pectinase were added. After mixing thoroughly, the mixture was soaked at 10℃ for 72 hours. Then, activated *Hansenula polymorpha* G2 suspension was inoculated at an inoculum size of 10... 6 CFU / mL, with commercially active non-Saccharomyces cerevisiae (NSD) as a control (20 g / 100 L). After adding the yeast mixture to the fermentation vessel, ensure the yeast solution is thoroughly mixed within the fermenter. Perform static fermentation at 25°C and pH 3.5 until residual sugar is less than 7.5 g / L and the difference between total sugar and total acid is less than or equal to 2.0 g / L, at which point fermentation is complete.

[0090] 2. Detection of volatile compounds

[0091] Extraction of volatile aroma components: 7.5 mL of wine was transferred to a 20 mL glass headspace vial, and 10 μL of 3-octanol aqueous solution (300 mg / L) was added as an internal standard, along with 2 g of NaCl to facilitate aroma volatilization. The aroma was determined using a semi-quantitative internal standard method. The vial was then equilibrated in a 40 °C water bath for 15 min, followed by SPME fiber headspace extraction at constant temperature for 40 min. Finally, the vial was manually injected into the GC inlet for 6 min for analysis.

[0092] Qualitative analysis was performed using full scan mode (SCAN), and quantitative analysis was performed using ion scan mode (SIM). Mass spectra were compared with the NIST 14 library, and components with a matching degree of 80% or higher were analyzed. Semi-quantitative analysis of volatile compounds was performed using the internal standard method. The results are shown in Table 2.

[0093] Table 2

[0094]

[0095] Esters and alcohols are the main volatile aroma compounds in wine. Esters are the most abundant in almost all wines, followed by alcohols and fatty acids. The ester content in dry red wine made from the G2 strain reached (1387.27±142.84) mg / L, significantly higher than that of commercial yeast NSD (919.75±121.28) mg / L, classifying it as a high-ester-producing strain. Acetates are formed during the production of higher alcohols through the degradation of amino acids or sugars and acetyl-CoA. Generally, studies suggest that acetates have a greater impact on the fruit aromas of wine than fatty acid ethyl esters. Three acetate esters (ethyl acetate, isoamyl acetate, and hexyl acetate) were detected in the dry red wine made from the G2 strain. The content of ethyl acetate (224.50±15.08 mg / L) was more than twice that of the commercial yeast NSD (107.84±14.37 mg / L), indicating a greater enhancement of fruity aromas in the wine compared to the commercial yeast. The content of hexyl acetate (27.26±2.73 mg / L) was more than three times that of the commercial yeast NSD (6.27±0.51 mg / L), which imparts aromas of apple, cherry, and pear to the wine. Furthermore, the content of ethyl hexanoate and ethyl octanoate, among other fatty acid esters, in the dry red wine made from the G2 strain was also significantly higher than that in the commercial yeast NSD.

[0096] The alcohol content (1020.09±94.71 mg / L) in dry red wine made from the G2 strain was higher than that of the commercial yeast NSD. Furthermore, the levels of 1-propanol and phenylethanol in the G2 strain were significantly higher than those in the commercial yeast NSD, which would significantly enhance the aroma and flavor of the wine. In addition, the styrene content in the G2 strain was more than twice that of the commercial non-brewing yeast NSD, which could significantly increase the pear aroma in the wine.

[0097] Example 5

[0098] Hansenula polymorpha G2 is used in the production of dry white wines.

[0099] 1. Fermentation experiment

[0100] Sampling was conducted at a perennial, high-quality vineyard in Huailai County, Zhangjiakou City. Healthy, fresh longan grapes with undamaged skins were harvested, destemmed, crushed, and pressed by hand. The juice was then mixed with 80g / t potassium metabisulfite and 15g / t pectinase, clarified at 6-8℃ for 48 hours, and 250mL of the juice was placed in a sterile 500mL Erlenmeyer flask. The flask was sterilized at 70℃ for 20 minutes, cooled to room temperature, and the process was repeated twice to kill any contaminating microorganisms. The activated wine was then inoculated with a suspension of *Hansenula polymorpha* G2 at a rate of 10... 6 After 48 hours, commercially available active dry yeast VL2 (20 g / 100 L) was inoculated at cfu / mL. Fermentation with commercially available active dry yeast VL2 (20 g / 100 L) alone served as a control. When adding the yeast mixture to the fermentation vessel, ensure thorough mixing. Static fermentation was carried out at 14°C and pH 3.5 until the residual sugar content was less than 4.0 g / L, at which point fermentation was considered complete.

[0101] 2. Detection of volatile compounds

[0102] Extraction of volatile aroma components: 7.5 mL of wine was transferred to a 20 mL glass headspace vial, and 10 μL of 3-octanol aqueous solution (300 mg / L) was added as an internal standard, along with 2 g of NaCl to facilitate aroma volatilization. The aroma was determined using a semi-quantitative internal standard method. The vial was then equilibrated in a 40 °C water bath for 15 min, followed by SPME fiber headspace extraction at constant temperature for 40 min. Finally, the vial was manually injected into the GC inlet for 6 min for analysis.

[0103] Qualitative analysis was performed using full scan mode (SCAN), and quantitative analysis was performed using ion scan mode (SIM). Mass spectra were compared with the NIST 14 library, and components with a matching degree of 80% or higher were analyzed. Semi-quantitative analysis of volatile compounds was performed using the internal standard method. The results are shown in Table 3.

[0104] Table 3

[0105]

[0106] Esters and alcohols are the main volatile aroma compounds in wine. The ester content in wine samples fermented sequentially by G2 and VL2 reached (2490.72±17.91) mg / L, significantly higher than that of commercial brewing yeast VL2 (1063.79±21.34) mg / L, indicating a high ester-producing strain. Acetates are formed through the degradation of amino acids or sugars and acetyl-CoA along with the production of higher alcohols. Generally, studies suggest that acetates have a greater impact on the fruit aromas of wine than fatty acid ethyl esters. Four acetates (ethyl acetate, isoamyl acetate, hexyl acetate, and phenylethyl acetate) were detected in dry white wines fermented by the G2 strain, all higher than those fermented by VL2 alone. Furthermore, the content of fatty acid ethyl esters such as ethyl caprylate, ethyl hexanoate, and ethyl decanoate in wine samples fermented sequentially by G2 and VL2 was also significantly higher than that of commercial yeast NSD, significantly increasing the fruit and floral aromas in the wine.

[0107] The alcohol content in the wine samples fermented sequentially by G2 and VL2 (544.53±14.75 mg / L) was significantly higher than that of commercial yeast VL2 (86.37±4.62 mg / L). Three terpenoid compounds were also detected: 4-terpene alcohol, citronellol, and nerol. The sensory thresholds of the terpenoid compounds are very low. Their presence gives the wine a rich floral and fruity aroma, thereby enhancing the varietal aroma and giving the wine its typical characteristics and terroir style.

[0108] The results above show that the strain with accession number CGMCC No.25348 selected in this invention has good resistance to acid, sulfur dioxide, high sugar and alcohol, and has the excellent characteristic of high production of β-glucosidase. Wines made from it have local biochemical characteristics and can produce more prominent and richer regional aroma components, which is of great significance for brewing distinctive and high-quality dry red and dry white wines.

[0109] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A wine vine contains Hansenula polymorpha ( Hanseniaspora uvarum G2, characterized in that, and has a preservation number of CGMCC No. 25348.

2. A fermentation inoculant characterized by, The wine Hanseniaspora uvarum G2 of claim 1.

3. The fermentation inoculant of claim 2, wherein, The fermentation agent is a liquid bacterial agent.

4. The fermentation inoculant of claim 2 or 3, wherein The viable cell concentration of wine Hanseniaspora occidentalis G2 in the fermentation inoculum is 10 8 cfu / mL ~ 10 12 cfu / mL.

5. The wine Hanseniaspora uvarum G2 of claim 1 or the fermentation agent of any one of claims 2-4 is used in brewing dry red or dry white wine.

6. A method of producing wine, characterised in that, The wine Hanseniaspora uvarum G2 of claim 1 or the fermentation agent of any one of claims 2-4 is used in brewing dry red or dry white wine.

7. The method of producing wine according to claim 6, wherein, The specific steps are as follows: potassium metabisulfite and pectinase are added to grape juice, mixed evenly, then the wine Hanseniaspora uvarum G2 of claim 1 or the fermentation agent of any one of claims 2-4 is inoculated into the grape juice, mixed evenly, fermented, and dry red or dry white wine is obtained.

8. The method of producing wine according to claim 7, wherein, The inoculation amount of the wine Hanseniaspora uvarum G2 is 1 x 10 6 cfu / mL ~ 1 x 10 8 cfu / mL.

Images